WO2001081572A1 - Nouveau polypeptide, antigene humain rage4 25 du cancer du rein, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, antigene humain rage4 25 du cancer du rein, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001081572A1 WO2001081572A1 PCT/CN2001/000599 CN0100599W WO0181572A1 WO 2001081572 A1 WO2001081572 A1 WO 2001081572A1 CN 0100599 W CN0100599 W CN 0100599W WO 0181572 A1 WO0181572 A1 WO 0181572A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- antigen
- polynucleotide
- rage4
- kidney cancer
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4748—Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide—a human kidney cancer RAGE4 antigen 25, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
- RAGE-related genes including RAGE1, RAGE2, RAGE3, and RAGE4.
- RAGE1 can encode the LE9211-A antigen.
- RAGE1 and RAGE1 contains a 37Bp insertion sequence ⁇ 'J at position 249, but RAGE1 does not; but RAGE1 has an additional nucleoside at position 191.
- RAGE4's cDNA is about 800 bases longer than other RAGEs, and its 5'-end sequence is the same as RAGE2, but the sequence from position 434 to the poly A tail is different from the cDNA of other RAGE genes.
- the RAGE4 cDNA may be caused by the selective conjugation of the RAGE2 gene.
- the RAGE4 cDNA includes a long open reading frame (0RF) and a start codon. It encodes a protein containing 187 amino acid residues and is the main product of the RAGE4 gene. The protein contains several peptide sequences that can bind to different HLA molecules.
- RAGE1 was able to encode the LE9211-A antigen.
- the other three RAGE cDNAs and HLA-B7 cDNA were transferred into COS-7 cells, and they were found not to have the ability to bind to CTL263 7.
- RAGE1 if the 37Bp base is inserted, it causes the premature termination of its second reading frame.
- the human kidney cancer RAGE4 antigen 25 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes
- the human kidney cancer RAGE4 antigen 25 protein, especially the amino acid sequence of this protein was identified. Isolation of the human kidney cancer RAGE4 antigen 25 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the diagnosis and / or treatment of a disease, so it is important to isolate its coding DNA. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human kidney cancer RAGE4 antigen 25.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human kidney cancer RAGE4 antigen 25.
- Another object of the present invention is to provide a method for producing human kidney cancer RAGE4 antigen 25.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human kidney cancer RAGE4 antigen 25.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human kidney cancer RAGE4 antigen 25.
- Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of human kidney cancer RAGE4 antigen 25.
- the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1 1 to 8 to 03 in SEQ ID NO: 1; and (b) having a sequence in SEQ ID NO: 1 1 -1 358-bit sequence.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human kidney cancer RAGE4 antigen 25 protein activity, which comprises using the polypeptide of the present invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human kidney cancer RAGE4 antigen 25 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating a kidney tumor or other diseases caused by abnormal expression of human kidney cancer RAGE4 antigen 25.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of Leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to proteins that have the structure, regulation, or biochemical function of natural molecules.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with human kidney cancer RAGE4 antigen 25, causes the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human kidney cancer RAGE4 antigen 25.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human kidney cancer RAGE4 antigen 25 when combined with human kidney cancer RAGE4 antigen 25.
- Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that binds human kidney cancer RAGE4 antigen 25.
- Regular refers to a change in the function of human kidney cancer RAGE4 antigen 25, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human kidney cancer RAGE4 antigen 25.
- substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human kidney cancer RAGE4 antigen 25 using standard protein purification techniques. Basically Pure human kidney cancer RAGE4 antigen 25 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human kidney cancer RAGE4 antigen 25 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean strict Conditions with reduced sex allow non-specific binding because conditions with reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences.
- the percentage identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.).
- the MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0
- the Cluster method arranges groups of sequences by checking the distance between all pairs. Into clusters. The clusters are then assigned in pairs or groups.
- the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by the Cluster method or using methods known in the art such as Jotun He in. The percent identity between nucleic acid sequences (Hein J., (1990) Methods in emzumology 183: 625-645) 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody means a complete antibody molecule and its fragments, such as Fa, ⁇ ( & 13 ') 2 and? It can specifically bind to the epitope of human kidney cancer RAGE4 antigen 25.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide exists in a living animal. It is not isolated, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human kidney cancer RAGE4 antigen 25 means that human kidney cancer RAGE4 antigen 25 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human kidney cancer RAGE4 antigen 25 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human kidney cancer RAGE4 antigen 25 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human kidney cancer RAGE4 antigen 25, which is basically composed of the amino acid sequence shown in SEQ ID D NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human kidney cancer RAGE4 antigen 25.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human kidney cancer RAGE4 antigen 25 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
- such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of an amino acid encoding SEQ ID NO: 2 Polynucleotide composition of a polypeptide of the amino acid sequence.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1358 bases in length and its open reading frame 114-803 encodes 229 amino acids.
- this polypeptide has a similar expression profile to the human kidney cancer RAGE4 antigen, and it can be deduced that the human kidney cancer RAGE4 antigen 25 has a similar function to the human kidney cancer RAGE4 antigen.
- the polynucleotide of the present invention may be in the form of DM or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DM can be a coding chain or a non-coding chain.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization L ° / ⁇ Using denaturants, such as 50% (v / v) formamide, 0.1% calf serum / 0. l ° /.
- hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, preferably at least 100 nucleotides.
- Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human kidney cancer RAGE4 antigen 25.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human kidney cancer RAGE4 antigen 25 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDM libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or loss of marker gene function; (3) measuring the level of human kidney cancer RAGE4 antigen 25 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human kidney cancer RAGE4 antigen 25 gene.
- ELISA enzyme-linked immunosorbent assay
- the RACE method RACE-rapid amplification of cDNA ends
- the primers can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by conventional methods.
- the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the human kidney cancer RAGE4 antigen 25 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology. .
- a polynucleotide sequence encoding human kidney cancer RAGE4 antigen 25 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- An expression vector for DNA sequences and appropriate transcriptional / translational regulatory elements include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sanibroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide niRNA synthesis.
- Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancement on the late side of the origin of replication And adenovirus enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human kidney cancer RAGE4 antigen 25 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells
- fly S 2 or Sf 9 animal cells
- animal cells such as CH0, COS or Bowes s melanoma cells Wait.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human kidney cancer RAGE4 antigen 25 (Scence, 1 984; 224: 1431). Generally, the following steps are taken:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include but Not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmosis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmosis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High performance liquid chromatography (HPLC
- FIG. 1 is a comparison diagram of gene chip expression profiles of human kidney cancer RAGE4 antigen 25 and human kidney cancer RAGE4 antigen according to the present invention.
- the upper graph is a graph of the expression profile of human kidney cancer RAGE4 antigen 25, and the lower graph is the graph of the expression profile of human kidney cancer RAGE4 antigen 25.
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates non-starved L02
- 8 indicates L02 +, lhr, As 3+
- 20 means prostate
- 21 means fetal heart
- 22 means heart
- 23 means muscle
- 24 means testis
- 25 means fetal thymus
- 26 means thymus.
- Figure 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of the isolated human kidney cancer RAGE4 antigen 25.
- 25KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5c. The bacteria formed a cDNA library.
- Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and one of the clones was found.
- the cDNA sequence of 0150e01 is new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, PCR was performed using the following primers:
- Primerl 5'- GGAGATAAAGAATCTATTAAGAAT -3 '(SEQ ID NO: 3)
- Primer2 5,-TTTTAGAAAACAATTTTTATTTAA -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 ⁇ l / L KC1, 10 mmol / L Tris-CI, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol in a 50 ⁇ 1 reaction volume Primer, 1U Taq DNA polymerase (C 1 on tech company).
- the reaction was performed on a PE9600 DNA thermal cycler (Perk yn-E 1 me r) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. 0 Simultaneously set during RT-PCR ⁇ -act in is the positive control and template blank is the negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen).
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1358 bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human kidney cancer RAGE4 antigen 25 gene expression:
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA containing 20mM 3- (N- morpholino) propanesulfonic acid (pH 7.0) - was electrophoresed on a 1.2% agarose gel ImM EDTA- 2 .2M formaldehyde - 5mM sodium acetate. It was then transferred to a nitrocellulose membrane.
- the DNA probe used was the PCR-encoded human kidney cancer RAGE4 antigen 25 coding region sequence (114bp to 803bp) shown in FIG.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 ( pH7.4)-5 x SSC- 5 x Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in lx SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human kidney cancer RAGE4 antigen 25
- Primer3 5,-CCCCATATGATGTTGGGCCCCTCTTGGGATGGA —3, (Seq ID No: 5)
- Primer4 5,-CATGGATCCTTAAATATCATTTCTTGGCCTCTG -3, (Seq ID No: 6)
- the 5 ′ ends of these two primers contain Ndel and BamHI restriction sites, respectively.
- the coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively.
- the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3) Digestion site.
- PCR was performed using the pBS-0150e01 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 contains 10 pg of pBS- 0150e01 plasmid and primers! ⁇ : ⁇ ! ⁇ And? ! ⁇ ! : ⁇ Points and ⁇ for ⁇ ! ⁇ ⁇ , Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
- Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into E. coli DH5 CC using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 ⁇ g / ml), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0150e01) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- the host bacteria BL21 (pET-0150e01) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L, Continue incubation for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidine (6His-Tag). A purified human kidney cancer RAGE4 antigen 25 was purified.
- a peptide synthesizer (product of PE company) was used to synthesize the following human kidney cancer RAGE4 antigen 25-specific peptides: NH2-Met-Leu-Gly-Pro-Ser-Trp-Asp-Gly-Asp-Glu-Ala-Glu-Ser -Thr-Gly-COOH (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Sou thern imprinting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention;
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Probes 1 3 ⁇ l Probe (0.1 OD / 10 ⁇ 1), add 2 ⁇ IKinase buffer, 8-10 uCi ⁇ - 32 P_dATP + 2U Kinase, to make up to a final volume of 20 ⁇ 1.
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared after the collection solutions of the first peak are combined.
- probe 1 can be used for qualitative and quantitative analysis.
- the presence and differential expression of the polynucleotide of the present invention in different tissues are analyzed.
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP 5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech
- Cy5dUTP 5- Amino- propargyl-2'-deoxyuridine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amershani Phamacia Biotech Company
- the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleCheni) for 16 hours, washed with a washing solution (lx SSC, 0.2% SDS) at room temperature and scanned with ScanArray 3000
- the instrument purchased from General Scanning Company, USA was used for scanning.
- the scanned image was analyzed and processed with Iniagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
- the encoded product of the RAGE4 gene can bind to different major histocompatibility antigens HLA molecules, thereby identifying and killing tumor cells. It has also been found through in vitro immunization experiments that the peptide sequence encoded by the RAGE4 gene can stimulate lymphocytes of normal individuals, thereby producing cancer-specific CTL. All RAGE-related genes are kidney-specific, and the proteins they encode can only be expressed in the kidney, which is of great significance for the research and treatment of kidney cancer. Research at the molecular level of cancer antigens has made possible immunotherapies using known antigens for cancer treatment.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human kidney cancer RAGE4 antigen, and both have similar biological functions. It is specifically expressed in the kidney in vivo and is extremely important for tumor immune surveillance and immune killing. Its abnormal expression is closely related to kidney diseases, especially kidney tumors.
- kidney diseases including but not limited to: renal cortical tubular adenoma, eosinophil adenoma, and juxtaglomerular cells Neoplasm, polycystic nephroma, renal cell carcinoma, renal sarcomatoid carcinoma, papillary renal cell carcinoma, nephroblastoma, glomerulonephritis, tubular disease, pyelonephritis, horseshoe kidney
- Abnormal expression of the human kidney cancer RAGE4 antigen 25 of the present invention may also cause certain genetic diseases and the like.
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially kidney diseases, certain genetic diseases, and the like.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human kidney cancer RAGE4 antigen 25.
- Agonists enhance human kidney cancer RAGE4 antigen 25 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human kidney cancer RAGE4 antigen 25 can be cultured together with labeled human kidney cancer RAGE4 antigen 25 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human kidney cancer RAGE4 antigen 25 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human kidney cancer RAGE4 antigen 25 can bind to human kidney cancer RAGE4 antigen 25 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- human kidney cancer RAGE4 antigen 25 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human kidney cancer RAGE4 antigen 25 and its receptor. .
- Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human kidney cancer RAGE4 antigen 25 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. For screening, 25 molecules of human kidney cancer RAGE4 antigen should generally be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the human kidney cancer RAGE4 antigen 25 epitope. These antibodies include (but are not limited to): many Cloned antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human kidney cancer RAGE4 antigen 25 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait. Techniques for preparing monoclonal antibodies to human kidney cancer RAGE4 antigen 25 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV- Hybridoma technology, etc. Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against human kidney cancer RAGE4 antigen 25.
- Antibodies against human kidney cancer RAGE4 antigen 25 can be used in immunohistochemical techniques to detect human kidney cancer AGE4 antigen 25 in biopsy specimens.
- Monoclonal antibodies that bind to human kidney cancer RAGE4 antigen 25 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human kidney cancer RAGE4 antigen 25 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol crosslinker such as SPDP, and toxin is bound to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human kidney cancer RAGE4 antigen 25-positive cells .
- the antibodies of the present invention can be used to treat or prevent diseases associated with human kidney cancer RAGE4 antigen 25.
- Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human kidney cancer RAGE4 antigen 25.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human kidney cancer RAGE4 antigen 25.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human kidney cancer RAGE4 antigen 25 detected in the test can be used to explain the importance of human kidney cancer RAGE4 antigen 25 in various diseases and to diagnose diseases in which human kidney cancer RAGE4 antigen 25 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human kidney cancer RAGE4 antigen 25 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human kidney cancer RAGE4 antigen 25.
- Recombinant gene therapy vectors (such as viral vectors) can be designed for expression Mutation of human kidney cancer RAGE4 antigen 25 to inhibit endogenous human kidney cancer RAGE4 antigen 25 activity.
- a variant human kidney cancer RAGE4 antigen 25 may be a shortened human kidney cancer RAGE4 antigen 25 lacking a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity.
- the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human kidney cancer RAGE4 antigen 25.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human kidney cancer RAGE4 antigen 25 into cells.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human kidney cancer RAGE4 antigen 25 can be found in existing literature (Sambrook, etal.).
- a recombinant polynucleotide encoding human kidney cancer RAGE4 antigen 25 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human kidney cancer RAGE4 antigen 2 5 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
- This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human kidney cancer RAGE4 antigen 25 can be used for the diagnosis of diseases related to human kidney cancer RAGE4 antigen 25.
- the polynucleotide encoding human kidney cancer RAGE4 antigen 25 can be used to detect the expression of human kidney cancer RAGE4 antigen 25 or the abnormal expression of human kidney cancer RAGE4 antigen 25 in a disease state.
- the DNA sequence encoding human kidney cancer RAGE4 antigen 25 can be used to hybridize biopsy specimens to determine the expression of human kidney cancer RAGE4 antigen 25.
- Hybridization techniques include Souternrn blotting, Northenrn blotting, in situ hybridization, and the like. These techniques and methods are all mature and open technologies, and related kits are commercially available.
- Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Micr oa r ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and Genetic diagnosis.
- a microarray Merix oa r ray
- a DNA chip also known as a "gene chip”
- Human kidney cancer RAGE4 antigen 25 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human kidney cancer RAGE4 antigen 25 transcription products.
- Human kidney cancer RAGE4 antigen 25 gene mutations can also be used to diagnose human kidney cancer RAGE4 antigen 25 Related diseases.
- Human kidney cancer RAGE4 antigen 25 mutation forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human kidney cancer RAGE4 antigen 25 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping capability and every 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human kidney cancer RAGE4 antigen 25 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human kidney cancer RAGE4 antigen 25 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Toxicology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU67268/01A AU6726801A (en) | 2000-04-27 | 2001-04-23 | A novel polypeptide, a human renal cancer rage4 antigen 25 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00115469.9 | 2000-04-27 | ||
CN 00115469 CN1320626A (zh) | 2000-04-27 | 2000-04-27 | 一种新的多肽——人肾癌rage4抗原25和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001081572A1 true WO2001081572A1 (fr) | 2001-11-01 |
Family
ID=4584915
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000599 WO2001081572A1 (fr) | 2000-04-27 | 2001-04-23 | Nouveau polypeptide, antigene humain rage4 25 du cancer du rein, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1320626A (fr) |
AU (1) | AU6726801A (fr) |
WO (1) | WO2001081572A1 (fr) |
-
2000
- 2000-04-27 CN CN 00115469 patent/CN1320626A/zh active Pending
-
2001
- 2001-04-23 WO PCT/CN2001/000599 patent/WO2001081572A1/fr active Application Filing
- 2001-04-23 AU AU67268/01A patent/AU6726801A/en not_active Abandoned
Non-Patent Citations (4)
Title |
---|
DATABASE GENBANK [online] 14 May 1999 (1999-05-14), Database accession no. AC006441 * |
DATABASE GENBANK [online] 18 February 2000 (2000-02-18), accession no. EMBL Database accession no. Z98200 * |
DATABASE GENBANK [online] 21 April 1999 (1999-04-21), Database accession no. AC007350 * |
DATABASE GENBANK [online] 23 October 1999 (1999-10-23), Database accession no. AC006449 * |
Also Published As
Publication number | Publication date |
---|---|
AU6726801A (en) | 2001-11-07 |
CN1320626A (zh) | 2001-11-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001072786A1 (fr) | Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide | |
WO2001079490A1 (fr) | Nouveau polypeptide, proteine antigene prostatique specifique membranaire 16, et polynucleotide codant pour ce polypeptide | |
WO2001073062A1 (fr) | Nouveau polypeptide, antigene prostatique specifique membranaire 18, et polynucleotide codant pour ce polypeptide | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001081572A1 (fr) | Nouveau polypeptide, antigene humain rage4 25 du cancer du rein, et polynucleotide codant pour ce polypeptide | |
WO2001085752A1 (fr) | Polynucleotide codant un peptide de myosine | |
WO2001094371A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide | |
WO2001075117A1 (fr) | Nouveau polypeptide, tyrosinase humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001090348A1 (fr) | Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide | |
WO2001055399A1 (fr) | Nouveau polypeptide, dipeptide aminopeptidase humaine 28, et polynucleotide codant pour ce polypeptide | |
WO2001079423A2 (fr) | Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide | |
WO2001075054A2 (fr) | Nouveau polypeptide, facteur humain de regulation 30 de la transcription de la microglobuline, et polynucleotide codant pour ce polypeptide | |
WO2001075016A2 (fr) | Nouveau polypeptide, tyrosinase humaine 16, et polynucleotide codant pour ce polypeptide | |
WO2001055381A1 (fr) | Nouveau polypeptide, facteur regulateur 80 de la transcription humaine, et polynucleotide codant pour ce polypeptide | |
WO2001072801A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide | |
WO2001072789A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 10, et polynucleotide codant pour ce polypeptide | |
WO2001072792A1 (fr) | Nouveau polypeptide, proteine humaine 13 analogue a l'ubiquitine, et polynucleotide codant pour ce polypeptide | |
WO2001070792A1 (fr) | Nouveau polypeptide, tyrosinase humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001066588A1 (fr) | Nouveau polypeptide, facteur humain 1-12 de liaison intensive de leucocytes, et polynucleotide codant pour ce polypeptide | |
WO2001072785A1 (fr) | Nouveau polypeptide, proteine humaine helice-boucle-helice 17 (b-hlh), et polynucleotide codant pour ce polypeptide | |
WO2001070994A1 (fr) | Nouveau polypeptide, dihydropyridine dicarboxylate deshydrogenase humaine 18, et polynucleotide codant pour ce polypeptide | |
WO2001072813A1 (fr) | Nouveau polypeptide, facteur humain 6-14 de couplage de l'atpase mitochondriale, et polynucleotide codant pour ce polypeptide | |
WO2001079430A2 (fr) | Nouveau polypeptide, serine protease humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001074894A1 (fr) | Nouveau polypeptide, proteine humaine de regulation 12 de la proteine phosphorylase, et polynucleotide codant pour ce polypeptide | |
WO2001075030A2 (fr) | Nouveau polypeptide, tyrosinase humaine 11, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |