WO2001073062A1 - Nouveau polypeptide, antigene prostatique specifique membranaire 18, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, antigene prostatique specifique membranaire 18, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001073062A1
WO2001073062A1 PCT/CN2001/000327 CN0100327W WO0173062A1 WO 2001073062 A1 WO2001073062 A1 WO 2001073062A1 CN 0100327 W CN0100327 W CN 0100327W WO 0173062 A1 WO0173062 A1 WO 0173062A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
prostate
membrane antigen
specific membrane
Prior art date
Application number
PCT/CN2001/000327
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU46346/01A priority Critical patent/AU4634601A/en
Publication of WO2001073062A1 publication Critical patent/WO2001073062A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a prostate-specific membrane antigen 18, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Background technique
  • Organ-specific antigens can be found "responding to only one specific tissue.
  • the prostate is a very unusual organ. With age, most organs shrink, but the prostate glands keep increasing. The case eventually developed into a malignant tumor.
  • Prostate cancer is the most common malignant disease in men and ranks second among cancers that cause death in men [Chiarodo, A. (1991) Cancer Res., 51: 2498-2505]. There are many different manifestations of prostate cancer, from slowly occurring to painlessly worsening, to developing into non-metastatic disease, and finally metastasizing to bone.
  • PAP was one of the earliest immune sera to diagnose prostate cancer metastasis and is now replaced with PSA.
  • PSA is related to tumors, an indicator of cancer cell metastasis, and provides parameters for surgery, radiation, and hormonal ablation therapy for patients with prostate cancer. All these proteins are secreted in the serum and prostate and can be measured.
  • LNCaP human prostate cancer cell line has been established from a metastatic lymph node from a pre-treated patient with hormonal refractory prostate cancer
  • the epitope of 7E11-C5 includes a carbohydrate portion of an antigen, and the molecular weight of this antigen is about 100,000 kDa [Abdel-Nabi, H., Wright, GL, et
  • the PSM antigen presents many interesting and meaningful characteristics. Three arginine residues at the N-terminus of the transmembrane region indicate that the protein is a type II integrated membrane protein, and a short N-terminal region is located on the cytoplasmic side of the membrane, and a large C-terminal domain is located outside the molecule [von Heij ine, G. Biochim. Biophy s. Acta, 947: 307-333, 1988]. As the only integral membrane protein of prostate epithelial cells, PSM antigen or a part thereof can be used as an ideal site for observing metastatic accumulation.
  • the prostate-specific membrane antigen 18 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more involved in these processes.
  • the prostate-specific membrane antigen 18 protein, especially the amino acid sequence of this protein was identified.
  • the isolation of the new prostate-specific membrane antigen 18 protein encoding gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a prostate-specific membrane antigen 18. .
  • Another object of the present invention is to provide a polynucleotide comprising a polynucleotide encoding a prostate-specific membrane antigen 18. Genetically engineered host cells.
  • Another object of the present invention is to provide a method for producing prostate-specific membrane antigen 18.
  • Another object of the present invention is to provide an antibody against the polypeptide-prostate specific membrane antigen 18 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide-prostate specific membrane antigen 18 of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of prostate-specific membrane antigen 18.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of prostate specific membrane antigen 18 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of prostate-specific membrane antigen 18 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
  • the invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of prostate cancer, benign prostate tumor, prostatic hyperplasia, prostatitis, metastatic prostate cancer or other abnormal expression of prostate specific membrane antigen 18. Use of medicines that cause disease.
  • ⁇ nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genome or a synthesis DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention refers to the amino acid sequence of a naturally occurring protein molecule, such a polypeptide "or ⁇ "Protein” is not meant to limit the amino acid sequence to the complete natural amino acid associated with the protein molecule.
  • a “protein or polynucleotide variant” refers to an amino acid sequence or a polynucleotide sequence encoding one or more amino acid or nucleotide changes.
  • the changes may include amino acid sequences or amino acid or Deletions, insertions or substitutions of nucleotides.
  • Variants may have "conservative" changes, where the substituted amino acid has similar structural or chemical properties as the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or a nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • -"Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein with the structural, regulatory, or biochemical function of a natural molecule.
  • immunological activity refers to natural, recombinant, or synthetic proteins and fragments thereof to induce specific immunity in a suitable animal or cell Response and ability to bind specific antibodies.
  • Antist refers to a protein that can cause changes in the protein when bound to prostate-specific membrane antigen 18.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to prostate-specific membrane antigen 18.
  • An antagonist "or inhibitor” refers to a molecule that can block or regulate the biological or immunological activity of prostate-specific membrane antigen 18 when combined with prostate-specific membrane antigen 18.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to prostate-specific membrane antigen 18.
  • Modulation refers to a change in the function of the prostate-specific membrane antigen 18, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of the prostate-specific membrane antigen 18.
  • Substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify prostate-specific membrane antigens using standard protein purification techniques.
  • Substantially pure prostate-specific membrane antigen 18 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of the prostate-specific membrane antigen 18 polypeptide can be analyzed by amino acid sequence.
  • Complementary or “complementary” refers to the natural binding of polynucleotides that are base-paired under conditions of acceptable salt concentration and temperature.
  • sequence T GA can be combined with the complementary sequences A-C-T.
  • Two The complementarity between individual single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • Homology refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits the hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be achieved by hybridization under conditions of reduced stringency (Southern blotting or Northern blot, etc.) to detect. Basically homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the degree of stringency is reduced. Conditions allow non-specific binding because conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences.
  • the percentage identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis. ) MEGALIGN program can compare two or more sequences (Higgins, DG and PM Sharp according to different methods such as Cluster method) (1988) Gene 73: 237-244).
  • the Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences is calculated by the following formula: Number of residues matching between sequence A and sequence X 100 Number of residues in sequence A-number of interval residues in sequence A
  • the number of spacer residues in a sequence B can also be determined by the Cluster method or by a method known in the art such as Jotun Hein.
  • the percent identity between nucleic acid sequences (Hein J., (1990) Methods in emzumology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions when the alignment between amino acid sequences is aligned.
  • Amino acids used for conservative substitutions For example, negatively charged amino acids may include aspartic acid and glutamic acid ; Positively charged amino acids can include lysine and arginine; Amino acids with similarly charged head groups that have similar hydrophilicity can include leucine, isoleucine, and valine; glycine and alanine Amino acids; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a specific DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the sense strand.
  • a “derivative” refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl, or amino group.
  • a nucleic acid derivative may encode a polypeptide that retains the main biological properties of a natural molecule.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the antigenic determinant of prostate-specific membrane antigen 18.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • ⁇ separated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector and also It is possible that such a polynucleotide or polypeptide is part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated means that the substance is separated from its original environment (if it is a natural substance, the original environment is the natural environment).
  • the polynucleotide and polypeptide in the natural state in a living cell are There is no isolation and purification, but the same polynucleotide or polypeptide is separated and purified if it is separated from other substances existing in its natural state.
  • isolated prostate-specific membrane antigen 18 "means that prostate-specific membrane antigen 18 is substantially free of other proteins, lipids, sugars, or other substances naturally associated with it. Those skilled in the art can use standard Protein purification technology is used to purify prostate-specific membrane antigen 18. The substantially pure polypeptide can produce a single main band on a non-reducing polyacrylamide gel. The purity of prostate-specific membrane antigen 18 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, prostate-specific membrane antigen 18, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and is preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of prostate-specific membrane antigen 18.
  • fragment, derivative and analog refer to a polypeptide that substantially maintains the same biological function or activity of the prostate-specific membrane antigen 18 of the present invention.
  • a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused to the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2102 bases in length and its open reading frame 1503-1985 encodes 160 amino acids.
  • this polypeptide has a similar expression profile to the prostate-specific membrane antigen, and it can be inferred that the prostate-specific membrane antigen 18 has a function similar to that of the prostate-specific membrane antigen.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a degenerate variant "in the present invention means a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide means a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “-strict conditions” means: (1) at lower ions Intensity and hybridization and elution at higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) adding a denaturant such as 50% (v / v) formamide, 0 1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding prostate-specific membrane antigen 18.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the prostate-specific membrane antigen 18 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, fluorescein, or enzymes (such as alkaline oxidase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein products expressed by the prostate-specific membrane antigen 18 gene.
  • ELISA enzyme-linked immunosorbent assay
  • the RACE method RACE—rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Selected and synthesized by conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a prostate-specific membrane antigen 18 coding sequence, and a recombinant technology for producing a polypeptide of the present invention. method.
  • a polynucleotide sequence encoding the prostate-specific membrane antigen 18 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable in the present invention include, but are not limited to: in bacteria T7 promoter-based expression vectors for expression (Rosenberg, et al.
  • any plasmid and vector can be used to construct recombinant expression vectors.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoters, retroviral LTRs and other known controllable genes in prokaryotic cells or eukaryotic cells
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
  • Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding prostate-specific membrane antigen 18 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • DNA sequence of the present invention or a recombinant vector containing the DNA sequence to transform a host cell is useful
  • the conventional techniques are well known to those skilled in the art.
  • the host is a prokaryote such as E. coli, it can absorb
  • DNA competent cells can be harvested after the exponential growth phase and treated with the CaCl 2 method, the steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant prostate-specific membrane antigen 18 (Scienc e , 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
  • FIG. 1 is a comparison diagram of gene chip expression profiles of prostate specific membrane antigen 18 and prostate specific membrane antigen of the present invention.
  • the upper picture is a graph of the prostate-specific membrane antigen 18 expression profile, and the lower picture is the prostate specific Histogram of expression profile of heterosexual membrane antigen.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated prostate-specific membrane antigen 18.
  • 18KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • RNA from human fetal brain was extracted by guanidine isothiocyanate / phenol / chloroform method.
  • Poly (A) mRNA was isolated from total RNA using the Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragment into the multicloning site of pBSK (+) vector (Clontech) to transform DH5JL. The bacteria formed a cDNA library.
  • Dye terminate cycle reaction sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primer 1 5,-GGAGGAGCTAAGGACTAGAGGTTG —3, (SEQ ID NO: 3)
  • Primer2 5 '-GTTTTATAAAACATAAATAATCAT -3' (SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp at the 5 'end of SEQ ID NO: l;
  • Primer2 is the 3 'terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l of KC1, 10 mmol / L in a 50 ⁇ l reaction volume
  • Tris-Cl (pH 8. 5), 1.5 raraol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpraol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elraer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector using a TA cloning kit (Invitrogen).
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2102bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of prostate specific membrane antigen 18 gene expression:
  • the method involves acid sulfur-ken-L-guanidine phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25 mM sodium citrate, 0.2 M sodium acetate (pH 4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) Centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was electrophoresis performed on a 1.2% agarose gel containing 20raM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5raM sodium acetate-IraM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • a - 32 P dATP DNA probes prepared by random primer SYSTEM 32 P- labeled. The DNA probe used was the PCR-amplified prostate-specific membrane antigen 18 coding region sequence (1503bp to 1985bp) shown in FIG. 1.
  • the 32P- labeled probe (approximately 2 X 10 6 cpm / ml) and transferred to a nitrocellulose membrane RNA is hybridized overnight at 42 ° C in a solution, the solution comprising 50% formamide - 25mM KH 2 P0, (pH7. 4)-5 X SSC-5 X Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 XSSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant prostate-specific membrane antigen 18
  • a pair of specific amplification primers is designed, and the sequence is as follows ⁇ Primer3: 5, ⁇ CCCCATATGATGATAGTTCTAGTGAGGGTGGGT -3, (Seq ID No: 5) Primer4: 5,-CCCGAATTCCTAAGCCAAGATTTGTATCTCTGT -3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and EcoRI restriction sites, The coding sequences of the 5 'end and 3' end of the gene of interest are followed respectively, and the Ndel and EcoRI restriction sites correspond to the expression vector plasmid
  • pBS-0683cl2 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS- 0683cl2 plasmid, primers Primer-3 and Primer-4 were 10 pmol,
  • a positive clone (pET-0683cl2) with the correct sequence was selected, and the recombinant plasmid was transformed into Escherichia coli BL21 (DE3) plySs (Novagen) using the calcium chloride method.
  • the host strain BL21 (pET-0683cl2) was cultured at 37 ° C to logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L. Continue to cultivate for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation.
  • Polypeptide synthesizer (product of PE company) was used to synthesize the following prostate-specific membrane antigen 18-specific peptides: -Trp-Trp-C00 H (SEQ ID NO: 7).
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps to hybridize the fixed polynucleotide sample to the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The same or complementary oligonucleotide fragment of the polynucleotide SEQ ID NO: 1.
  • the spot imprint method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention as hybridization probes should follow the following principles and several aspects to be considered: 1.
  • the preferred range of probe size is 18-50 nucleotides;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41N:
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • Two NC membranes are required for each probe, so that it can be used in subsequent experiments
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • pre-hybridization solution 10xDenhardt's ; l; 6xSS (:, 0.1 mg / ml CT DNA (calf thymus DNA).
  • Gene microarray or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently researching and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research on the function of new genes; finding and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see DeRisi, J. L., Lyer, V. & Brown, P. 0.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were dried to fix the DNA on the glass slides to prepare chips. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
  • the total mRNA was extracted from the human mixed tissue and the specific tissue (or stimulated cell line) of the body in one step, and the niRNA was purified by Oligotex mRNA Midi Kit (purchased from QiaGen), and the fluorescence was tested by reverse transcription.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA- Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Plot a graph based on these 13 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profiles of prostate-specific membrane antigen 18 and prostate-specific membrane antigen according to the present invention are very similar. Industrial applicability
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Prostate cancer is the most common malignant disease in men.
  • PSA is a serum immune indicator for the diagnosis of prostate cancer metastasis and spread.
  • LNCaP human prostate adenocarcinoma cell line has been established as the best model for studying prostate cancer cells in vivo. This cell line produces a prostate-specific monoclonal antibody, PSM.
  • PSM antigen is an integral membrane protein of prostate epithelial cells, and PSM antigen or a part thereof can be used as an ideal site for observing metastatic accumulation.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human prostate-specific membrane antigen, and both have similar biological functions.
  • As an integral membrane protein of prostate epithelial cells it mainly participates in cell differentiation and protein expression of prostatic gland tissue, and regulates the proliferation, differentiation and spread of prostate cells.
  • the abnormal expression is usually closely related to the pathological changes of prostate tissue cells.
  • prostate-specific membrane antigen 18 of the present invention will produce various diseases, especially prostate diseases, including but not limited to: prostate cancer, benign tumors of the prostate, benign prostatic hyperplasia, prostatitis, and metastatic prostate Cancer
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, For example, it can treat various diseases, especially prostate diseases.
  • the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) prostate-specific membrane antigen 18.
  • Agonists enhance biological functions such as prostate-specific membrane antigen 18 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing prostate-specific membrane antigen 18 can be cultured together with a labeled prostate-specific membrane antigen 18 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of prostate-specific membrane antigen 18 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of prostate-specific membrane antigen 18 can be combined with prostate-specific membrane antigen 18 to eliminate its function, or to inhibit the production of the polypeptide, or to bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • prostate specific membrane antigen 18 can be added to the bioanalytical assay to determine whether the compound is antagonistic by measuring the effect of the compound on the interaction between prostate specific membrane antigen 18 and its receptor.
  • Agent Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to prostate-specific membrane antigen 18 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the prostate specific membrane antigen 18 molecule should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against a prostate-specific membrane antigen 18 epitope. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting prostate-specific membrane antigen 18 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
  • Techniques for preparing monoclonal antibodies to prostate-specific membrane antigen 18 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridoma technology, and EBV- Hybridoma technology, etc.
  • Antibodies against prostate specific membrane antigen 18 can be used in immunohistochemical techniques to detect prostate specific membrane antigen 18 in biopsy specimens.
  • Monoclonal antibodies that bind to prostate-specific membrane antigen 18 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • prostate-specific membrane antigen 18 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill prostate-specific membrane antigen 18-positive cells .
  • the antibodies of the present invention can be used to treat or prevent diseases associated with prostate-specific membrane antigen 18.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of prostate-specific membrane antigen 18.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of prostate specific membrane antigen 18 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of prostate specific membrane antigen 18 detected in the test can be used to explain the importance of prostate specific membrane antigen 18 in various diseases and to diagnose diseases in which prostate specific membrane antigen 18 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzyme, and can be subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis. .
  • Polynucleotides encoding prostate-specific membrane antigen 18 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormalities in cell proliferation, development, or metabolism caused by non-expression or abnormal / inactive expression of prostate-specific membrane antigen 18.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant prostate-specific membrane antigen 18 to inhibit endogenous prostate-specific membrane antigen 18 activity.
  • a variant prostate-specific membrane antigen 18 may be a shortened prostate-specific membrane antigen 18 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat abnormalities of prostate specific membrane antigen 18 expression or activity. Disease.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer a polynucleotide encoding prostate-specific membrane antigen 18 into a cell.
  • the method of constructing a polynucleotide encoding a recombinant viral vector carrying the prostate specific membrane antigen 18 can be found in existing literature (S a mbr 00 k, et al.).
  • a polynucleotide encoding the prostate-specific membrane antigen 18 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit prostate specific membrane antigen 18 raRNA are also within the scope of this invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidation synthesis of oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding prostate-specific membrane antigen 18 can be used for the diagnosis of diseases related to prostate-specific membrane antigen 18.
  • the polynucleotide encoding the prostate-specific membrane antigen 18 can be used to detect the expression of the prostate-specific membrane antigen 18 or the abnormal expression of the prostate-specific membrane antigen 18 in a disease state.
  • a DNA sequence encoding prostate-specific membrane antigen 18 can be used to hybridize biopsy specimens to determine the expression of prostate-specific membrane antigen 18.
  • Hybridization techniques include Southern blotting,
  • a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DNA chip (also called a gene chip), and used to analyze differential expression analysis and gene diagnosis of genes in tissues.
  • a microarray or a DNA chip also called a gene chip
  • the specific membrane antigen 18 specific primers can be used to detect the transcription products of prostate specific membrane antigen 18 by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
  • RT-PCR RNA-polymerase chain reaction
  • Detection of mutations in the prostate-specific membrane antigen 18 gene can also be used to diagnose prostate-specific membrane antigen 18-related diseases.
  • Forms of prostate-specific membrane antigen 18 mutations The heterosexual membrane antigen 18 DNA sequence is compared to point mutations, translocations, deletions, recombinations, and any other abnormalities. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for staining Structural changes in the body, such as deletions or translocations that are visible from the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
  • the polypeptide of the present invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as via a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Prostate specific membrane antigen 18 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of prostate-specific membrane antigen 18 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, un antigène prostatique spécifique membranaire 18, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment du cancer de la prostate, des tumeurs bénignes prostatiques, de l'hyperplasie de la prostate, de la prostatite et de la tumeur prostatique métastatique. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour l'antigène prostatique spécifique membranaire 18.
PCT/CN2001/000327 2000-03-17 2001-03-16 Nouveau polypeptide, antigene prostatique specifique membranaire 18, et polynucleotide codant pour ce polypeptide WO2001073062A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU46346/01A AU4634601A (en) 2000-03-17 2001-03-16 Novel polypeptide--- a prostate specific membrane antigen 18 and polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00114971 CN1314364A (zh) 2000-03-17 2000-03-17 一种新的多肽——前列腺特异性膜抗原18和编码这种多肽的多核苷酸
CN00114971.7 2000-03-17

Publications (1)

Publication Number Publication Date
WO2001073062A1 true WO2001073062A1 (fr) 2001-10-04

Family

ID=4584442

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000327 WO2001073062A1 (fr) 2000-03-17 2001-03-16 Nouveau polypeptide, antigene prostatique specifique membranaire 18, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1314364A (fr)
AU (1) AU4634601A (fr)
WO (1) WO2001073062A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7282331B2 (en) * 2003-03-18 2007-10-16 Advandx, Inc. Method for improved specificity in probe based assays

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105646662A (zh) * 2014-03-24 2016-06-08 朱育盼 特异性结合前列腺癌的短肽pcp9及其应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999006576A1 (fr) * 1997-08-04 1999-02-11 Calydon, Inc. Sequence stimulatrice de la kallicreine glandulaire chez l'homme, vecteurs comprenant cette sequence et procedes d'utilisation de ces derniers

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999006576A1 (fr) * 1997-08-04 1999-02-11 Calydon, Inc. Sequence stimulatrice de la kallicreine glandulaire chez l'homme, vecteurs comprenant cette sequence et procedes d'utilisation de ces derniers

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7282331B2 (en) * 2003-03-18 2007-10-16 Advandx, Inc. Method for improved specificity in probe based assays

Also Published As

Publication number Publication date
CN1314364A (zh) 2001-09-26
AU4634601A (en) 2001-10-08

Similar Documents

Publication Publication Date Title
WO2001073062A1 (fr) Nouveau polypeptide, antigene prostatique specifique membranaire 18, et polynucleotide codant pour ce polypeptide
WO2001074879A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s3-12, et polynucleotide codant pour ce polypeptide
WO2001079490A1 (fr) Nouveau polypeptide, proteine antigene prostatique specifique membranaire 16, et polynucleotide codant pour ce polypeptide
WO2001072815A1 (fr) Nouveau polypeptide, ferredoxine humaine 12, et polynucleotide codant pour ce polypeptide
WO2001085752A1 (fr) Polynucleotide codant un peptide de myosine
WO2001094593A1 (fr) Nouveau polypeptide, glycero-3-phosphate deshydrogenase humaine 11, et polynucleotide codant ce polypeptide
WO2002040532A1 (fr) Nouveau polypeptide, antigene prostatique specifique membranaire 9, et polynucleotide codant pour ce polypeptide
WO2001053492A1 (fr) Nouveau polypeptide, s-adenosylmethionine synthetase 31, et polynucleotide codant pour ce polypeptide
WO2001046430A1 (fr) Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide
WO2001094371A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001055195A1 (fr) Nouveau polypeptide, proteine de type an1 humaine, et polynucleotide codant pour ce polypeptide
WO2001090376A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide
WO2001072799A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 9, et polynucleotide codant pour ce polypeptide
WO2001070796A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 78, et polynucleotide codant pour ce polypeptide
WO2001055399A1 (fr) Nouveau polypeptide, dipeptide aminopeptidase humaine 28, et polynucleotide codant pour ce polypeptide
WO2001074870A1 (fr) Nouveau polypeptide, alpha-galactosidase humaine a-11, et polynucleotide codant pour ce polypeptide
WO2001070783A1 (fr) Nouveau polypeptide, proteine humaine gamma-cop 16, et polynucleotide codant pour ce polypeptide
WO2001081572A1 (fr) Nouveau polypeptide, antigene humain rage4 25 du cancer du rein, et polynucleotide codant pour ce polypeptide
WO2001075005A2 (fr) Nouveau polypeptide, sous-unite c de l'atpase pompe a protons vacuolaire (v-atpase) 12, et polynucleotide codant pour ce polypeptide
WO2001075030A2 (fr) Nouveau polypeptide, tyrosinase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001075007A2 (fr) Nouveau polypeptide, tyrosinase 15, et polynucléotide codant pour ce polypeptide
WO2001087941A1 (fr) Nouveau polypeptide, proteine kingle humaine 15, et polynucleotide codant pour ce polypeptide
WO2001070779A1 (fr) Nouveau polypeptide, proteine humaine 12 de type cdc4, et polynucleotide codant pour ce polypeptide
WO2001083676A2 (fr) Nouveau polypeptide, phosphatase humaine 10 fortement striee, et polynucleotide codant pour ce polypeptide
WO2001081392A1 (fr) Nouveau polypeptide, phosphoproteine nucleolaire humaine 13, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP