WO2001083676A2 - Nouveau polypeptide, phosphatase humaine 10 fortement striee, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, phosphatase humaine 10 fortement striee, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001083676A2
WO2001083676A2 PCT/CN2001/000624 CN0100624W WO0183676A2 WO 2001083676 A2 WO2001083676 A2 WO 2001083676A2 CN 0100624 W CN0100624 W CN 0100624W WO 0183676 A2 WO0183676 A2 WO 0183676A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
phosphatase
rich
human
Prior art date
Application number
PCT/CN2001/000624
Other languages
English (en)
Chinese (zh)
Other versions
WO2001083676A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU77437/01A priority Critical patent/AU7743701A/en
Publication of WO2001083676A2 publication Critical patent/WO2001083676A2/fr
Publication of WO2001083676A3 publication Critical patent/WO2001083676A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide ⁇ ⁇ rich in striated structure phosphatase 10, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides.
  • the phosphorylation of protein tyrosine residues is an important regulatory mechanism for controlling various signal transduction processes such as cell growth, differentiation and development in vivo. People have long been studying tyrosine kinases and protein tyrosine phosphorylases, but there have been more studies on tyrosine kinases, and in recent years, research on protein tyrosine phosphorylases has begun to pay more attention. Protein tyrosine phosphorylase works synergistically with tyrosine kinase in the body and plays an important regulatory role in maintaining normal physiological characteristics of cells.
  • protein tyrosine phosphorylase Many different sources have been cloned from many different organisms.
  • the first protein tyrosine phosphorylase was isolated from the human placenta; in 1990, the cDNA sequence of the enzyme was isolated; subsequently, people began to study the phosphorylase.
  • different members of the enzyme family were cloned from various eukaryotic cells, from yeast to humans. The protein sequences of all these enzymes have high similarity, and the protein sequences contain one or more protein tyrosine phosphorylase domains.
  • a protein tyrosine phosphorylase was cloned from human fetal brain tissue.
  • the protein sequence of the enzyme is also rich in protein structure.
  • the protein has high homology with the striated structure-rich protein tyrosine phosphorylase, both of which are striated structure-rich protein tyrosine phosphorylase.
  • members of the phosphorylase protein family are highly expressed in T cells of organisms, which regulate the activity of T cells in different organisms and are closely related to the occurrence of some disorders of the immune system [Tomas Mus tel in, Johannes Brockdorff et a l., 1999, Cel l Signal l, 11: 637-650].
  • the C-terminus of the protein sequence of all members of the protein tyrosine phosphorylase family contains a phosphorylase catalytic domain, which consists of one or more highly conserved characteristic sequence fragments as shown below: [I / V] HCXAGXXR [S / T] GX [F / Y]; Among them, the cysteine residues in the sequence fragments play an extremely important regulatory role in the formation of the enzyme active configuration and the catalytic activity. Its mutation will lead to inactivation and dysfunction of the enzyme, which will cause various diseases related to it.
  • the N-terminus of the protein family member protein sequence also contains two proline-rich regions, which are located at the junction of the protein and the substrate. It plays an important regulatory role in the process of cooperation.
  • the protein tyrosine phosphorylase has a higher conservation in evolution.
  • Members of this protein family all play an important regulatory role in the regulation of various lymphocyte activities in the organism, and their mutations or abnormal expression will usually lead to abnormal function of the immune system in the body, and then cause various related disorders.
  • the protein is usually closely related to the occurrence of various immune disorders, malignant lymphatic system diseases, leukemia, various immunodeficiency diseases and related tissue malignant tumors and cancers in vivo. It can also be used to diagnose and treat various related diseases mentioned above.
  • the human striatum-rich phosphatase 10 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, it has been necessary to identify Many people involved in these processes are rich in striated structure phosphatase 10 protein, especially the amino acid sequence of this protein is identified. Isolation of the newly-enriched striatal phosphatase 10 protein-encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human striatum-rich phosphatase 10.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human striatum-rich phosphatase 10.
  • Another object of the present invention is to provide a method for producing human striatum-rich phosphatase 10. Another object of the present invention is to provide a human-striated-rich phosphate directed against the polypeptide of the present invention. Antibody to enzyme 10.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of phosphatase 10 rich in striated structure against a polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities in human striatal-rich phosphatase 10. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 870-1142 in SEQ ID NO: 1; and (b) a sequence having 1-2209 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human striatum-rich phosphatase 10 protein activity, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of a human striated-rich phosphatase 10 protein in vitro, which comprises detecting a mutation in the polypeptide or a coding polynucleotide sequence thereof in a biological sample. Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of immunological diseases, developmental disorders, inflammation, various tumors, blood diseases, HIV infection or other phosphatase due to human being rich in striated structure. 10 Use of a medicament for a disease caused by abnormal expression. Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1 is a comparison diagram of gene chip expression profiles of the striatum-rich phosphatase 10 and human striatum-rich phosphatase.
  • the upper graph is a graph of human striatum-rich phosphatase 10 expression profile
  • the lower graph is the human striatum-rich phosphatase expression profile.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates non-starved L02
  • 8 indicates L02 +, lhr, As 3+
  • 9 indicates ECV304 PMA-
  • 10 means ECV304 PMA +
  • 11 means fetal liver
  • 12 means normal liver
  • 13 means thyroid
  • 14 means skin
  • 15 means fetal lung
  • 16 means lung
  • 17 means lung cancer
  • 18 means fetal spleen
  • 19 means spleen
  • 20 Indicates prostate
  • 21 indicates fetal heart
  • 22 indicates heart
  • 23 indicates muscle
  • 24 indicates testis
  • 25 indicates fetal thymus
  • 26 indicates thymus.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human striatal-rich phosphatase 10.
  • OKDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • “Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human striatal-rich phosphatase 10, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human striatum-rich phosphatase 10.
  • Antagonist refers to a biological or immunological activity that can block or regulate human striatum-rich phosphatase 10 when combined with human striatum-rich phosphatase 10.
  • Molecule Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds to human striatal-rich phosphatase 10.
  • Regular refers to a change in the function of human striatal-rich phosphatase 10, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties of human striatal-rich phosphatase 10. , Functional or immune properties.
  • substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can use standard protein purification techniques to purify human striatum-rich phosphatases
  • the substantially pure human striatum-rich phosphatase 10 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human striatum-rich phosphatase 10 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity means the sequence is the same in two or more amino acid or nucleic acid sequence comparisons Similar percentages.
  • the percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.).
  • the MEGAUGN program can compare two or more sequences based on different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0
  • the Clus ter method groups groups by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences, such as sequence A and sequence B is calculated by
  • the number of residues in the sequence-the number of spacer residues in the sequence-the number of spacer residues X in the sequence_ ⁇ can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J ., (1990) Methods in enzymology 183: 625-645) 0 ( "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions can include aspartic acid and glutamic acid; positively charged amino acids can include lysine and arginine; similarly hydrophilic groups with uncharged head groups Amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (') 2 and? It can specifically bind to the epitope of human striatal-rich phosphatase 10.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human striatum-rich phosphatase 10 means that human striatum-rich phosphatase 10 is substantially free of other proteins, lipids, sugars, or other substances naturally associated with it. Those skilled in the art can use standard protein purification techniques to purify human striatal-rich phosphatase
  • Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human striatum-rich phosphatase 10 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide-human striatum-rich phosphatase 10, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
  • the invention also includes fragments, derivatives, and analogs of human striatal-rich phosphatase 10.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human striatum-rich phosphatase 10 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a type in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a type in which the additional amino acid sequence is fused into the mature polypeptide and the polypeptide sequence is formed ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
  • such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2209 bases in length and its open reading frame 870-1142 encodes 90 amino acids. Based acid. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with human striatum-rich phosphatase. It can be inferred that the human striatum-rich phosphatase 10 has human striatum-rich phosphatase. Similar functionality.
  • the polynucleotide of the present invention may be in the D form or the RNA form.
  • Form D includes cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add a denaturant during hybridization, such as 50.
  • polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleosides encoding human striatum-rich phosphatase 10
  • the polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • polynucleotide sequence encoding the human striatal-rich phosphatase 10 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic MA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDM of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) the determination of human striatum-rich phosphatase 10 transcripts Level; (4) detecting protein products of gene expression by immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by human striatal-rich phosphatase 10 gene expression protein. .
  • a method for amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention. Especially difficult to get from the library.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR may be appropriately selected according to the polynucleotide sequence information of the present invention disclosed herein, and conventional methods may be used. synthesis.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human striatum-rich phosphatase 10 coding sequence, and recombinant technology to produce the present invention. Said method of polypeptide.
  • a polynucleotide sequence encoding human striatum-rich phosphatase 10 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human striatum-rich phosphatase 10 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 To 300 base pairs, acting on a promoter to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human striatum-rich phosphatase 10 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetic engineering containing the polynucleotide or the recombinant vector.
  • Host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human striatum-rich phosphatase 10 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, or expressed on a cell membrane, or secreted Out of the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • the phosphorylation of protein tyrosine residues is an important regulatory mechanism for controlling various signal transduction processes such as cell growth, differentiation and development in vivo.
  • Protein tyrosine phosphatase cooperates with protein tyrosine kinase to regulate tyrosine phosphorylation to control cell activity and proliferation.
  • Protein tyrosine phosphorylation is a major mechanism of cell signal transduction.
  • the striated structure-rich protein tyrosine phosphorylase is highly expressed in T cells of the body, which regulates the activity of T cells in different organisms and is closely related to the occurrence of some disorders of the immune system.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human striatum-rich phosphatase, both of which have similar biological functions. It is involved in cell signal modification and transmission in the body, and it is very important for various functions of the immune system. Abnormal expression will cause a variety of abnormalities such as immune dysfunction, developmental disorders, and tumorigenesis.
  • the abnormal expression of the striatum-rich phosphatase 10 of the present invention will produce various diseases, especially immune diseases, various tumors, development disorders, and inflammations. These diseases include, but are not limited to:
  • Immune diseases rheumatoid arthritis, chronic active hepatitis, post-infection myocarditis, systemic lupus erythematosus, scleroderma, myasthenia gravis, Guillain-Barre syndrome, autoimmune hemolytic anemia, common Variable immunodeficiency disease, primary B lymphocyte immunodeficiency disease, primary T lymphocyte immunodeficiency disease, severe combined immunodeficiency disease Wi skot t-Aldr ich syndrome, with ataxia capillaries, primary Phagocytic immunodeficiency, primary complement system deficiency, acquired immunodeficiency syndrome, bronchial asthma, aspirin asthma, allergic rhinitis, diffuse interstitial fibrosis, urticaria, specific dermatitis
  • Tumors of various tissues liver cancer, stomach cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neurofibromatosis, colon cancer, melanoma, bladder cancer, child cancer, intra-office Membrane cancer
  • developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, Neural tube defects, congenital hydrocephalus, congenital glaucoma or cataracts, congenital deafness, mental retardation, brain development disorders, skin, fat and muscle dysplasia, bone and joint dysplasia, various metabolic defects Disease, stunting, dwarfism, Cushing's syndrome, sexual retardation, diabetes
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • the abnormal expression of the striatum-rich phosphatase 10 of the present invention will also produce certain hereditary, hematological diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially immune diseases, various tumors, development disorders, inflammation, and some hereditary , Blood diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human striatum-rich phosphatase 10.
  • Agonists enhance human striatal-rich phosphatase 10 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing a human striatum-rich phosphatase 10 and a labeled human striatum-rich phosphatase 10 can be cultured in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human striatal-rich phosphatase 10 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human striatal-rich phosphatase 10 can bind to human striatal-rich phosphatase 10 and eliminate their functions, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide Disabling the polypeptide from performing a biological function.
  • human striatal-rich phosphatase 10 When screening compounds as antagonists, human striatal-rich phosphatase 10 can be added to the bioanalytical assay, and the interaction between human striatal-rich phosphatase 10 and its receptor can be determined by determining the compound Influence to determine if a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Peptide molecules capable of binding to human striatal-rich phosphatase 10 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human striatal-rich phosphatase 10 molecules should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human striatal-rich phosphatase 10 epitopes. These antibodies include (but are not limited to In): Polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human striatal-rich phosphatase 10 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant, etc.
  • Techniques for preparing human striatum-rich phosphatase 10 monoclonal antibodies include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cells Hybridoma technology, EBV-hybridoma technology, etc.
  • Inlay antibodies combining human constant regions and non-human variable regions can be produced using existing technologies (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies (U. S. Pat No. 4946778) can also be used to produce single-chain antibodies against human striatum-rich phosphatase 10.
  • Antibodies against human striatal-rich phosphatase 10 can be used in immunohistochemical techniques to detect human striatal-rich phosphatase 10 in biopsy specimens.
  • Monoclonal antibodies that bind to human striatal-rich phosphatase 10 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human striatum-rich phosphatase 10 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human striatal-rich phosphatase 10 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human striatal-rich phosphatase 10.
  • Administration of appropriate doses of antibodies can stimulate or block the production or activity of human striatal-rich phosphatase 10.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human striatal-rich phosphatase 10 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human striatal-rich phosphatase 10 detected in the test can be used to explain the importance of human striatal-rich phosphatase 10 in various diseases and to diagnose human striatal-rich Diseases where phosphatase 10 works.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human striatal-rich phosphatase 10 are also useful for a variety of therapeutic purposes.
  • Base The therapeutic technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human striatum-rich phosphatase 10.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human striatum-rich phosphatase 10 to inhibit endogenous human striatum-rich phosphatase 10 activity.
  • a variant human striatum-rich phosphatase 10 may be a shortened human striatum-rich phosphatase 10 that lacks a signaling functional domain.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of striatum-rich phosphatase 10 in humans.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer a polynucleotide encoding human striatum-rich phosphatase 10 into a cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding human striatum-rich phosphatase 10 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human striatum-rich phosphatase 10 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human striatum-rich phosphatase 10 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • Polynucleotides encoding human striatum-rich phosphatase 10 are useful in the diagnosis of diseases related to human striatum-rich phosphatase 10.
  • Polynucleotides encoding human striatum-rich phosphatase 10 can be used to detect the expression of human striatum-rich phosphatase 10 or abnormality of human striatum-rich phosphatase 10 in disease states expression.
  • the D sequence encoding human striatum-rich phosphatase 10 can be used to hybridize biopsy specimens to determine the expression status of human striatum-rich phosphatase 10.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization.
  • RNA-polymerase chain reaction in vitro amplification of human striatum-rich phosphatase 10 specific primers can also detect human striatum-rich phosphatase 10 transcription products.
  • Detection of mutations in the striatum-rich phosphatase 10 gene can also be used to diagnose human striatum-rich phosphatase 10-related diseases.
  • Human striatum-rich phosphatase 10 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human striatum-rich phosphatase 10 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequence can be mapped on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals, and the mutation is not observed in any normal individual, The mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Ability and dance ( 20 kb corresponds to one gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human striatum-rich phosphatase 10 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of striatum-rich phosphatase 10 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragments into the multicloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ . The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 W Automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0543b02 was a new D.
  • a series of primers were synthesized to perform bidirectional determination of the inserted CDM fragments of the clone.
  • Example 2 Cloning of a gene encoding human striatum-rich phosphatase 10 gene by RT-PCR method Using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction synthesis of cDM, using Qiagene's kit After purification, PCR amplification was performed with the following primers:
  • Primer 1 5'- GATTCATGGTTCATTTAAGTAAAG -3, (SEQ ID NO: 3)
  • Primer 2 5'- TGTCTCATTTTTTAAAGGTTATGG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer 2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 mmol / L of KC1, 10 mraol / L Tris-HCl, pH 8.5, 1.5 mraol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as positive control and template blank as negative control at the same time.
  • RNA precipitate 4M guanidinium isothiocyanate-25 mM sodium citrate, 0.2 M sodium acetate (pH 4.0.) Homogenize the tissue and add 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (4 9: 1), mixed and centrifuged. Aspirate the aqueous layer, add isopropyl alcohol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. Wash the obtained RNA precipitate with 70% ethanol, dry and dissolve in water. Use 20 g of RNA was electrophoresed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (PH7.
  • Example 4 In vitro expression, isolation, and purification of recombinant human striatum-rich phosphatase 10 In accordance with the sequence of the coding region shown in SEQ ID NO: 1 and FIG. 1, a pair of specific amplification primers were designed. The sequences are as follows:
  • Pr imer 3 5'- CCCCATATGATGCCCTTAGAATTTCACTGCATT -3, (Seq ID No: 5)
  • Primer4 5'- CATGGATCCCTACAAGGTGTGCCAAACAGCAGG -3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively. Points, followed by the coding sequences of the 5 ,, and 3 'ends of the gene of interest, respectively.
  • the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET- 2 8b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • the PCR reaction was performed using the pBS-0543b02 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of pBS-0543b02 plasmid in a total volume of 50 ⁇ 1, Primer-3 and Primer-4 primers were 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • Ligation products were transformed by the calcium chloride method Escherichia bacteria DH5 a, the (final concentration of 30 ⁇ 8 / ⁇ 1) LB plates incubated overnight positive clones by colony PCR method containing kanamycin, and sequenced.
  • a positive clone (pET-0543b02) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BLn (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host bacteria BM1 (pET-0543b02) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L, and continued Incubate for 5 hours.
  • the cells were collected by centrifugation, and the supernatant was collected by centrifugation.
  • the supernatant was collected by centrifugation.
  • the chromatography was performed using an affinity chromatography column His s. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag).
  • the purified target protein human is rich in striated structure phosphatase 10.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human striated-rich phosphatase 10-specific peptides: NH2-Met-Pro-Leu-Glu-Phe-His-Cys-I le-Cys-Ser-Met-Arg-Asn-Trp-Phe- C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragment selected from the polynucleotide SEQ ID NO: 1 of the present invention for use as a hybridization probe shall be Following the following principles and several aspects to consider:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genome sequences and their complement The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (fiber):
  • Probe 2 which belongs to the second type of probe, is equivalent to the gene mutation of SEQ ID NO: 1 or the replacement mutation sequence of its complementary fragment (41Nt ):
  • PBS phosphate buffered saline
  • DNA phenol extraction method Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000 g for 10 minutes. 2) Resuspend the pelleted cells (1 ⁇ 10 8 cells / ml) with cold cell lysate and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 7 cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or at 37 ° C. C gently shake overnight.
  • NC membrane nitrocellulose membrane
  • the sample membrane was placed in a plastic bag and 3-10 mg of prehybridization solution (i0xDenhardt s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After closing the bag, 68. C water bath for 2 hours.
  • prehybridization solution i0xDenhardt s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target D for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific methods and steps have been reported in the literature. For example, see DeRis i, L L., Lyer, V. & Brown, P. 0.
  • a total of 4,000 polynucleotide sequences of various full-length cDMs were used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification.
  • the spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m.
  • the spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the DNA was fixed on the glass slide to prepare a chip.
  • the specific method steps have been reported in the literature.
  • the sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5--triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRNA of human mixed tissue
  • the fluorescent reagent Cy5dUTP (5-Amino- Propargyl-2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification.
  • Cy3dUTP 5-Amino-propargyl-2'-deoxyuridine 5--triphate coupled to Cy3 f luorescent dye, purchased from Amersham P
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC> 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une phosphatase humaine 10 fortement striée, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des maladies immunitaires, des troubles du développement, des inflammations, de toutes sortes de tumeurs, de l'hémopathie et de l'infection par VIH. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la phosphatase humaine 10 fortement striée.
PCT/CN2001/000624 2000-04-29 2001-04-28 Nouveau polypeptide, phosphatase humaine 10 fortement striee, et polynucleotide codant pour ce polypeptide WO2001083676A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU77437/01A AU7743701A (en) 2000-04-29 2001-04-28 A novel polypeptide, heavily striated human phosphatase 10 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115537.7 2000-04-29
CN 00115537 CN1321762A (zh) 2000-04-29 2000-04-29 一种新的多肽——人富含纹状结构的磷酸酶10和编码这种多肽的多核苷酸

Publications (2)

Publication Number Publication Date
WO2001083676A2 true WO2001083676A2 (fr) 2001-11-08
WO2001083676A3 WO2001083676A3 (fr) 2002-02-28

Family

ID=4584983

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000624 WO2001083676A2 (fr) 2000-04-29 2001-04-28 Nouveau polypeptide, phosphatase humaine 10 fortement striee, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1321762A (fr)
AU (1) AU7743701A (fr)
WO (1) WO2001083676A2 (fr)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [Online] 04 February 2000 WATERSTON R. Retrieved from NCBI, accession no. GI:2804346 Database accession no. AC004029.1 *
DATABASE GENBANK [Online] 21 December 1999 SULSTON J.E. AND WATERSTON R. Retrieved from NCBI, accession no. GI:5701619 Database accession no. AC006459.2 *

Also Published As

Publication number Publication date
CN1321762A (zh) 2001-11-14
AU7743701A (en) 2001-11-12
WO2001083676A3 (fr) 2002-02-28

Similar Documents

Publication Publication Date Title
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001083743A1 (fr) Polypeptide sous-unite 11 d'adducine alpha de globule rouge humain et polynucleotide codant pour ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001096560A1 (fr) Nouveau polypeptide, proteine humaine stat2, et polynucleotide codant ce polypeptide
WO2001083676A2 (fr) Nouveau polypeptide, phosphatase humaine 10 fortement striee, et polynucleotide codant pour ce polypeptide
WO2001088158A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001090376A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide
WO2001081382A1 (fr) Nouveau polypeptide, proteine hs1 humaine 16, et polynucleotide codant pour ce polypeptide
WO2001049732A1 (fr) Nouveau polypeptide, transglutaminase 10, et polynucleotide codant pour ce polypeptide
WO2001074894A1 (fr) Nouveau polypeptide, proteine humaine de regulation 12 de la proteine phosphorylase, et polynucleotide codant pour ce polypeptide
WO2001073061A1 (fr) Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide
WO2001092540A1 (fr) Nouveau polypeptide, facteur humain stat2 11, et polynucleotide codant ce polypeptide
WO2001075059A2 (fr) Nouveau polypeptide, proteine humaine 11 de regulation de gtp, et polynucleotide codant pour ce polypeptide
WO2001074892A1 (fr) Nouveau polypeptide, proteine antigene prostatique specifique membranaire 12, et polynucleotide codant pour ce polypeptide
WO2001083542A1 (fr) Nouveau polypeptide, proteine humaine p18 21, et polynucleotide codant pour ce polypeptide
WO2001073008A1 (fr) Nouveau polypeptide, nucleoproteine humaine 13 associee aux tumeurs, et polynucleotide codant pour ce polypeptide
WO2001064730A1 (fr) Nouveau polypeptide, 5-phosphatase humaine 18, et polynucleotide codant pour ce polypeptide
WO2001090377A1 (fr) Nouveau polypeptide, facteur humain 14 d'inhibition de la croissance tumorale von hippel-lindau, et polynucleotide codant ce polypeptide
WO2001070983A1 (fr) Nouveau polypeptide, proteine antigene prostatique specifique membranaire 9, et polynucleotide codant pour ce polypeptide
WO2001073041A1 (fr) Nouveau polypeptide, adn ligase humaine 15, et polynucleotide codant pour ce polypeptide
WO2001071001A1 (fr) Nouveau polypeptide, tyrosinase humaine 15, et polynucleotide codant pour ce polypeptide
WO2001048160A1 (fr) Nouveau polypeptide, proteine tyrosine phosphatase 12, et polynucleotide codant pour ce polypeptide
WO2001070794A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 11, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP