WO2001075030A2 - Nouveau polypeptide, tyrosinase humaine 11, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, tyrosinase humaine 11, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001075030A2 WO2001075030A2 PCT/CN2001/000390 CN0100390W WO0175030A2 WO 2001075030 A2 WO2001075030 A2 WO 2001075030A2 CN 0100390 W CN0100390 W CN 0100390W WO 0175030 A2 WO0175030 A2 WO 0175030A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- human tyrosinase
- sequence
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0055—Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10)
- C12N9/0057—Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10) with oxygen as acceptor (1.10.3)
- C12N9/0059—Catechol oxidase (1.10.3.1), i.e. tyrosinase
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human tyrosinase 11, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
- Tyrosinase is a copper monomeric enzyme that catalyzes the hydroxylation of monophenols and the oxidation of o-diphenols. Tyrosinase is found in both prokaryotes and eukaryotes, and is related to pigment synthesis, such as melanin and some other polyphenol compounds.
- Tyrosinase binds two copper atoms (CuA and CuB), and each copper atom is connected to three histidine residues. The sequence near these histidine residues is quite conserved. Such a structure is in serum It has also been found in vegetarians.
- Tyrosinase and some related proteins have two characteristic structures. The first is at the N-terminus and contains two histidine residues bound to a copper atom. Its sequence is HX (4, 5) -F- (LIVMFTP) -X- (FW)-HRX (2)-(LM) -X (3) -E; The second one is located in the center of the entire enzyme and contains a histidine residue that binds to a copper atom. Its sequence is D- P- X- F- (LIVMFYW) -X (2)- HX (3)-D (all tyrosinase and heparin have this sequence).
- human tyrosinase 11 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so the identification of more involved in these processes has been required in the art
- the human tyrosinase 11 protein, especially the amino acid sequence of this protein was identified. Isolation of the new human tyrosinase 11 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human tyrosinase 11.
- Another object of the present invention is to provide a method for producing human tyrosinase 11.
- Another object of the present invention is to provide an antibody against the polypeptide-human tyrosinase 11 of the present invention.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide-human tyrosinase 11 of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human tyrosinase 11. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 449-733 in SEQ ID NO: 1; and (b) a sequence having 1-1914 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human tyrosinase 11 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to ⁇ The compound.
- the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human tyrosinase 11 protein in vitro, which comprises detecting a mutation in a polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human tyrosinase 11.
- FIG. 1 is a comparison diagram of gene chip expression profiles of human tyrosinase 11 and human tyrosinase 10 of the present invention.
- the upper graph is a graph of the expression profile of human tyrosinase 11, and the lower graph is the graph of the expression profile of human tyrosinase 10.
- FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of human tyrosinase 11 isolated.
- l lkDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of Leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human tyrosinase 11, can cause changes in the protein and thereby regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human tyrosinase 11.
- Antagonist refers to a molecule that, when combined with human tyrosinase 11, can block or regulate the biological or immunological activity of human tyrosinase 11.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human tyrosinase 11.
- Regular refers to a change in the function of human tyrosinase 11, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human tyrosinase 11.
- substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
- Those skilled in the art can purify human tyrosinase 11 using standard protein purification techniques.
- Substantially pure human tyrosinase 11 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of the human tyrosinase 11 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence T-G-A can be combined with the complementary sequence" GA-C-T ".
- the complementarity between two single-stranded molecules can be partial or complete.
- the degree of complementarity between nucleic acid strands is related to the nucleic acid strand The efficiency and intensity of hybridization have a significant effect.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding because conditions with reduced stringency require two sequences Mutual binding is specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi ggins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Cluster method divides each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzymology 183: 625-645) 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine. .
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and?, which can specifically bind to the epitope of human tyrosinase 11.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated human tyrosinase 11 means that human tyrosinase 11 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human tyrosinase 11 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on non-reducing polyacrylamide gels. The purity of the human tyrosinase 11 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human tyrosinase 11, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human tyrosinase 11.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human tyrosinase 11 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ⁇ )
- Such a type, in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- the additional amino acid sequence is fused into the mature polypeptide and the polypeptide sequence (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1,914 bases, and its open reading frames 449-733 encode 94 amino acids.
- this polypeptide has a similar expression profile with human tyrosinase 10, and it can be deduced that the human tyrosinase 11 has a similar function to human tyrosinase 10.
- the polynucleotide of the present invention may be in the form of DNA or MA.
- DNA forms include cDNA, Due to genomic DNA or synthetic DNA.
- DM can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SBQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2 .
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human tyrosinase 11.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human tyrosinase 11 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) expression libraries Antibody screening to detect cloned polynucleotide fragments with common structural characteristics.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice.
- the more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- fflRM extraction There are many mature techniques for fflRM extraction, and kits are also commercially available (Qiagene).
- construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human tyrosinase 11 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human tyrosinase 11 gene.
- ELISA enzyme-linked immunosorbent assay
- a method for amplifying DM / RNA by PCR is preferably used to obtain the gene of the present invention.
- the RACE method RACE-rapid amplification of cDNA ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones before they can be spliced. Long cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human tyrosinase 11 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology .
- a polynucleotide sequence encoding human tyrosinase 11 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- Methods well known to those skilled in the art can be used to construct expression vectors containing a DM sequence encoding human tyrosinase 11 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human tyrosinase 11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- E. coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as insect cells such as fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
- the host is a prokaryote, such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- polynucleotide sequence of the present invention can be used to express or produce recombinant human tyrosinase 11 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
- Tyrosinase is a copper monomeric enzyme that catalyzes the hydroxylation of monophenols and the oxidation of o-diphenols. Tyrosinase is ubiquitous in eukaryotes, and it is related to pigment synthesis, such as melanin and some other polyphenol compounds.
- the specific sequence structure of tyrosinase exists in tyrosinase and some related proteins, such as serotonin.
- the abnormal expression of the specific tyrosinase mot if will cause the dysfunction of the polypeptide containing the mot if of the present invention, resulting in abnormal tyrosine metabolism and related diseases such as tyrosine metabolism defects. Disease, melanoma, congenital iris abnormalities, etc.
- the abnormal expression of the specific tyrosinase mot if will also lead to abnormal serotonin function, which is related to blood pressure, depression, and anxiety.
- human tyrosinase 11 of the present invention will produce various diseases, especially tyrosine metabolism deficiency diseases, melanoma, congenital iris abnormalities, cardiovascular diseases, and mental diseases.
- diseases include but Not limited to: Neonatal transient hypertyrosineemia, acute tyrosinemia, subacute and chronic tyrosinemia, albinism, melanoma, melanoma, heterochromia, melanosis, hypertension , Coronary heart disease, heart failure, depression, anxiety, neurasthenia, schizophrenia, paranoia, obsessive-compulsive disorder, phobia
- the abnormal expression of the human tyrosinase 11 of the present invention will also produce certain hereditary, hematological and immune system diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or inhibit (antagonist) human tyrosinase 11.
- Agonists enhance human tyrosinase 11 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or a membrane preparation expressing human tyrosinase 11 can be cultured with labeled human tyrosinase 11 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human tyrosinase 11 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human tyrosinase 11 can bind to human tyrosinase 11 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- human tyrosinase 11 When screening compounds as antagonists, human tyrosinase 11 can be added to bioanalytical assays to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human tyrosinase 11 and its receptor . Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human tyrosinase 11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally should The human tyrosinase 11 molecule was labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides
- Antibodies against human tyrosinase 11 epitopes include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human tyrosinase 11 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
- Techniques for preparing monoclonal antibodies to human tyrosinase 11 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, BBV-hybridoma technology, etc.
- the chimeric human antibody constant region and the variable region of non-human origin may be used in combination Pat some production techniques (Morr i son et al, PNAS , 1985, 81: 6851) 0 Ersi some production techniques of single chain antibodies ( US Pat No. 4946778) can also be used to produce single chain antibodies against human tyrosinase 11.
- Anti-human tyrosinase 11 antibodies can be used in immunohistochemistry to detect human tyrosinase 11 in biopsy specimens.
- Monoclonal antibodies that bind to human tyrosinase 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
- This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human tyrosinase 11 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human tyrosinase 11 positive cells .
- the antibodies in the present invention can be used to treat or prevent diseases related to human tyrosinase 11.
- Administration of an appropriate dose of antibody can stimulate or block the production or activity of human tyrosinase 11.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human tyrosinase 11 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human tyrosinase 11 detected in the test can be used to explain the importance of human tyrosinase 11 in various diseases and to diagnose diseases in which human tyrosinase 11 functions.
- the polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human tyrosinase 11 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormalities in cell proliferation, development, or metabolism caused by non-expression or abnormal / inactive expression of human tyrosinase 11.
- Recombinant gene therapy vectors can be designed to express mutated human tyrosinase 11 to inhibit endogenous human tyrosinase 11 activity.
- a mutated human tyrosinase 11 may be a shortened human tyrosinase 11 lacking a signaling domain. Although it can bind to a downstream substrate, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human tyrosinase 11.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer a polynucleotide encoding human tyrosinase 11 into a cell.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human tyrosinase 11 can be found in the literature (Sambrook, et al.).
- recombinant polynucleotide encoding human tyrosinase 11 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense MA and DNA
- ribozymes that inhibit human tyrosinase 11 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RM molecule that can specifically decompose a specific MA. The mechanism is that the ribozyme molecule specifically hybridizes with a complementary target MA and performs endonucleation.
- Antisense RM, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
- Antisense RM molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA.
- This DM sequence has been integrated downstream of the RM polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
- the polynucleotide encoding human tyrosinase 11 can be used for the diagnosis of diseases related to human tyrosinase 11.
- the polynucleotide encoding human tyrosinase 11 can be used to detect the expression of human tyrosinase 11 or the abnormal expression of human tyrosinase 11 in a disease state.
- a DNA sequence encoding human tyrosinase 11 can be used to hybridize biopsy specimens to determine the expression status of human tyrosinase 11.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human tyrosinase ⁇ specific primers can also be used to detect human tyrosinase 11 transcripts by RNA-polymerase chain reaction (RT-PCR) in vitro amplification. Detection of mutations in the human tyrosinase 11 gene can also be used to diagnose human tyrosinase 11-related diseases.
- Human tyrosinase 11 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human tyrosinase 11 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping capability and every 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human tyrosinase 11 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dosage range of human tyrosinase 11 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragments into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with an existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0875E06 was a new DM.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- CDNA was synthesized using fetal brain total RM as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Primer 1 5 — GTTTCTGGTGTAGCCTCTCTTCCT -3, (SEQ ID NO: 3)
- Primer2 5'- TGGTTCAAGGGACTTTAATGTAGG -3 '(SEQ ID NO: 4)
- Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Conditions for the amplification reaction 50 ⁇ l of ol / L KC 1, 10 ⁇ l / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, 'l Opmol primer, 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec 72 ° C 2min. Set ⁇ -act in as a positive control and template blank as a negative control at the same time during RT-PCR.
- Amplification products were purified using a QIAGEN kit and ligated to a pCR vector using a TA cloning kit (Invi (product of trogen company).
- the results of DNA sequence analysis showed that the DNA sequence of the PCR product was exactly the same as the l-1914bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human tyrosinase 11 gene expression
- the 32P- labeled probes (about 2 xl 0 6 cpm / ml) and RNA was transferred to nitrocellulose membrane 42 in a solution. C overnight hybridization, the solution containing 50% formamide - After 25mM KH 2 P0 4 (. P H7 4) -5 ⁇ SSC- 5 ⁇ Denhardt 's solution and 20 ( ⁇ g / ml salmon sperm DNA hybridization, the filter The membrane was washed in 1 x SSC-0.1% SDS for 30 min at 55 ° C. Then, it was analyzed and quantified using a Phosphor Imager.
- Example 4 In vitro expression, isolation and purification of recombinant human tyrosinase 11
- Primer3 5,-CCCCATATGATGAGTTTAGCTCTTCTTTTATAC -3, (Seq ID No: 5)
- Pr imer4 5'- CATGGATCCTTACATAATTGGGAGTATATTTTG -3 '(Seq ID No: 6)
- the 5' ends of these two primers contain Mel and BamHI restriction sites, respectively.
- the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
- PCR was performed using the PBS-0875E06 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: the total volume of 50 ⁇ 1 contained 10 pg of PBS-0875E06 plasmid, and the primers Pr imer-3 and Pr imer-4 were lOpmol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligated product was transformed into E. coli DH5a by the calcium chloride method, and cultured overnight in LB plates containing kanamycin (final concentration 30 ⁇ 1), and colonies were used to screen positive clones and sequenced.
- a positive clone pET-0875E06
- the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- kanamycin-containing final concentration
- the host strain BL21 (pET-0875E06) was cultured at 37 ° C to the logarithmic growth phase, IPTG was added to a final concentration of 1 mmol / L, and the culture was continued for 5 hours.
- the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation.
- the supernatant was collected using an affinity chromatography column His s.
- Bind Quick Cartr idge product of Novagen capable of binding to 6 histidines (6His-Tag).
- 6His-Tag 6 histidines
- NH2-Met-Ser-Leu-Ala-Leu-Leu-Leu-Tyr-Ser-Pro-Leu-Leu-I le-Va l le-C00H (SEQ ID NO: 7).
- the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- Use Protein A-Sepharose from Antibody Positive Total IgG was isolated from rabbit serum.
- the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
- the immunoprecipitation method proved that the purified antibody could specifically bind to human tyrosinase 11.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences
- the column and its complementary region are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- probe 2 (P robe2), belong to the second probe, corresponding to SEQ ID NO: 1, or a replacement gene fragment complementary to a fragment of the mutant sequence (41Nt) :
- PBS ringworm buffer
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- the sample membrane was placed in a plastic bag and 3-10 mg of prehybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
- prehybridization solution lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)
- probe 1 can be used for qualitative and quantitative analysis.
- the presence and differential expression of the polynucleotide of the present invention in different tissues are analyzed.
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies.
- the data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. , M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues of the body (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent test is also labeled with J Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5 '-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech).
- the probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2 SDS) at room temperature and scanned with ScanArray 3000
- the instrument purchased from General Scanning Company, USA
- the scanned images were processed by Iraagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these 13 Cy3 / Cy5 ratios, draw a bar graph ( Figure 1). It can be seen from the figure that the expression profiles of human tyrosinase 11 and human tyrosinase 10 according to the present invention are very similar. .
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Pharmacology & Pharmacy (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Microbiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Enzymes And Modification Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU58147/01A AU5814701A (en) | 2000-03-24 | 2001-03-23 | A novel polypeptide, a human tyrosinase 11 and the polynucleotide encoding the plypeptide |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00115105A CN1315518A (zh) | 2000-03-24 | 2000-03-24 | 一种新的多肽——人酪氨酸酶11和编码这种多肽的多核苷酸 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001075030A2 true WO2001075030A2 (fr) | 2001-10-11 |
WO2001075030A3 WO2001075030A3 (fr) | 2002-01-03 |
Family
ID=4584574
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000390 WO2001075030A2 (fr) | 2000-03-24 | 2001-03-23 | Nouveau polypeptide, tyrosinase humaine 11, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1315518A (fr) |
AU (1) | AU5814701A (fr) |
WO (1) | WO2001075030A2 (fr) |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPH06100A (ja) * | 1992-06-18 | 1994-01-11 | Daicel Chem Ind Ltd | ヒト・アルビニズムを検出するためのdna配列及びそれを用いたヒト・アルビニズムの検出方法 |
-
2000
- 2000-03-24 CN CN00115105A patent/CN1315518A/zh active Pending
-
2001
- 2001-03-23 AU AU58147/01A patent/AU5814701A/en not_active Abandoned
- 2001-03-23 WO PCT/CN2001/000390 patent/WO2001075030A2/fr active Application Filing
Also Published As
Publication number | Publication date |
---|---|
CN1315518A (zh) | 2001-10-03 |
WO2001075030A3 (fr) | 2002-01-03 |
AU5814701A (en) | 2001-10-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001072786A1 (fr) | Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide | |
WO2001073062A1 (fr) | Nouveau polypeptide, antigene prostatique specifique membranaire 18, et polynucleotide codant pour ce polypeptide | |
WO2001075030A2 (fr) | Nouveau polypeptide, tyrosinase humaine 11, et polynucleotide codant pour ce polypeptide | |
WO2001075117A1 (fr) | Nouveau polypeptide, tyrosinase humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001075016A2 (fr) | Nouveau polypeptide, tyrosinase humaine 16, et polynucleotide codant pour ce polypeptide | |
WO2001071003A1 (fr) | Nouveau polypeptide, serine protease humaine 8, et polynucleotide codant pour ce polypeptide | |
WO2001074870A1 (fr) | Nouveau polypeptide, alpha-galactosidase humaine a-11, et polynucleotide codant pour ce polypeptide | |
WO2001088158A1 (fr) | Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001090376A1 (fr) | Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide | |
WO2001094593A1 (fr) | Nouveau polypeptide, glycero-3-phosphate deshydrogenase humaine 11, et polynucleotide codant ce polypeptide | |
WO2001055399A1 (fr) | Nouveau polypeptide, dipeptide aminopeptidase humaine 28, et polynucleotide codant pour ce polypeptide | |
WO2001085752A1 (fr) | Polynucleotide codant un peptide de myosine | |
WO2001087970A1 (fr) | Polypeptide de tyrosinase 12 humaine, et polynucleotide le codant | |
WO2001046430A1 (fr) | Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide | |
WO2001072799A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 9, et polynucleotide codant pour ce polypeptide | |
WO2001092326A1 (fr) | Nouveau polypeptide, phosphatase acide 13, et polynucleotide codant ce polypeptide | |
WO2001072980A1 (fr) | Nouveau polypeptide, peroxydase humaine 18, et polynucleotide codant pour ce polypeptide | |
WO2001092541A1 (fr) | Nouveau polypeptide, catalase 12, et polynucleotide codant ce polypeptide | |
WO2001048220A1 (fr) | Nouveau polypeptide, serine protease 15, et polynucleotide codant pour ce polypeptide | |
WO2001079434A2 (fr) | Nouveau polypeptide, signal peptidase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001087943A1 (fr) | Protease a serine 13 atp-dependante, polypeptide humain, et polynucleotide le codant | |
WO2001070792A1 (fr) | Nouveau polypeptide, tyrosinase humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001090164A1 (fr) | Nouveau polypeptide, tyrosinase humaine 9, et polynucleotide codant ce polypeptide | |
WO2001071001A1 (fr) | Nouveau polypeptide, tyrosinase humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001079430A2 (fr) | Nouveau polypeptide, serine protease humaine 9, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |