WO2001046430A1 - Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001046430A1
WO2001046430A1 PCT/CN2000/000560 CN0000560W WO0146430A1 WO 2001046430 A1 WO2001046430 A1 WO 2001046430A1 CN 0000560 W CN0000560 W CN 0000560W WO 0146430 A1 WO0146430 A1 WO 0146430A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
peroxidase
polynucleotide
sequence
seq
Prior art date
Application number
PCT/CN2000/000560
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Fudan University
Shanghai Bio Door Gene Technology Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University, Shanghai Bio Door Gene Technology Ltd. filed Critical Fudan University
Priority to AU19833/01A priority Critical patent/AU1983301A/en
Publication of WO2001046430A1 publication Critical patent/WO2001046430A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0065Oxidoreductases (1.) acting on hydrogen peroxide as acceptor (1.11)

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, peroxidase 12, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide.
  • Peroxidase is a heme-binding enzyme that performs a series of biosynthesis and degradation by using hydrogen peroxide as an electron acceptor. Peroxidase is widely distributed in bacteria, fungi, plants, and spinal thrusts.
  • Peroxidase is an enzyme that synthesizes all the atoms in an oxygen molecule into a substrate.
  • One of the most important functions of peroxidase is to break the aromatic ring.
  • Peroxidase can be divided into two types according to the way the aromatic ring substrate is broken.
  • a common peroxidase breaks the aromatic ring between two hydroxyl groups, while a special peroxidase breaks the ring between one hydroxylated c atom and another adjacent non-hydroxylated C atom.
  • Special peroxidases are usually poly-subunits. Each subunit binds a ferrous ion, and each subunit is about 33kd in size.
  • the peroxidases now known are evolutionarily related and they belong to the same family.
  • the family has a motif sequence of 4 conserved residues.
  • a glutamic acid in a conserved residue in this motif sequence may bind a ferrous atom.
  • This primitive sequence is: [GNTIVJ -X-H-X (5, 7)-[LIVMF] -Y-X (2)-[DENTA] -P-X- [GP] -X (2, 3)-E.
  • X represents any one amino acid
  • E represents an iron ligand.
  • MP0 Myeloperoxidase
  • TP0 peroxidase-thyroid Peroxidase
  • the peroxidase 12 protein plays an important role in important body functions as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more peroxidase 12 proteins involved in these processes. In particular, the amino acid sequence of this protein is identified. Isolation of the gene encoding the new peroxidase 12 protein also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM.
  • Another object of the present invention is to provide a method for producing peroxidase 12.
  • Another object of the present invention is to provide antibodies against the peroxidase 12 of the polypeptide of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the polypeptide of the present invention, peroxidase 12.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of peroxidase 12.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 508-828 in SEQ ID NO: 1; and (b) having a sequence of 1-2982 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of peroxidase 12 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to a disease associated with abnormal expression of peroxidase 12 protein, which comprises detecting a mutation in the polypeptide or a coding polynucleotide sequence thereof in a biological sample, or detecting a biological sample The amount or biological activity of a polypeptide of the invention.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental or immune disease or other diseases caused by abnormal expression of peroxidase 12.
  • Fig. 1 is a comparison diagram of amino acid sequence homology of the characteristic sequence of the peroxidase 12 of 72-amino acids and domains of the peroxidase 12 of the present invention at 15-86.
  • the upper sequence is peroxidase 12, and the lower sequence is the characteristic sequence domain of the peroxidase family.
  • " And ":” and ".” Indicate that the probability of the same amino acid appearing between two sequences decreases in sequence.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated peroxidase 12.
  • 12KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • Class Similarly, the term “immunologically active” refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with peroxidase 12, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind peroxidase 12.
  • Antagonist refers to a molecule that, when combined with peroxidase 12, can block or regulate the biological or immunological activity of peroxidase 12.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds peroxidase 12.
  • Regular refers to a change in the function of peroxidase 12, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of peroxidase 12.
  • Substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify peroxidase 12 using standard protein purification techniques. Substantially pure peroxidase 12 produces a single main band on a non-reducing polyacrylamide gel. The purity of the peroxidase 12 peptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues matching between sequence ⁇ and sequence S
  • the number of residues in the sequence-the number of spacer residues in the sequence ⁇ the number of spacer residues in the sequence ⁇ can also be determined by the Clus ter method or by methods known in the art such as Jotun He in (Hein J ., (1990) Methods in enzymology 183: 625-645) relations
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and?, which can specifically bind to the epitope of peroxidase 12.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated peroxidase 12 means that peroxidase 12 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify peroxidase 12 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the peroxidase 12 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, peroxidase 12, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of peroxidase 12.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the peroxidase 12 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such A type in which a mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this poly
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a total nucleotide sequence of 2982 bases, and its open reading frame 508-828 encodes 106 amino acids.
  • This polypeptide has the characteristic sequence of the peroxidase family, and it can be deduced that the peroxidase 12 has the structure and function represented by the characteristic sequence of the peroxidase family.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • the term "polynucleotide encoding a polypeptide" is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least two sequences between
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 ° /. SDS, 60 'C; or (2) add a denaturant, such as 50 ° /, for hybridization. (V / v) formamide, 0.1% calf serum / 0.1% Fi co l l, 42. C, etc .; or (3) hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding peroxidase 12.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding peroxidase 12 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DN A sequence to obtain the double-stranded DN A of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Q i agene There are many mature techniques for mRNA extraction, and kits are also commercially available (Q i agene).
  • the construction of cDNA libraries is also a common method (Sambrook, etal., Mo l ecu l ar C l on ing, A Labora tory Manua l, Co ld Spr i ng Harbor Labora t ory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Cl on Tech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of peroxidase 12 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1 000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELI SA) can be used to detect the protein product expressed by the peroxidase 12 gene.
  • ELI SA enzyme-linked immunosorbent assay
  • a method (Sa ik i, e t a l. Science 1985; 230: 1 350-1 354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger e t al. PNAS, 1977, 74: 546 3-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a peroxidase 12 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .
  • the polynucleotide sequence encoding peroxidase 12 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, etal.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding peroxidase 12 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as insect cells such as Fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with CaCI. The steps used It is well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant peroxidase 12 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can be used to treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.
  • Peroxidase is a heme-binding enzyme that performs a series of biosynthesis and degradation by using hydrogen peroxide as an electron acceptor. Peroxide and microperoxide contain a large amount of peroxidase. Peroxidation can occur during certain pathological processes in the human body, such as viral hepatitis and Borrelia infection. Studies have found that myeloperoxidase (MP0) is mainly present in granulocytes and monocytes, and MP0 plays an important role in neutrophil-dependent bactericidal systems. It was also found that peroxidase-thyroid peroxidase (TP0) is involved in the biosynthesis of thyroid hormones.
  • MP0 myeloperoxidase
  • TP0 peroxidase-thyroid peroxidase
  • abnormal expression of the specific peroxidase mot if will cause abnormal function of the peroxidase-containing moU f polypeptide of the present invention, resulting in abnormal inflammatory processes, abnormal immune system function, and abnormal thyroid hormone production. And produce related diseases.
  • peroxidase 12 of the present invention will produce various diseases, especially various Inflammation, immune system disease, thyroid disease, these diseases include but are not limited to:
  • inflammatory abnormalities caused by various infections and traumas such as viral hepatitis, Borrelia infection, tuberculosis, HIV, syphilis, allergic reactions, bronchial asthma, sarcoidosis, rheumatoid arthritis, rheumatoid arthritis, Osteoarthritis, glomerulonephritis, immune complex glomerulonephritis, acute anterior uveitis, dermatomyositis, urticaria, atopic dermatitis, hemochromatosis, Addison's disease, Graves's Disease, chronic active hepatitis, intestinal emergency syndrome, atrophic gastritis, systemic lupus erythematosus, cerebrospinal multiple sclerosis, Guillain-Barre syndrome, intracranial granulomatosis, Wegener granulomatosis, autoimmune thyroiditis, Autoimmune interstitial nephritis, ulcerative co
  • Immune system diseases antibody-based primary specific immunodeficiency disease, combined immunodeficiency disease, immunodeficiency disease of phagocytic cells deficiency, complement system deficiency disease, Down syndrome, biotin-dependent carboxylase deficiency, D m Can syndrome, thymoma, chronic cutaneous mucosal candidiasis, aplastic anemia, Di George syndrome, Wiscot t-Aldr ich syndrome, immunodeficiency disease with ataxia capillary dilatation, acquired immunodeficiency Syndrome
  • Thyroid diseases toxic goiter, non-toxic goiter, cretinism, myxedema, thyroiditis
  • the abnormal expression of the peroxidase 12 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various inflammations, immune system diseases, thyroid diseases, certain hereditary, and bloody Diseases and diseases of the immune system.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or inhibit (antagonist) peroxidase 12.
  • Agonists enhance peroxidase 12 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing peroxidase 12 can be cultured with labeled peroxidase 12 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of peroxidase 12 include antibodies, compounds, receptor deletions, and the like that have been screened.
  • An antagonist of peroxidase 12 can bind to peroxidase 12 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • peroxidase 12 When screening compounds as antagonists, peroxidase 12 can be added to bioanalytical assays to determine the effect of the compound on the interaction between peroxidase 12 and its receptor. Whether the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to peroxidase 12 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, 12 molecules of peroxidase should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against peroxidase 12 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting peroxidase 12 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to peroxidase 12 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against peroxidase 12.
  • Anti-peroxidase 12 antibodies can be used in immunohistochemistry to detect peroxidase 12 in biopsy specimens.
  • Monoclonal antibodies that bind to peroxidase 12 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • peroxidase 12 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP, and toxin is bound to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill peroxidase 12 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to peroxidase 12. Administration of an appropriate amount of antibody can stimulate or block the production or activity of peroxidase 12.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of peroxidase 12 levels. These tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the level of peroxidase 12 detected in the test can be used to explain the importance of peroxidase 12 in various diseases and to diagnose diseases in which peroxidase 12 functions.
  • the polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding peroxidase 12 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by peroxidase 12 expression or abnormal / inactive expression.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated peroxidase 12 to inhibit endogenous peroxidase 12 activity.
  • a mutated peroxidase 1 2 may be a shortened peroxidase 12 lacking a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of peroxidase 12.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding peroxidase 12 into a cell.
  • Methods for constructing a recombinant viral vector carrying a polynucleotide encoding peroxidase 12 can be found in the existing literature (Sambrook, et al.).
  • the recombinant polynucleotide encoding peroxidase 12 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit peroxidase 12 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding peroxidase 12 can be used for the diagnosis of diseases related to peroxidase 1 2.
  • the polynucleotide encoding peroxidase 12 can be used to detect the expression of peroxidase 12 or the abnormal expression of peroxidase 12 in a disease state.
  • the DNA sequence encoding peroxidase 12 can be used to hybridize biopsy specimens to determine the expression of peroxidase 1 2.
  • Hybridization techniques include Sout hern blotting, Nor t hern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray (Mic Roa ray) or a DNA chip (also known as a "gene chip") It is used to analyze differential expression analysis and gene diagnosis of genes in tissues.
  • Peroxidase 12-specific primers can also be used to detect peroxidase 12 transcripts by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
  • RT-PCR RNA-polymerase chain reaction
  • Detection of mutations in the peroxidase 12 gene can also be used to diagnose peroxidase 12-related diseases.
  • Peroxidase 12 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type peroxidase 12 DNA sequences. Mutations can be detected using existing techniques such as Southern imprinting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for staining Structural changes in the body, such as deletions or translocations that are visible from the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Peroxidase 12 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of peroxidase 12 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA I solat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smar t cDNA cloning kit purchased from Clontech) was used to insert the cDNA fragments into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ .
  • the sequences at the 5 'and 3' ends of all clones were determined using Dye terminate cycl reacting sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perk in-Elmer).
  • the determined cDNA sequence was compared with an existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0053b06 was a new DM. Insert a cDNA fragment into the clone by synthesizing a series of primers Segments are measured in both directions.
  • the 0053b06 clone contains a full-length cDNA of 2982bp (as shown in Seq IDN0: 1), and has a 321bp open reading frame (0RF) from 508bp to 828bp, encoding a new protein (such as Seq ID NO: 2).
  • This clone pBS-0053b06 and encoded the protein as peroxidase 12.
  • the sequence of the peroxidase 12 of the present invention and the protein sequence encoded by the peroxidase 12 of the present invention were profiled with a program (Basic local alignment search tool) in GCG [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], performing domain analysis in a database such as prosite.
  • the peroxidase 12 of the present invention is homologous with the domain peroxidase family characteristic sequence at 15-86. The results of the homology are shown in FIG. 1 with a homology of 0.15 and a score of 9.55; the threshold is 9.29.
  • Example 3 Cloning of a gene encoding peroxidase 12 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- AAGATTTTAAAAAAATATATAGGC -3 '(SEQ ID NO: 3)
  • Primer2 5- TTATTACGTATTTTATTGTAAAAC -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp at the 5 'end of SEQ ID NO: 1;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l reaction volume containing 50 ol / L C1, 10ramol / L Tris-HCl, pH 8.5, 1.5mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer, 1U of Taq DM polymerase (C 1 on tech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Pe rki n-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-2982bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of peroxidase 12 gene expression
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. Will The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was transferred to nitrocellulose membrane 42 in a solution.
  • 20raM 3- (N-morpholino) propanesulfonic acid (PH7.0) -5mM sodium acetate-ImM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • the DNA probe used was the PCR amplified peroxidase 12 coding region sequence (508bp to 828bp) shown in FIG.
  • the 32P- labeled probe (about 2x l0 6 cpm / ml) and RNA was transferred to nitrocellulose membrane 42 in a solution.
  • the solution contains 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 x SSC-5xDenhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA.
  • the filter membrane is at 1 x SSC -Wash in 0.1% SDS at 55 ° C for 30 min. Then, use Phosphor Imager for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant peroxidase 12
  • Primer3 5'- CATGCTAGCATGTGGAATGGGTTGTGGGTGTTGG -3 '(Seq ID No: 5)
  • Primer4 5'- CATGGATCCTTAAATTTTTTCAAGCCAATTCCCA -3' (Seq ID No: 6)
  • These two primers contain Nhel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Nhel and BaraHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the PCR reaction was performed using the pBS-0053b06 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0053b06 plasmid, primers Primer-3 and Primer-4 were lptnol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into E. coli DH5cc using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive clones were selected by colony PCR method and sequenced. Correct positive clone ( P ET-0053b06) The recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepha r0 se4B column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method demonstrated that the purified antibody could specifically bind to peroxidase 12.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. First, the selection of the probe
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
  • Probe 1 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of pre-hybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ral CT DM (calf DM)) was added. After the bag was sealed, it was shaken in a 68 ° C water bath for 2 hours.
  • pre-hybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ral CT DM (calf DM)
  • X-ray autoradiography -70 ° C
  • X-ray autoradiography pressing time depends on the radioactivity of the hybrid spot
  • Gene chip or gene micro-matrix (DM Mi croarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific methods and steps have been reported in the literature for various references. For example, see DeR i s i, J. L., Lyer, V. & Brown, P. O.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the obtained amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance between points is 280 ⁇ ⁇ 1 . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified using 01 igotex raRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5- Amino- propargy 1-2 ⁇ - deoxyuri dine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Araersham Pharaacia Biotech Company) labeled mRNA of normal liver tissue, using a fluorescent reagent Cy5dUTP (5-Amino-propargy 1-2- -deoxyuri dine 5'-tr iphate coupled to Cy5 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification.
  • Cy3dUTP 5- Amino- propargy 1-2 ⁇ - deoxyuri dine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Araersham Pharaacia Biotech Company
  • Cy5dUTP
  • the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • Scanner purchased from General Scanning Company, USA
  • the scanned image was analyzed and processed with Imagene software (Biodiscovery, USA), and the Cy3 / Cy5 ratio of each point was calculated. The points with the ratio less than 0.5 and greater than 2 were considered.
  • Genes with differential expression were used to analyze a UniHyb TM Hybridization Solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • Scanner purchased from General Scanning Company, USA
  • the scanned image was analyzed and processed with Imagene software (Biodiscovery, USA), and the Cy3 / Cy

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une peroxydase 12, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la peroxydase 12.
PCT/CN2000/000560 1999-12-21 2000-12-11 Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide WO2001046430A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU19833/01A AU1983301A (en) 1999-12-21 2000-12-11 A novel polypeptide, peroxidase 12 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 99124300 CN1300843A (zh) 1999-12-21 1999-12-21 一种新的多肽-过氧化物酶12和编码这种多肽的多核苷酸
CN99124300.5 1999-12-21

Publications (1)

Publication Number Publication Date
WO2001046430A1 true WO2001046430A1 (fr) 2001-06-28

Family

ID=5283384

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000560 WO2001046430A1 (fr) 1999-12-21 2000-12-11 Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1300843A (fr)
AU (1) AU1983301A (fr)
WO (1) WO2001046430A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105112382B (zh) * 2015-09-01 2018-10-26 江苏大学 一种基于家蚕-杆状病毒系统制备人髓过氧化物酶的方法

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 16 June 1998 (1998-06-16), Database accession no. AC004703 *
DATABASE GENBANK [online] 17 November 1994 (1994-11-17), Database accession no. U14573 *
DATABASE GENBANK [online] 20 November 1999 (1999-11-20), Database accession no. AO000337 *
DATABASE GENBANK [online] 20 November 1999 (1999-11-20), Database accession no. AP000215 *
DATABASE GENBANK [online] 21 May 1996 (1996-05-21), Database accession no. U15422 *

Also Published As

Publication number Publication date
AU1983301A (en) 2001-07-03
CN1300843A (zh) 2001-06-27

Similar Documents

Publication Publication Date Title
WO2001079490A1 (fr) Nouveau polypeptide, proteine antigene prostatique specifique membranaire 16, et polynucleotide codant pour ce polypeptide
WO2001046430A1 (fr) Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide
WO2001072815A1 (fr) Nouveau polypeptide, ferredoxine humaine 12, et polynucleotide codant pour ce polypeptide
WO2001055404A1 (fr) Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide
WO2001049857A1 (fr) Nouveau polypeptide, serine transhydroxymethylase 15, et polynucleotide codant pour ce polypeptide
WO2001087943A1 (fr) Protease a serine 13 atp-dependante, polypeptide humain, et polynucleotide le codant
WO2001085923A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 9.2, et polynucleotide codant pour ce polypeptide
WO2001072980A1 (fr) Nouveau polypeptide, peroxydase humaine 18, et polynucleotide codant pour ce polypeptide
WO2001053492A1 (fr) Nouveau polypeptide, s-adenosylmethionine synthetase 31, et polynucleotide codant pour ce polypeptide
WO2001070785A1 (fr) Nouveau polypeptide, serine proteinase humaine atp-dependante 13, et polynucleotide codant pour ce polypeptide
WO2001046431A1 (fr) Nouveau polypeptide, catalase 10, et polynucleotide codant pour ce polypeptide
WO2001075034A2 (fr) Nouveau polypeptide, peroxydase proteine humaine 15, et polynucleotide codant pour ce polypeptide
WO2001072799A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 9, et polynucleotide codant pour ce polypeptide
WO2001070796A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 78, et polynucleotide codant pour ce polypeptide
WO2001075125A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 31, et polynucleotide codant pour ce polypeptide
WO2001092317A1 (fr) Nouveau polypeptide, peroxydase 9, et polynucleotide codant ce polypeptide
WO2001074880A1 (fr) Nouveau polypeptide, peroxydase proteine humaine 10, et polynucleotide codant pour ce polypeptide
WO2001040295A1 (fr) Nouveau polypeptide, proteine humaine 48 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001072803A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 15, et polynucleotide codant pour ce polypeptide
WO2001047993A1 (fr) Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide
WO2001075035A2 (fr) Nouveau polypeptide, peroxydase proteine humaine 9, et polynucleotide codant pour ce polypeptide
WO2001081397A1 (fr) Nouveau polypeptide, cofacteur humain 81 d'un facteur d'initiation de traduction, et polynucleotide codant pour ce polypeptide
WO2001090349A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 12, et polynucleotide codant ce polypeptide
WO2001072792A1 (fr) Nouveau polypeptide, proteine humaine 13 analogue a l'ubiquitine, et polynucleotide codant pour ce polypeptide
WO2001070994A1 (fr) Nouveau polypeptide, dihydropyridine dicarboxylate deshydrogenase humaine 18, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP