WO2001055189A1 - NOUVEAU POLYPEPTIDE, SECp43, 32 S'ASSOCIANT AVEC L'ARNt DE LA SELENOCYSTEINE HUMAINE, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE - Google Patents

NOUVEAU POLYPEPTIDE, SECp43, 32 S'ASSOCIANT AVEC L'ARNt DE LA SELENOCYSTEINE HUMAINE, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE Download PDF

Info

Publication number
WO2001055189A1
WO2001055189A1 PCT/CN2001/000070 CN0100070W WO0155189A1 WO 2001055189 A1 WO2001055189 A1 WO 2001055189A1 CN 0100070 W CN0100070 W CN 0100070W WO 0155189 A1 WO0155189 A1 WO 0155189A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
secp43
specific
human
Prior art date
Application number
PCT/CN2001/000070
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biodoor Gene Technology Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biodoor Gene Technology Ltd. Shanghai filed Critical Biodoor Gene Technology Ltd. Shanghai
Priority to AU2001231484A priority Critical patent/AU2001231484A1/en
Publication of WO2001055189A1 publication Critical patent/WO2001055189A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human selenocysteine tRNA-specific related protein SECp43, 32, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • Human selenocysteine tRNA-specific related protein SECp43 is a new RNA-binding protein involved in the regulation of selenocysteine tRNA during the ribosome complex translation process and involves the correct synthesis of related proteins.
  • the human selenocysteine tRNA-specific related protein SECp43 has two nucleoprotein binding domains and a polar / acidic carboxyl terminus. It specifically binds to selenocysteine tRNA (tRNA- Sec), and selenocysteine tRNA is a very rare tRNA in the body.
  • tRNA- Sec selenocysteine tRNA
  • a 48 kDa protein that interacts with the recombinant SECp43 protein can be isolated using the yeast two-hybrid system, which may be a protein inserted into the mammalian selenocysteine pathway.
  • the human selenocysteine tRM-specific related protein SECp43 is specifically and highly expressed in a variety of malignancies, and that the expression level of this gene in the pathological tissue of primary malignant gliomas is normal in adult brain 3.5 times of tissue; specific high expression in colon adenocarcinoma caused by p53 mutation, but not expressed in control normal human colonic epithelium; specific high expression of this gene in primary ovarian adenocarcinoma . This shows that this gene is closely related to the occurrence and development of tumors.
  • the human selenocysteine tRM-specific related protein SECp43 of the present invention is involved in the correct translation of the protein and is closely related to a variety of malignancies such as primary malignant glioma, colon adenocarcinoma, and primary ovarian adenocarcinoma. It is of great significance for disease treatment and diagnosis.
  • the human selenocysteine tRNA-specific related proteins SECp43, 32 proteins play an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. There has been a need to identify more human selenocysteine tRNA-specific proteins SECp43, 32 proteins involved in these processes, especially the amino acid sequence of this protein. Isolation of the new human selenocysteine tRM-specific related protein SECp43, 32 protein encoding gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human selenocysteine tRNA-specific related protein SECp43, 32.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human selenocysteine tRNA-specific related protein SECp43, 32.
  • Another object of the present invention is to provide a human selenocysteine tRNA-specific related protein.
  • Another object of the present invention is to provide antibodies against the polypeptide of the present invention-human selenocysteine tRNA-specific related proteins SECp43, 32.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human selenocysteine tRNA-specific related proteins SECp43, 32.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human selenocysteine tRM-specific proteins SECp43,32.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having an amino acid sequence of SBQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 28-891 in SEQ ID NO: 1; and (b) a sequence having 1-1012 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a screening method for mimicking, activating, antagonizing or inhibiting human selenocysteine tRNA characteristics.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human selenocysteine tRNA-specific proteins SECp43, 32 in vitro, which comprises detecting the polypeptide or a polynucleoside encoded therein in a biological sample. Mutations in the acid sequence, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the polypeptides and / or polynucleotides of the present invention which are prepared for use in the treatment of cancer, developmental or immune diseases or other abnormal expressions of human selenocysteine tRNA-specific proteins SECp4 3, 32. Use of drugs that cause disease.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genome or a synthesis DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similar The term “immunologically active” refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human selenocysteine tRNA-specific proteins SECp43, 32, can cause the protein to change, thereby regulating the activity of the protein.
  • Agonists may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human selenocysteine tRM-specific related proteins SECp43, 32.
  • Antagonist refers to a protein SECp43 that can block or regulate human selenocysteine tRM when it is combined with human selenocysteine tRNA-specific proteins SECp43, 32 32 biologically or immunologically active molecules.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human selenocysteine tRNA-specific related proteins SECp43, 32.
  • Regular refers to a change in the function of the human selenocysteine tRNA-specific proteins SECp43, 32, including an increase or decrease in protein activity, a change in binding properties, and a human selenocysteine tRNA-specific correlation Changes in any other biological, functional or immune properties of the proteins SECp43, 32.
  • Substantially pure 1 refers to other proteins, lipids, carbohydrates, or other substances with which it is not naturally associated. Those skilled in the art can purify human selenocysteine tRM specificity using standard protein purification techniques.
  • Related proteins SECp43, 32 Essentially pure human selenocysteine tRNA Specific related proteins SECp43, 32 produce a single main band on a non-reducing polyacrylamide gel. Human selenocysteine tRNA The purity of the specific related proteins SECp43, 32 can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wi s.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun He in (He in J., (1990) Methods in emzumology 183: 625-645) 0 "similarity" is Refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment between amino acid sequences.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? 7, which specifically bind to the epitopes of human selenocysteine tRNA-specific proteins SECp43, 32.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not Components of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • the isolated human selenocysteine tRNA-specific related protein SECp43, 32 refers to the human selenocysteine tRNA-specific related protein SECp43, 32 which is substantially free of other proteins naturally associated with it , Lipids, sugars or other substances.
  • Those skilled in the art can purify human selenocysteine tRNA-specific related proteins SECp43, 32 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on a non-reducing polyacrylamide gel. The purity of human selenocysteine tRNA-related proteins SECp43, 32 can be analyzed by amino acid sequence analysis.
  • the present invention provides a new polypeptide-human selenocysteine tRM-specific related protein
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • Polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of the human selenocysteine tRNA-specific related proteins SECp43, 32.
  • fragment As used in the present invention, the terms “fragment”, “derivative” and “analog” refer to those that substantially maintain the same biological function or activity of the human selenocysteine tRNA-specific related proteins SECp43, 32 of the present invention. Peptide.
  • a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of an amino acid encoding SEQ ID NO: 2 Polynucleotide composition of a polypeptide of the amino acid sequence.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1012 bases in total length and its open reading frame 28-891 encodes 287 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 98% homology with the selenocysteine tRNA-specific related protein, and the human selenocysteine tRNA-specific related protein can be inferred
  • SECp43, 32 has similar structures and functions to selenocysteine tRNA-specific related proteins.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the invention relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) 1 ° / ⁇ When hybridizing with a denaturant, such as 50% (v / v) formamide, 0.1 ° /.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • the invention also relates to nucleic acid fragments that hybridize to the sequences described above.
  • “core The "acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides in length.
  • Nucleic acids The fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human selenocysteine tMA-specific related proteins SECp43, 32.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human selenocysteine tRNA-specific related proteins SECp43, 32 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA 'sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the CDM of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene).
  • CDNA library is constructed in a conventional method (Sambrook, etal., 'Mo l ecul ar Cl oning, A Labora tory Manua l, Col d Spr ing Harbor Labora tory. New York, 1989) 0 may be obtained commercially available cDNA library of , Such as different CDM libraries from Cl ontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-MA or DNA-RNA hybridization; (2) the appearance or loss of marker gene function; (3) determination of human selenocysteine tRM-specific related protein SECp43, Level of transcript of 32; (4) detecting protein products of gene expression by immunological techniques or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2,000 nucleotides, and preferably within 1,000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the RACE method RACE-cDM terminal rapid amplification method
  • the primers used for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
  • the amplified DM / MA fragment can be separated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various MA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human selenocysteine tRNA-specific related proteins SECp43, 32, and recombinant Technology A method of producing a polypeptide of the invention.
  • a polynucleotide sequence encoding human selenocysteine tRNA-specific related proteins SECp43, 32 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing the DNA sequence encoding human selenocysteine tRNA-specific related proteins SECp43, 32 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and Green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and Green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human selenocysteine tRNA-specific related protein SECp43, 32 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute the polynucleotide or the recombinant.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant human selenocysteine tRNA-specific related proteins SECp43, 32 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • polynucleotide or variant
  • encoding the human human selenocysteine tRNA-specific related proteins SECp43, 32 of the present invention, or a recombinant expression vector containing the polynucleotide for transformation or transduction A suitable host cell;
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • Fig. 1 is a comparison diagram of amino acid sequence homology of the human selenocysteine tRNA-specific related proteins SECp43, 32 and selenocysteine tRNA-specific related proteins of the present invention.
  • the upper sequence is human selenocysteine tRNA-specific related proteins SECp43, 32, and the lower sequence is selenocysteine tRM-specific related proteins.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human selenocysteine tRNA-specific related proteins SECp43, 32.
  • 32KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Quik mRNA I solat ion Ki t (Qiegene) Isolate poly (A) mRNA from total RNA. 2ug poly (A) mRM forms cDNA by reverse transcription.
  • a Smart cDNA cloning kit (purchased from Clontech; ⁇ cDNA fragment was inserted into the multicloning site of pBSK (+) vector (Clontech)) to transform DH5 ⁇ to form a cDNA library.
  • Dye terminate cycle react ion sequencing Kit Perkin-Elmer
  • ABI 377 Auto Sequencer CPerkin-Elmer determined the sequences at the 5 'and 3' ends of all clones. Comparing the determined cDNA sequence with an existing public DNA sequence database (Genebank), it was found that the cDNA sequence of one of the clones 0319c04 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the 0319c04 clone contains a full-length cDNA of 1012bp (as shown in Seq ID NO: l), and has an 864bp open reading frame (0RF) from 28bp to 891bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • This clone pBS-0319c04 and the encoded protein was named human selenocysteine tRNA-specific related proteins SECp43, 32.
  • Example 2 Homologous search of cDNA clones
  • the sequences of the human selenocysteine tRNA-specific related proteins SECp43, 32 of the present invention and their encoded protein sequences were analyzed using the Blas t program (Basicloca l Al ignment search tool) [Al tschul, SF et a l. J. Mol. Biol. 1990; 215: 403-10], homology search was performed in databases such as Genbank, Switzerland, and so on.
  • the gene with the highest homology to the human selenocysteine tRNA-specific related proteins SECp43, 32 is a known selenocysteine tRNA-specific related protein, and the protein encoded by it is in Genbank The accession number is AF181856.
  • Example 3 Cloning of genes encoding human selenocysteine tRNA-specific proteins SECp43, 32 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5 GGCAAAGCCCCACCCCGGTGCGCG-3, (SEQ ID NO: 3)
  • Pr imer 2 5,-TCTCCAAAAACAGTCATTATTAAA -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence starting from the Ibp at the 5 ′ end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 ⁇ l of Kol, L KC1, 10 mmol / L Tris-CI, ( ⁇ 8.5 ⁇ ), 1.5 mmol / L MgCl 2 , 20 ( ⁇ mol / L) L dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech). Reaction was performed on a PE9600 MA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec 72 ° C 2min. Simultaneously set ⁇ -act in during RT-PCR For positive control and template blank as negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DM sequence of the PCR product was exactly the same as l-1012bp shown in SEQ ID NO: 1.
  • Example 4 Analysis of human selenocysteine tRNA-specific protein SECp 4 3 , 32 gene expression by Nor thern blot:
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) Centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • 32P-labeled probe (about 2 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RM was transferred at 42 ° C overnight in a solution containing 50% formamide-25niM H 2 P0 4 ( pH 7.4) -5 SSC-5 ⁇ Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human selenocysteine tRNA-specific related proteins SECp43, 32
  • Pr imer3 5'- CATGCTAGCATGGCGGCCAGCCTGTGGATGGGC -3 '(Seq ID No: 5)
  • Pr imer4 5'- CCCAAGCTTCTACATCATGGCAGGGATCTCTGA -3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Nhel and Hindl ll digestion sites, respectively, followed by the 5 'and 3' ends of the target gene, respectively.
  • Sequences, Nhel and Hindl11 restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3).
  • the pBS-0319c04 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0319c04 plasmid, primers Primer-3 and? ⁇ 61: -4 points plus! Is 1 ( ⁇ 11101, Advantage polymerase Mix (Clontech)) 1 ⁇ 1.
  • Cycle parameters 94.C 20s, 60.C 30s, 68 ° C 2 min, a total of 25 cycles.
  • Nhel and Hindl11 were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5a by the calcium chloride method.
  • polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43.
  • Example 7 Use of a polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • the selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt): '
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And Helle, RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDMs were used as target DNA, including the polynucleotides of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ !. The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from normal brain and brain cancer in one step, and mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5-Amino- propargyl-2 ' -deoxyur idine 5'-tr iphate coupled to Cy3 f luorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of normal brain tissue
  • the fluorescent reagent Cy5dUTP (5-Amino-pr opargy 1-2 '-deoxyur idine 5'- tr iphate coupled to Cy5 f luorescent dye (purchased from Amersham Phamacia Biotech) was used to label brain cancer tissue mRNA, and the probe was prepared after purification.
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • Human selenocysteine tRNA-specific related protein SECp43 is a new RM-binding protein that is involved in the regulation of selenocysteine tRNA during the ribosome complex translation process and involves the correct synthesis of related proteins.
  • the characteristic sequence of the human selenocysteine tRNA-specific related protein SECp43 family is necessary for its biological activity.
  • Abnormal expression of the polypeptide human selenocysteine tMA-specific related protein SECp43 of the present invention will cause abnormal translation of the protein and cause related diseases.
  • the abnormal expression of the human selenocysteine tRNA-specific related proteins SECp43, 32 of the present invention will produce various diseases, especially various tumors, embryonic development disorders, and growth disorders. These diseases include But not limited to:
  • Tumors of various tissues primary malignant glioma, colon adenocarcinoma, primary ovarian adenocarcinoma, stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, nerve Cell tumor, astrocytoma, ependymoma, glioblastoma, neurofibromas, colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, uterine cancer, uterus Endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal and sinus cancer, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma
  • Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, urethra Inferior cleft, amphoteric deformity, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, cerebral palsy, mental retardation, mental retardation, familial cerebral neurodevelopmental syndrome, strabismus, skin, fat, and muscular dysplasia such as congenital skin relaxation, albinism, Alzheimer's disease, congenital keratosis, bone and joint dysplasia such as cartilage dysplasia, epiphyseal dysplasia, metabolic bone disease, various metabolic defects such as various amino acid metabolic defects, dementia, dwarfism, Cushing syndrome, sexual retardation
  • Abnormal expression of the human selenocysteine tRNA-specific related proteins SECp43, 32 of the present invention will also cause certain hereditary, hematological and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic developmental disorders, growth and development disorders, and certain inheritances. Sexual, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human selenocysteine tRM-specific related proteins SECp43, 32. Agonists enhance human selenocysteine tRNA-specific proteins SECp43, 32 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing human selenocysteine tRNA-specific related proteins SECp43, 32 can be labeled with a labeled human selenocysteine tRNA-specific related protein SECp43 in the presence of a drug, 32 cultivated together. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of the human selenocysteine tRM-specific related protein SEC P 43, 32 include selected antibodies, compounds, receptor deletions, and the like.
  • An antagonist of the human selenocysteine tRNA-specific related protein SECp43, 32 can bind to the human selenocysteine tRNA-specific related protein SECp43, 32 and eliminate its function, or inhibit the production of the polypeptide, or It is the binding to the active site of the polypeptide that makes the polypeptide unable to perform biological functions.
  • the human selenocysteine tRNA-specific related protein SECp43, 32 can be added to the bioanalytical assay, and by measuring the compound against the human selenocysteine tRNA-specific related protein SECp43, 32 and its receptors to determine if a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human selenocysteine tRNA-specific related proteins SECp43, 32 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, the human selenocysteine tRNA-specific protein SECp43, 32 molecules should be generally processed. Line tag.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the present invention also provides antibodies against the human selenocysteine tRNA-specific related proteins SECp43, 32 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human selenocysteine tRNA-specific proteins SECp43, 32 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response. , Including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to human selenocysteine tRNA-specific proteins SECp43, 32 include, but are not limited to, hybridoma technology (Kohler and
  • Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (U.S.
  • Pat No. 49467778 can also be used to produce anti-human selenocysteine tRNA-specific related proteins
  • Anti-human selenocysteine tMA-specific related proteins SECp43, 32 antibodies can be used in immunohistochemistry to detect human selenocysteine tRNA-specific related proteins in biopsy specimens
  • Monoclonal antibodies that bind to human selenocysteine tRNA-specific proteins SECp43, 32 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human selenocysteine tRNA specific related protein SECp43, 32 high affinity monoclonal antibody can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human selenocysteine tRM specific Sex-related protein SECp43, 32 positive cells.
  • the antibodies of the present invention can be used to treat or prevent proteins specifically related to human selenocysteine tRNA
  • SECp43, 32 related diseases administration of appropriate doses of antibodies can stimulate or block the production or activity of human selenocysteine tRNA-specific proteins SECp43, 32.
  • the invention also relates to quantitative and localized detection of human selenocysteine tRNA-specific related proteins
  • SECp43 3.2 diagnostic test method. These tests are well known in the art and include FISH assays and radioimmunoassays. Human selenocysteine tMA-specific protein SEC P 43, 32 levels can be used to explain the importance of human selenocysteine tRNA-specific proteins SECp43, 32 in various diseases and to diagnose human selenocysteine tRNA-specific related proteins
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human selenocysteine tMA-specific related proteins SECp43, 32 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat cell proliferation, development or metabolic abnormalities caused by the non-expression or abnormal / inactive expression of the human selenocysteine tRNA-specific proteins SECp43, 32.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human selenocysteine tRM-specific proteins SECp43, 32 to inhibit endogenous human selenocysteine tRNA-specific correlations Protein SECp43, 32 activity.
  • a variant human selenocysteine tRNA-specific related protein SECp43, 32 may be a shortened, human selenocysteine tRM-specific related protein SECp43, 32 lacking a signaling domain, although Can bind to downstream substrates, but lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat human selenocysteine tRNA-specific proteins.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer polynucleotides encoding human selenocysteine tRM-specific related proteins SECp43, 32 Into the cell.
  • Methods for constructing recombinant viral vectors carrying polynucleotides encoding human selenocysteine tRNA-specific related proteins SECp43, 32 can be found in the existing literature (Sambrook, et al.).
  • recombinant polynucleotides encoding human selenocysteine tRNA-specific related proteins SECp43, 32 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides that inhibit human selenocysteine tRM-specific related proteins SECp43, 32 mRNA and ribozymes are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense MA and DM and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technique of solid phase phosphate amide synthesis of oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the MA. This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the application of ribonucleoside linkages. Phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding the human selenocysteine tRNA-specific related protein SECp43, 32 can be used for diagnosis of diseases related to the human selenocysteine tRNA-specific related protein SECp43, 32.
  • Polynucleotides encoding human selenocysteine tRNA-specific related proteins SECp43, 32 can be used to detect the expression of human selenocysteine tRNA-specific related proteins SECp43, 32 or human selenogenes in disease states Abnormal expression of cysteine tRNA-specific proteins SECp43, 32.
  • the DM sequence encoding the human selenocysteine tRNA-specific related protein SECp43, 32 can be used to hybridize biopsy specimens to determine the expression status of the human selenocysteine tRNA-specific related protein SEC P 43, 32.
  • Hybridization techniques include Southern blotting, Nor thern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also known as a "gene chip"), and used to analyze differential expression analysis and gene diagnosis of genes in tissues. .
  • Human selenocysteine tRNA-specific related protein SECp43, 32 specific primers for in vitro amplification of MA-polymerase chain reaction (RT-PCR) can also detect human selenocysteine tRNA-specific related protein SECp43, 32 transcript.
  • Human selenocysteine tRNA-specific proteins SECp43, 32 mutations can also be used to diagnose human selenocysteine tRNA-specific proteins SECp43, 32-related diseases.
  • Human selenocysteine tRNA-specific related proteins SECp43, 32 mutations include point mutations, translocations, and deletions compared to normal wild-type human selenocysteine tRNA-specific related proteins SECp43, 32 DNA sequences. , Reorganization, and any other abnormalities. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern imprinting method and Wes tern blotting method can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ Hybridization, pre-screening of chromosomes using hybrid flow sorting, and pre-selection of hybridization to construct a chromosome-specific C band library.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mende l ian
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as via a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • the human selenocysteine tRM-specific related protein SECp43, 32 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human selenocysteine tRM-specific related proteins SECp43, 32 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une SECp43, 32 s'associant avec l'ARNt de la sélénocystéine humaine, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la SECp43, 32 s'associant avec l'ARNt de la sélénocystéine humaine.
PCT/CN2001/000070 2000-01-28 2001-01-21 NOUVEAU POLYPEPTIDE, SECp43, 32 S'ASSOCIANT AVEC L'ARNt DE LA SELENOCYSTEINE HUMAINE, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE WO2001055189A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001231484A AU2001231484A1 (en) 2000-01-28 2001-01-21 A novel polypeptide, secp43, 32 that associates specifically with human selecnocysteine trna and the polynucleotide encoding thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00111573.1 2000-01-28
CN 00111573 CN1307042A (zh) 2000-01-28 2000-01-28 一种新的多肽——人硒代半胱氨酸tRNA特异性相关蛋白SECp43,32和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001055189A1 true WO2001055189A1 (fr) 2001-08-02

Family

ID=4581482

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000070 WO2001055189A1 (fr) 2000-01-28 2001-01-21 NOUVEAU POLYPEPTIDE, SECp43, 32 S'ASSOCIANT AVEC L'ARNt DE LA SELENOCYSTEINE HUMAINE, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE

Country Status (3)

Country Link
CN (1) CN1307042A (fr)
AU (1) AU2001231484A1 (fr)
WO (1) WO2001055189A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10452568B2 (en) 2015-11-24 2019-10-22 Hewlett-Packard Development Company, L.P. Peripheral device lists

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105001406B (zh) * 2015-06-16 2018-04-17 湖南大学 一种检测活体中硒代半胱氨酸的新方法
CN112480229B (zh) * 2020-11-26 2021-07-30 广东省农业科学院植物保护研究所 蛋白Secp43或其编码基因在调控黑腹果蝇雄性生育中的应用

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
RNA, vol. 5, no. 12, December 1999 (1999-12-01), pages 1561 - 1569 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10452568B2 (en) 2015-11-24 2019-10-22 Hewlett-Packard Development Company, L.P. Peripheral device lists

Also Published As

Publication number Publication date
CN1307042A (zh) 2001-08-08
AU2001231484A1 (en) 2001-08-07

Similar Documents

Publication Publication Date Title
WO2001055189A1 (fr) NOUVEAU POLYPEPTIDE, SECp43, 32 S'ASSOCIANT AVEC L'ARNt DE LA SELENOCYSTEINE HUMAINE, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001083743A1 (fr) Polypeptide sous-unite 11 d'adducine alpha de globule rouge humain et polynucleotide codant pour ce polypeptide
WO2001068684A1 (fr) Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2001048004A1 (fr) Nouveau polypeptide, proteine de liaison de l'heparine 10, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001071003A1 (fr) Nouveau polypeptide, serine protease humaine 8, et polynucleotide codant pour ce polypeptide
WO2001072793A1 (fr) Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001055419A1 (fr) Nouveau polypeptide, site de liaison 27 d'arn s1, et polynucleotide codant pour ce polypeptide
WO2001074867A1 (fr) Nouveau polypeptide, proteine humaine 11 regulant la protease, et polynucleotide codant pour ce polypeptide
WO2001055193A1 (fr) Nouveau polypeptide, sous-unite 35 pb1 de l'arn polymerase, et polynucleotide codant pour ce polypeptide
WO2001068872A1 (fr) Nouveau polypeptide, sous-unite c humaine de la pompe a proton vacuolaire atpase 22, et polynucleotide codant pour ce polypeptide
WO2001087968A1 (fr) Proteine s4-36 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001075019A2 (fr) Nouveau polypeptide, proteine humaine de mutation 11 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide
WO2001079437A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide
WO2002014365A1 (fr) Nouvelle proteine 12 activatrice du polypeptide-ras gtp et le polynucleotide codant pour ladite proteine
WO2001046411A1 (fr) Nouveau polypeptide, proteine ribosomale s17 10, et polynucleotide codant pour ce polypeptide
WO2001081392A1 (fr) Nouveau polypeptide, phosphoproteine nucleolaire humaine 13, et polynucleotide codant pour ce polypeptide
WO2001055375A1 (fr) Nouveau polypeptide, agent de reduction humain et une proteine reagissant a la tunicamycine 40, et polynucleotide codant pour ce polypeptide
WO2001048218A1 (fr) Nouveau polypeptide, proteine muts 13, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP