WO2001071003A1 - Nouveau polypeptide, serine protease humaine 8, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, serine protease humaine 8, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001071003A1
WO2001071003A1 PCT/CN2001/000404 CN0100404W WO0171003A1 WO 2001071003 A1 WO2001071003 A1 WO 2001071003A1 CN 0100404 W CN0100404 W CN 0100404W WO 0171003 A1 WO0171003 A1 WO 0171003A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
serine protease
human serine
sequence
Prior art date
Application number
PCT/CN2001/000404
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU58153/01A priority Critical patent/AU5815301A/en
Publication of WO2001071003A1 publication Critical patent/WO2001071003A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424Serine endopeptidases (3.4.21)
    • C12N9/6454Dibasic site splicing serine proteases, e.g. kexin (3.4.21.61); furin (3.4.21.75) and other proprotein convertases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human serine protease 8, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide.
  • Cereal seeds contain a large number of serine protease inhibitors and ⁇ -amylase inhibitors. These inhibitors can form a family due to their structural similarity. This family may form defenses against pathogenic bacteria and invaders by inhibiting foreign proteinases and amylases.
  • the members of the cereal trypsin inhibitor and ⁇ -amylase inhibitor family are proteins consisting of about 120 amino acid residues, including 10 Cy s residues to form 5 disulfide bonds.
  • Some of the cereal trypsin inhibitors and ⁇ -amylase inhibitors are soluble in NaC 1 albumin and globulin and bind to I gE in the serum of patients with plant allergies. Some members of this family have been identified as asthma The patient's main allergen.
  • the human serine protease 8 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more people involved in these processes Serine protease 8 protein, especially the amino acid sequence of this protein is identified. Isolation of the novel human serine protease 8 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human serine protease 8.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human serine protease 8.
  • Another object of the present invention is to provide a method for producing human serine protease 8.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human serine protease 8.
  • Another object of the present invention is to provide analog compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human serine protease 8.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of human serine protease 8. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence of positions 1724 to 1978 in SEQ ID NO: 1; and (b) a sequence of 1-2183 in SEQ ID NO: 1 Sequence of bits.
  • the present invention relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including transformed, transduced or transfected host cells; and a culture cell
  • a vector particularly an expression vector, containing the polynucleotide of the present invention
  • a host cell genetically engineered with the vector, including transformed, transduced or transfected host cells
  • a culture cell The method for preparing a polypeptide of the present invention by describing a host cell and recovering an expressed product is described.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a screen for mimicking, activating, antagonizing or inhibiting human serine protease 8 protein.
  • a method of active compounds which comprises utilizing a polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human serine protease 8 protein, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a mutation in a biological sample The amount or biological activity of a polypeptide of the invention.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human serine protease 8.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human serine protease 8 and human serine protease 15 according to the present invention.
  • the upper graph is a graph of the expression profile of human serine protease 8
  • the lower graph is the graph of the expression profile of human serine protease 15.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates non-starved L02
  • 8 indicates L02 +, lhr, As 3+
  • 9 indicates ECV304 PMA-
  • 10 means ECV304 PMA +
  • 11 means fetal liver
  • 12 means normal liver
  • 13 means thyroid
  • 14 means skin
  • 15 means fetal lung
  • 16 means lung
  • 17 means lung cancer
  • 18 means fetal spleen
  • 19 means spleen
  • 20 Indicates prostate
  • 21 indicates fetal heart
  • 22 indicates heart
  • 23 indicates muscle
  • 24 indicates testis
  • 25 indicates fetal thymus
  • 26 indicates thymus.
  • FIG. 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human serine protease 8 isolated. 8kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof Minute.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the substituted amino acid has similar crusting or chemical properties to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human serine protease 8, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human serine protease 8.
  • Antagonist refers to a molecule that, when combined with human serine protease 8, can block or regulate the biological or immunological activity of human serine protease 8.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human serine protease 8.
  • Regular refers to a change in the function of human serine protease 8, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human serine protease 8.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human serine protease 8 using standard protein purification techniques. Basically pure human serine protease 8 produces a single main band on a non-reducing polyacrylamide gel. The purity of human serine protease 8 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to polynucleotides that naturally bind through base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-TG-A” can be combined with the complementary sequence "G-A-CT”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Cluster method checks all The distances arrange the groups of sequences into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun He in (He in L, (1990) Methods in enzymology 183: 625-645). 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b ') 2 and F V, which specifically binds human serine proteases 8 antigenic determinants.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human serine protease 8 means that human serine protease 8 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human serine protease 8 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human serine protease 8 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide, human serine protease 8, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human serine protease 8.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human serine protease 8 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as Leader sequence or secretory sequence or the sequence or protease sequence used to purify this polypeptide).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2183 bases in length and its open reading frame 1724-1978 encodes 84 amino acids.
  • this polypeptide has a similar expression profile to human serine protease 15 and it can be deduced that the human serine protease 8 has a similar function to human serine protease 15.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60'C; or (2) 1 ° / ⁇ When hybridizing with a denaturant, such as 50% (v / v) formamide, 0.1 ° /.
  • Hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide is identical to the mature polypeptide shown in SEQ ID NO: 2 Same biological function and activity.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 More than nucleotides.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human serine protease 8.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human serine protease 8 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: ⁇ hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleotides with common structural characteristics Fragment.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Q i agene There are many mature techniques for mRNA extraction, and kits are also commercially available (Q i agene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Mol ecu lar Cl on, A Labora tory Manua, Coll Spring Harbor Labora tory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human serine protease 8 transcripts; (4) by Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably Is at least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (EL ISA) can be used to detect the protein product expressed by the human serine protease 8 gene.
  • a method of amplifying DNA / RNA by PCR (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human serine protease 8 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
  • a polynucleotide sequence encoding human serine protease 8 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
  • DM sequences encoding human serine protease 8 can be used to construct expression vectors containing DM sequences encoding human serine protease 8 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DM technology, DM synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will allow it to be used in higher eukaryotic cells Transcription is enhanced.
  • Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human serine protease 8 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method.
  • the steps used are well known in the art.
  • the alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following D transfection methods can be used: calcium phosphate co-precipitation, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant human serine protease 8 by conventional recombinant DNA technology (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, or expressed on a cell membrane, or secreted Out of the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Cereal trypsin inhibitors and ⁇ -amylase inhibitors have inhibitory effects on the secreted proteins of pathogenic bacteria. Similar activities of trypsin inhibitors and ⁇ -amylase inhibitors mot i f also exist in human peptides, which also inhibit trypsin and ⁇ -amylase, affecting the body's digestive and absorption functions.
  • Trypsin inhibitors and ⁇ -amylase inhibitor-specific conserved sequences are required to form their active rao t i f. It can be seen that the abnormal expression of the specific trypsin inhibitor and the ⁇ -amylase inhibitor mot if will cause the function of the polypeptide containing the mot if of the present invention to be abnormal, which will lead to abnormal digestion and absorption functions of the body, and Produce related diseases such as digestive diseases.
  • human serine protease 8 of the present invention will produce various diseases, especially digestive system diseases, including but not limited to: malnutrition, pancreatitis, gastrointestinal indigestion, irritable bowel syndrome, chronic Diarrhea, chronic gastritis, acute gastritis, peptic ulcer, pancreatic cancer, gastric cancer, CROHN disease, ulcerative colitis, colorectal cancer
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human serine protease 8.
  • Agonists enhance biological functions such as human serine protease 8 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation such as various cancers.
  • mammalian cells or membrane preparations expressing human serine protease 8 can be cultured together with labeled human serine protease 8 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human serine protease 8 include antibodies, compounds, receptor deletions, and analogs that have been screened. Antagonists of human serine protease 8 can bind to human serine protease 8 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform a biological function.
  • human serine protease 8 When screening compounds as antagonists, human serine protease 8 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human serine protease 8 and its receptor. Antagonists can be screened in the same way as above for screening compounds Acting receptor deletions and analogs. Polypeptide molecules capable of binding to human serine protease 8 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human serine protease 8 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against human serine protease 8 epitopes. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human serine protease 8 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to human serine protease 8 include, but are not limited to, hybridoma technology (Kohler and Milstei n. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
  • Chimeric antibodies that combine human constant regions with non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against human serine protease 8.
  • Anti-human serine protease 8 antibodies can be used in immunohistochemical techniques to detect human serine protease 8 in biopsy specimens.
  • Monoclonal antibodies that bind to human serine protease 8 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human serine protease 8 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human serine protease 8 positive cells.
  • the antibodies in the present invention can be used to treat or prevent diseases related to human serine protease 8. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human serine protease 8.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human serine protease 8 levels. These tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human serine protease 8 detected in the test can be used to explain the importance of human serine protease 8 in various diseases and to diagnose diseases in which human serine protease 8 plays a role.
  • the polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human serine protease 8 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human serine protease 8.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human serine protease 8 to inhibit endogenous human serine protease 8 activity.
  • a mutated human serine protease 8 may be a shortened human serine proteinase 8 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human serine protease 8.
  • Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer polynucleotides encoding human serine protease 8 into cells.
  • viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding human serine protease 8 can be found in the existing literature (Sambrook, et al.).
  • recombinant polynucleotide encoding human serine protease 8 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human serine protease 8 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DM, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human serine protease 8 can be used for the diagnosis of diseases related to human serine protease 8.
  • the polynucleotide encoding human serine protease 8 can be used to detect the expression of human serine protease 8 or the abnormal expression of human serine protease 8 in a disease state.
  • a DNA sequence encoding human serine protease 8 can be used to hybridize biopsy specimens to determine the expression of human serine protease 8.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These technical methods The methods are publicly available mature technologies, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissue.
  • Human serine protease 8 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human serine protease 8 transcription products.
  • Detection of mutations in the human serine protease 8 gene can also be used to diagnose human serine protease 8-related diseases.
  • Human serine protease 8 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human serine protease 8 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific genes on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mende l ian Inherance in Man (available online with Johns Hopk ins University Welch Med i cal Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions. Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease.
  • Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR.
  • the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human serine protease 8 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human serine protease 8 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Po ly (A) mRNA was isolated from total RNA using Quik mRNA I sola t ion Ki t (a product of Qiegene). 2ug po ly (A) mRM forms cDNA by reverse transcription. Smar t cDNA cloning kit (purchased from C 1 on tech
  • the terminate cycle reaction sequencing kit Perkin-Elmer
  • the ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public D-sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0901h02 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5 — AACAGCTCAATAAATGCTGGCTAG — 3, (SEQ ID NO: 3)
  • Priraer2 5'- GCACGGCTGCGATAAGACGAAGCT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 mmol / L KC1, 10 mmol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ ol / L dNTP, lOpmol primer, 1U Taq DNA in a 50 ⁇ 1 reaction volume Polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • RT-PCR set act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 2183 bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human serine protease 8 gene expression
  • RNA extraction in one step includes acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidinium isothiocyanate-25 mM sodium citrate, 0.2 M acetic acid Sodium (pH4.0) was used to homogenize the tissue, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, and the mixture was centrifuged. The aqueous phase layer was aspirated and isopropyl alcohol (0.8 (Volume) and centrifuge the mixture to obtain RNA precipitate. The obtained RNA precipitate was washed with 70% ethanol, dried and dissolved in water.
  • RNA probe Using 20 ⁇ 8 RNA, containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7 .0) -5mM sodium acetate - electrophoresed on agarose gel ImM EDTA- 1.2% 2 ⁇ 2M formaldehyde and transferred to nitrocellulose with a- 32 P dATP Preparation 32 ⁇ - SYSTEM labeled by random priming.
  • DM probe The DNA probe used was the PCR amplified human serine protease 8 coding region sequence (1724bp to 1978bp) shown in FIG. 1.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7. 4)-5 x SSC- 5 x Denhardt's solution and 20 ( ⁇ g / ral salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min Then, analysis and quantification were performed using Phosphor Imager.
  • Example 4 In vitro expression, isolation and purification of recombinant human serine protease 8
  • Pr imer3 5,-CCCCATATGATGCGCTTCCCCCGGGAACAAGCT -3, (Seq ID No: 5)
  • Pr iraer4 5,-CATGGATCCTCAGAGCCTTAATCTGTTCTCCAG -3, (Seq ID No: 6)
  • Ndel and BamHI digestion sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Ca. No. 69865. 3) Selective endonuclease site.
  • the PCR reaction was performed using the pBS-0901h02 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0901h02 plasmid, primers Primer-3 and Primer-4 were 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Nde l and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into the colibacillus DH5 C by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 ⁇ 8 / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0901h02) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the following peptides specific for human serine protease 8 were synthesized using a peptide synthesizer (product of PE company): NH2- Met-Arg- Phe- Pro- Arg-Glu- Gin- Al a- Gly- Il-Gly- Arg- Cys- Ser- Gin- C00H (SEQ ID NO: 7).
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragment selected from the polynucleotide SEQ ID NO: 1 of the present invention for use as a hybridization probe shall be Following the following principles and several aspects to consider:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 (p r obel), belonging to the first probe, and SEQ ID NO: 1 gene fragment is fully complementary or homologous (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardfs; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardfs; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
  • Gene chip or gene micro matrix (DNA Mi croarray) is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotting instrument (purchased by Cartesian, USA). The distance from the point is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRM was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen), and another 1 J was separated by reverse transcription.
  • Cy3dUTP (5-Araino-propargyl-2'-deoxyur idine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamac ia Biotech), a fluorescent reagent Cy3dUTP, was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Araino-propargy 2'-deoxyuridine 5'-tripha te coupled to Cy5 fluorescent dye, purchased from Amersham Pharaacia Biotech Company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • Cy3dUTP 5-Araino-propargyl-2'
  • the probes from the above two tissues and the chips were respectively hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and a washing solution (1 ⁇ SSC, 0.2% SDS) was used at room temperature. After washing, scanning was performed with a ScanArray 3000 scanner (purchased from Genera Scanning, USA), and the scanned images were analyzed by Imagene software (Biodi scovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une sérine protéase humaine 8, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la sérine protéase humaine 8.
PCT/CN2001/000404 2000-03-24 2001-03-23 Nouveau polypeptide, serine protease humaine 8, et polynucleotide codant pour ce polypeptide WO2001071003A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU58153/01A AU5815301A (en) 2000-03-24 2001-03-23 A novel polypeptide, a human serine protease 8 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00115084 CN1315553A (zh) 2000-03-24 2000-03-24 一种新的多肽——人丝氨酸蛋白酶8和编码这种多肽的多核苷酸
CN00115084.7 2000-03-24

Publications (1)

Publication Number Publication Date
WO2001071003A1 true WO2001071003A1 (fr) 2001-09-27

Family

ID=4584553

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000404 WO2001071003A1 (fr) 2000-03-24 2001-03-23 Nouveau polypeptide, serine protease humaine 8, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1315553A (fr)
AU (1) AU5815301A (fr)
WO (1) WO2001071003A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004106536A3 (fr) * 2003-05-28 2005-03-03 Bayer Healthcare Ag Agents diagnostiques et therapeutiques pour maladies associees a la serine protease 8 (prss8)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 18 February 2000 (2000-02-18), accession no. EMBL Database accession no. AL137655 *
DATABASE GENBANK [online] 18 February 2000 (2000-02-18), accession no. EMBL Database accession no. AL137733 *
DATABASE GENBANK [online] 6 June 1997 (1997-06-06), accession no. EMBL Database accession no. Z96606 *
DATABASE GENBANK [online] 9 September 1999 (1999-09-09), Database accession no. AF109718 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004106536A3 (fr) * 2003-05-28 2005-03-03 Bayer Healthcare Ag Agents diagnostiques et therapeutiques pour maladies associees a la serine protease 8 (prss8)

Also Published As

Publication number Publication date
AU5815301A (en) 2001-10-03
CN1315553A (zh) 2001-10-03

Similar Documents

Publication Publication Date Title
WO2001074879A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s3-12, et polynucleotide codant pour ce polypeptide
WO2001055189A1 (fr) NOUVEAU POLYPEPTIDE, SECp43, 32 S'ASSOCIANT AVEC L'ARNt DE LA SELENOCYSTEINE HUMAINE, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001071003A1 (fr) Nouveau polypeptide, serine protease humaine 8, et polynucleotide codant pour ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001083743A1 (fr) Polypeptide sous-unite 11 d'adducine alpha de globule rouge humain et polynucleotide codant pour ce polypeptide
WO2001048220A1 (fr) Nouveau polypeptide, serine protease 15, et polynucleotide codant pour ce polypeptide
WO2001074870A1 (fr) Nouveau polypeptide, alpha-galactosidase humaine a-11, et polynucleotide codant pour ce polypeptide
WO2001094371A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001075085A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001079430A2 (fr) Nouveau polypeptide, serine protease humaine 9, et polynucleotide codant pour ce polypeptide
WO2001074894A1 (fr) Nouveau polypeptide, proteine humaine de regulation 12 de la proteine phosphorylase, et polynucleotide codant pour ce polypeptide
WO2001081395A1 (fr) Nouveau polypeptide, adn topo-isomerase i-15, et polynucleotide codant pour ce polypeptide
WO2001077286A2 (fr) Nouveau polypeptide, globine humaine 58 de l'uterus, et un polynucleotide codant pour ce polypeptide
WO2001068872A1 (fr) Nouveau polypeptide, sous-unite c humaine de la pompe a proton vacuolaire atpase 22, et polynucleotide codant pour ce polypeptide
WO2001046442A1 (fr) Nouveau polypeptide, cysteine protease 10, et polynucleotide codant pour ce polypeptide
WO2001075005A2 (fr) Nouveau polypeptide, sous-unite c de l'atpase pompe a protons vacuolaire (v-atpase) 12, et polynucleotide codant pour ce polypeptide
WO2001072792A1 (fr) Nouveau polypeptide, proteine humaine 13 analogue a l'ubiquitine, et polynucleotide codant pour ce polypeptide
WO2001078755A2 (fr) Nouveau polypeptide, proteine humaine de mutation 9 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide
WO2001092540A1 (fr) Nouveau polypeptide, facteur humain stat2 11, et polynucleotide codant ce polypeptide
WO2001081537A2 (fr) Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide
WO2001094407A1 (fr) Nouveau polypeptide, enzyme de conjugaison de l'ubiquitine humaine 10.01, et polynucleotide codant ce polypeptide
WO2001075030A2 (fr) Nouveau polypeptide, tyrosinase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001074883A1 (fr) Nouveau polypeptide, proteine endoase humaine 11, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP