WO2001079490A1 - Nouveau polypeptide, proteine antigene prostatique specifique membranaire 16, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine antigene prostatique specifique membranaire 16, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001079490A1
WO2001079490A1 PCT/CN2001/000324 CN0100324W WO0179490A1 WO 2001079490 A1 WO2001079490 A1 WO 2001079490A1 CN 0100324 W CN0100324 W CN 0100324W WO 0179490 A1 WO0179490 A1 WO 0179490A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
prostate
polynucleotide
membrane antigen
specific membrane
Prior art date
Application number
PCT/CN2001/000324
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU50240/01A priority Critical patent/AU5024001A/en
Publication of WO2001079490A1 publication Critical patent/WO2001079490A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a prostate-specific membrane antigen 16, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Background technique
  • Organ-specific antigens can "discover" responses that occur only in one specific tissue.
  • the prostate is a very unusual organ. With the increase of age, most organs will shrink, but the prostate gland keeps growing, and eventually develops into a malignant tumor in most cases.
  • Prostate cancer is the most common malignant disease in men, ranking second among cancers that cause men to die [Chiarodo, A. (1991) Cancer Res., 51: 2498- 2505].
  • PAP was one of the earliest immune sera to diagnose the metastasis of prostate cancer and is now replaced by PSA.
  • PSA is related to tumors, an indicator of cancer cell metastasis, and provides parameters for surgery, radiation, and male hormone ablation therapy in patients with prostate cancer. All these proteins are secreted in the serum and prostate and can be measured.
  • LNCaP human prostate cancer cell line derived from a pre-treated patient with hormonal refractory prostate cancer has been established [Horoszewicz, JS, Leong, SS, et al., (1983) Cancer Res., 43: 1809— 1818].
  • This cell line is considered to be the best model for studying prostate cancer cells in vivo, because it has aneuploidy of male karyotype and maintains the prostate's differentiation function, which in turn can produce PAP and PSA and highly expressed males. Hormone receptor. Cell membranes isolated from this cell line were used to deimmunize mice to produce hybridomas. Immunization with mouse spleen cells and LNCaP cell membranes can produce a prostate-specific monoclonal antibody named 7E11-C5.
  • This monoclonal antibody binds very tightly to the LNCaP cell membrane. All benign and neoplastic prostate cells were positive, while malignancies were more positive. Lymph nodes and bone metastases are also positive for this antibody, especially in hormonal-suppressive lesions [Axelrocl, H. R., Gilman, S. C., et al., (1992) AUA Proceedings. Abstract 596, 1992].
  • the epitope of 7E11-C5 includes a carbohydrate portion of an antigen, and the molecular weight of this antigen is about 100, OOOkDa [Abde 1-Nabi, H., Wright, GL, et al., (1992) Semin. Urol., 10: 45-54].
  • PSM prostate-specific membrane antigen
  • the PSM antigen presents many interesting and meaningful characteristics. Three arginine residues at the N-terminus of the transmembrane region indicate that the protein is a type II integrated membrane protein, and a short N-terminal region is located on the cytoplasmic side of the membrane, and a large C-terminal domain is located outside the molecule. von Hei jine, G. Biochim. Biophys. Acta, 947: 307-333, 1988].
  • PSM antigen or a part thereof can be used as an ideal site for observing metastatic accumulation.
  • the prostate-specific membrane antigen 16 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes Identification of the prostate-specific membrane antigen 16 protein, especially the amino acid sequence of this protein.
  • the isolation of the new prostate-specific membrane antigen 16 protein-encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a prostate-specific membrane antigen 16.
  • Another object of the present invention is to provide a method for producing prostate-specific membrane antigen 16.
  • Another object of the present invention is to provide an antibody against the polypeptide-prostate specific membrane antigen 16 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide-prostate-specific membrane antigen 16 of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of prostate-specific membrane antigen 16.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 62 to 602 in SEQ ID NO: 1; and (b) having a sequence in SEQ ID NO: 1- 1 8] A 9-bit sequence.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of prostate-specific membrane antigen 16 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of prostate-specific membrane antigen 16 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of prostate cancer, benign prostate tumors, benign prostatic hyperplasia, prostatitis, metastatic prostate cancer or other abnormalities due to the expression of prostate specific membrane antigen 16.
  • Use of drugs that cause disease are described in detail below.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule
  • polypeptide or “protein” is not meant to limit the amino acid sequence to the complete natural amino acid associated with the protein molecule.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when bound to a prostate-specific membrane antigen 16, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind prostate specific membrane antigen 16.
  • Antagonist refers to a molecule that, when combined with prostate specific membrane antigen 16, can block or regulate the biological or immunological activity of prostate specific membrane antigen 16.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to prostate-specific membrane antigen 16.
  • Regular membrane antigen 16 refers to changes in the function of prostate-specific membrane antigen 16 including increased or decreased protein activity, changes in binding characteristics, and any other biological, functional, or immune properties of prostate-specific membrane antigen 16 change.
  • Substantially pure 1 'means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify prostate-specific membrane antigens 16 using standard protein purification techniques. Basic The purity of the pure prostate-specific membrane antigen 16 on a non-reducing polyacrylamide gel can produce a single main band of prostate-specific membrane antigen 16 and the purity of the polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to polynucleotides that naturally bind through base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "CT-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands The efficiency, efficiency and strength of the hybridization between nucleic acid chains have obvious development effects. .
  • Homologous origin refers to the degree of complementarity between each other. It may be a partial homologous source or an entirely homologous source. . "" Partially homologous source “” refers to a sequence sequence that complements and partially complements each other. At least at least the cocoa partially inhibits the complete complementarity of the complement. The sequence sequence hybridizes with the target nucleic acid. . The suppression of this type of hybrid crosses can be achieved by performing hybrid crosses ((SSoouutthheerrnn print 55 traces or Or NNoorrtthheerrnn printed traces, etc.)) to check. .
  • the sequence sequence of the homologous source or the hybrid hybrid probe probe cocoa can compete and suppress the sequence sequence of the completely homologous source and the target sequence sequence.
  • the combination under the conditions of the strict personality characteristics of the degree of degradation is low. . This does not mean that the condition that the degree of strict personality is lowered and lowered is allowed to allow the combination of Xu Feifei and the specificity, because the degree of strict personality is reduced.
  • the low conditional requirements require that the two or two sequence sequences are mutually combined to be specific or selective or to interact with each other. .
  • Identical homology percentage percentage means that in the comparison of two or more kinds of amino amino acids or nucleic acid sequences, the sequence sequence is more identical than the middle sequence sequence. Percentage percentage similar to OR or 1100. . The percentage of homogeneity of the same phase can be measured by the method of electro-electronic sub-method. ..)). . MMEEGGAALLIIGGNN program sequence cocoa according to different methods such as CClluusstteerr method compares two or more species sequence sequences ((HHiiggggiinnss ,, DD .. GG .. and PP .. MM ..
  • SShhaarrpp ((11998888)) GGeennee 7733 :: 223377-224444)) 00 CC 11 uuss tteerr passed the inspection to check the distance between all matched pairs. Groups of groups are arranged in clusters. . Each cluster will then be assigned as a pair or or as a group. . The sequence of two or two amino amino acid sequences is as follows The number of residues matching between sequence A and sequence B is 100.
  • the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Cluster method or by methods known in the art such as Jotun He in determines the percent identity between nucleic acid sequences (Hein J., (1990) Methods in emzumology 183: 625-645) 0 "Similarity" refers to the same or Degree of conservative substitution.
  • negatively charged amino acids may include 5 aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group has Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and? It can specifically bind to the epitope of prostate-specific membrane antigen 16.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides are not isolated and purified, but the same polynucleotides or polypeptides, such as separated from other substances in the natural state, are: Isolated and purified.
  • isolated prostate-specific membrane antigen 16 refers to prostate-specific membrane antigen
  • prostate-specific membrane antigens 16 Essentially free of other proteins, lipids, sugars or other substances naturally associated with it.
  • Those skilled in the art can purify prostate-specific membrane antigens 16 using standard protein purification techniques. Substantially pure peptides produce a single main band on a non-reducing polyacrylamide gel. The purity of the prostate-specific membrane antigen 16 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, prostate specific membrane antigen 16, which is basically composed of SEQ ID D
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of prostate-specific membrane antigen 16.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the prostate-specific membrane antigen 16 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by other groups to include a substituent; or (in) such One, Wherein the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide (such as a leader sequence) Or secreted sequences or sequences used to purify this polypeptide or protease sequences)
  • fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1819 bases, and its open reading frame 1 62-602 encodes 1 46 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to prostate-specific membrane antigen, and it can be deduced that the prostate-specific membrane antigen 16 has a similar function to prostate-specific membrane antigen.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide: the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) in the lower Hybridization and elution at ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) adding a denaturant such as 50% (v / v) formamide, 0.1 during hybridization. /.
  • Hybridization occurs only when the identity between the two sequences is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • the "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides Nucleic acid fragments and above. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding prostate-specific membrane antigen 16.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the prostate-specific membrane antigen 16 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage CDM library.
  • kits are also commercially available (Qiagene).
  • CDNA library is constructed in a conventional method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989) 0 may be a commercially available cDNA library is obtained, such as different cDNA CI on tech companies library. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) determining the level of transcripts of prostate-specific membrane antigen 16; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probes used here are usually the gene sequence information of the present invention Based on chemically synthesized DNA sequences. The genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the prostate-specific membrane antigen 16 gene.
  • ELISA enzyme-linked immunosorbent assay
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PIUS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a prostate-specific membrane antigen 16 coding sequence, and a recombinant technology for producing the polypeptide of the present invention method.
  • a polynucleotide sequence encoding the prostate-specific membrane antigen 16 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a prostate-specific membrane antigen 16 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell: or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant prostate-specific membrane antigen 16 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, or expressed on a cell membrane, or divided; it must be extracellular.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • Fig. 1 is a comparison chart of gene chip expression profiles of prostate-specific membrane antigen 16 and prostate-specific membrane Hangyuan of the present invention.
  • the upper graph is a graph of the expression profile of prostate-specific membrane antigen 16 and the lower graph is the graph of the expression profile of prostate-specific membrane antigen 16.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated prostate-specific membrane antigen 16.
  • 16KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • a Quik mRNA Isolation Kit (product of Qiegene) was used to isolate poly (A) mRNA from total RNA. 2ug poly (A) niRNA was reverse transcribed to form cDNA.
  • a Smar t cDNA cloning kit (purchased from C 1 on t ech) was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 cc. The bacteria formed a cDNA library.
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- GGCACACCCGCGGTGCACTGTGAG -3 '(SEQ ID NO: 3)
  • Primer2 5'- GCTTCCATAATTCTTTATTAAATA -3, (SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ I / L KC1, 10mmol / L Tris-CI, (pH8.5), 1.5mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol in a 50 ⁇ I reaction volume Primer, 1U of Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. During RT-PCR, set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen product). DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-1818bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of prostate-specific membrane antigen 16 gene expression:
  • RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH 4.Q), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • the 32P- labeled probe (approximately 2 X 10 6 cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide - 25mM KH 2 P0 4 (pH7.4)-5 x SSC-5 x Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant prostate-specific membrane antigen 16
  • Primer3 5-CATGCTAGCATGGCCATGACACTGCTTTTGACC -3 (Seq ID No: 5)
  • Primer4 5'- CCCGAATTCTCAGTCCTGAAATTGGCAGTTCTG -3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Nhel and EcoRI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively.
  • the Nhel and EcoRI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
  • the pBS-0683b05 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0683b05 plasmid, primers? ! ⁇ ! ⁇ Hey! : ⁇ ! ⁇ Different! ! ⁇ ! ⁇ , Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 C 20s, 60 ° C 30s, 68 C 2 min, a total of 25 cycles. Nhel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH50 using the calcium chloride method.
  • the following peptide-specific membrane antigen 16-specific peptides were synthesized using a peptide synthesizer (product of PE): NH2- Met- Ala-Met- T'hr- Leu-Leu- Leu- Thr- Leu- Glu_Val- Asp- Pro- Gly-Thr-COOH (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides; 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • the 32 P-Probe (the second peak is free ⁇ -dATP) is prepared.
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, refer to the documents DeRisi, L L., Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And the documents Helle, RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-21
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA), between the points The distance is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the DNA was fixed on the glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spotting processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP 5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech
  • Cy5dUTP 5- Amino- propargy 2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company
  • the mRNA was purified to prepare a probe. For specific steps and methods, see:
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these 13 Cy3 / Cy5 ratios, a bar graph is drawn. (Figure). It can be seen from the figure that the prostate-specific membrane anti- ⁇ 16 prostate-specific membrane antigen expression profiles according to the present invention are very similar. Industrial applicability
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Prostate cancer is the most common malignant disease in men.
  • PSA is a serum immune indicator for the diagnosis of prostate cancer metastasis and spread.
  • LNCaP human prostate adenocarcinoma cell line has been established as the best model for studying prostate cancer cells in vivo. This cell line produces a prostate-specific monoclonal antibody, PSM.
  • PSM antigen is an integral membrane protein of prostate epithelial cells, and PSM antigen or a part thereof can be used as an ideal site for observing metastatic accumulation.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human prostate-specific membrane antigen, and both have similar biological functions.
  • As an integral membrane protein of prostate epithelial cells it mainly participates in the cell differentiation and protein expression of prostate tissues, and regulates the proliferation, differentiation and spread of prostate cells. Its abnormal expression is usually closely related to the pathological changes of prostate tissue cells.
  • abnormal expression of the prostate-specific membrane antigen 16 of the present invention will cause various diseases, especially It is a prostate disease that includes, but is not limited to: prostate cancer, benign tumors of the prostate, benign prostatic hyperplasia, prostatitis, metastatic prostate cancer
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, can treat various diseases, especially prostate diseases and the like.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) prostate specific membrane antigen 16.
  • Agonists enhance biological functions such as prostate-specific membrane antigen 16 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing prostate-specific membrane antigen 16 can be cultured together with a labeled prostate-specific membrane antigen 16 in the presence of a drug. The ability of the drug to increase or suppress this interaction is then determined.
  • Antagonists of prostate-specific membrane antigen 16 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of prostate-specific membrane antigen 16 can bind to prostate-specific membrane antigen 16 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • prostate-specific membrane antigen 16 can be added to bioanalytical assays to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between prostate-specific membrane antigen 16 and its receptor .
  • Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Polypeptide molecules capable of binding to prostate-specific membrane antigen 16 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. For screening, 16 molecules of prostate-specific membrane antigen should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against a prostate-specific membrane antigen 16 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting prostate-specific membrane antigen 16 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
  • Techniques for preparing monoclonal antibodies against prostate-specific membrane antigen 16 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV- Hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851) 0 Some techniques for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against prostate specific membrane antigen 16.
  • Antibodies against prostate specific membrane antigen 16 can be used in immunohistochemical techniques to detect prostate specific membrane antigen 16 in biopsy specimens.
  • Monoclonal antibodies that bind to prostate-specific membrane antigen 16 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • prostate-specific membrane antigen 16 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill prostate-specific membrane antigen 16 positive cells .
  • the antibodies of the present invention can be used to treat or prevent diseases related to prostate-specific membrane antigen 16. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of prostate-specific membrane antigen 16.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of prostate specific membrane antigen 16 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of prostate specific membrane antigen 16 detected in the test can be used to explain the importance of prostate specific membrane antigen 16 in various diseases and to diagnose diseases in which prostate specific membrane antigen 16 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding prostate-specific membrane antigen 16 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of prostate-specific membrane antigen 16.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant prostate-specific membrane antigen 16 to inhibit endogenous prostate-specific membrane antigen 16 activity.
  • a variant prostate-specific membrane antigen 16 may be a shortened prostate-specific membrane antigen 16 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of prostate specific membrane antigen 16.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer a polynucleotide encoding a prostate-specific membrane antigen 16 into a cell.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a prostate-specific membrane antigen 16 can be found in the literature (Sambrook, et al.). Recombinantly encoded prostate-specific The polynucleotide of the membrane antigen 16 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit prostate-specific membrane antigen 16 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding prostate-specific membrane antigen 16 can be used for the diagnosis of diseases related to prostate-specific membrane antigen 16.
  • Polynucleotides encoding prostate-specific membrane antigen 16 can be used to detect the expression of prostate-specific membrane antigen 16 or the abnormal expression of prostate-specific membrane antigen 16 in a disease state.
  • a DNA sequence encoding prostate-specific membrane antigen 16 can be used to hybridize biopsy specimens to determine the expression of prostate-specific membrane antigen 16.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on. These techniques and methods are all mature and open technologies, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for differential expression analysis and gene diagnosis of genes in tissues.
  • a microarray or a DNA chip also referred to as a "gene chip”
  • Prostate-specific membrane antigen 16 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect prostate-specific membrane antigen 16 transcripts.
  • Detection of mutations in the prostate-specific membrane antigen 16 gene can also be used to diagnose prostate-specific membrane antigen 16-related diseases.
  • Forms of prostate-specific membrane antigen 16 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type prostate-specific membrane antigen 16 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • Only few chromosome markers based on actual sequence data (repeat polymorphisms) are available For marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceuticals or biological products, which instructions reflect production, use Or a government agency that sells it allows it to be administered to humans.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Prostate specific membrane antigen 16 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of prostate-specific membrane antigen 16 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine antigène prostatique spécifique membranaire 16, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment du cancer prostatique, des tumeurs bénignes prostatiques, de l'hyperplasie prostatique, de la prostatite et du cancer de la prostate métastatique. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine antigène prostatique spécifique membranaire 16.
PCT/CN2001/000324 2000-03-17 2001-03-16 Nouveau polypeptide, proteine antigene prostatique specifique membranaire 16, et polynucleotide codant pour ce polypeptide WO2001079490A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU50240/01A AU5024001A (en) 2000-03-17 2001-03-16 A novel polypeptide- prostate specific membrane antigen 16 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00114986.5 2000-03-17
CN 00114986 CN1314361A (zh) 2000-03-17 2000-03-17 一种新的多肽——前列腺特异性膜抗原16和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001079490A1 true WO2001079490A1 (fr) 2001-10-25

Family

ID=4584457

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000324 WO2001079490A1 (fr) 2000-03-17 2001-03-16 Nouveau polypeptide, proteine antigene prostatique specifique membranaire 16, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1314361A (fr)
AU (1) AU5024001A (fr)
WO (1) WO2001079490A1 (fr)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105646663A (zh) * 2014-03-24 2016-06-08 朱育盼 特异性结合前列腺癌的短肽pcp4及其应用
CN105646666A (zh) * 2014-03-24 2016-06-08 朱育盼 特异性结合前列腺癌的短肽pcp12及其应用
CN106213492A (zh) * 2016-07-22 2016-12-14 山东博奥克生物科技有限公司 一种提升运动机能并增加骨密度的健康产品及制备方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999047041A1 (fr) * 1998-03-19 1999-09-23 Board Of Regents, The University Of Texas System Appareil d'imagerie confocal a fibres optiques et ses procedes d'utilisation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999047041A1 (fr) * 1998-03-19 1999-09-23 Board Of Regents, The University Of Texas System Appareil d'imagerie confocal a fibres optiques et ses procedes d'utilisation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 21 April 1997 (1997-04-21), WILSON R. ET AL., XP002947824, accession no. NCBI Database accession no. AAB52660.1 *

Also Published As

Publication number Publication date
AU5024001A (en) 2001-10-30
CN1314361A (zh) 2001-09-26

Similar Documents

Publication Publication Date Title
WO2001072786A1 (fr) Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide
WO2001079490A1 (fr) Nouveau polypeptide, proteine antigene prostatique specifique membranaire 16, et polynucleotide codant pour ce polypeptide
WO2001073062A1 (fr) Nouveau polypeptide, antigene prostatique specifique membranaire 18, et polynucleotide codant pour ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001066730A1 (fr) Nouveau polypeptide, proteine humaine rs3 12, et polynucleotide codant pour ce polypeptide
WO2002040532A1 (fr) Nouveau polypeptide, antigene prostatique specifique membranaire 9, et polynucleotide codant pour ce polypeptide
WO2001085752A1 (fr) Polynucleotide codant un peptide de myosine
WO2001094593A1 (fr) Nouveau polypeptide, glycero-3-phosphate deshydrogenase humaine 11, et polynucleotide codant ce polypeptide
WO2001064734A1 (fr) Nouveau polypeptide, cathepsine humaine 18, et polynucleotide codant pour ce polypeptide
WO2001072799A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 9, et polynucleotide codant pour ce polypeptide
WO2001074865A1 (fr) Nouveau polypeptide, proteine a doigt de zinc 10, et polynucleotide codant pour ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001049726A1 (fr) Nouveau polypeptide, recepteur du peptide natriuretique humain 18, et polynucleotide codant pour ce polypeptide
WO2001055374A1 (fr) Nouveau polypeptide, sequence 71 de multirepetition de la leucine, et polynucleotide codant pour ce polypeptide
WO2001046430A1 (fr) Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide
WO2001066580A1 (fr) Nouveau polypeptide, proteine humaine 13 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001081572A1 (fr) Nouveau polypeptide, antigene humain rage4 25 du cancer du rein, et polynucleotide codant pour ce polypeptide
WO2001075005A2 (fr) Nouveau polypeptide, sous-unite c de l'atpase pompe a protons vacuolaire (v-atpase) 12, et polynucleotide codant pour ce polypeptide
WO2001070794A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 11, et polynucleotide codant pour ce polypeptide
WO2001040295A1 (fr) Nouveau polypeptide, proteine humaine 48 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001074880A1 (fr) Nouveau polypeptide, peroxydase proteine humaine 10, et polynucleotide codant pour ce polypeptide
WO2001046442A1 (fr) Nouveau polypeptide, cysteine protease 10, et polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001083676A2 (fr) Nouveau polypeptide, phosphatase humaine 10 fortement striee, et polynucleotide codant pour ce polypeptide
WO2001046253A1 (fr) Nouveau polypeptide, calcitonine 11, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP