WO2001090348A1 - Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001090348A1
WO2001090348A1 PCT/CN2001/000625 CN0100625W WO0190348A1 WO 2001090348 A1 WO2001090348 A1 WO 2001090348A1 CN 0100625 W CN0100625 W CN 0100625W WO 0190348 A1 WO0190348 A1 WO 0190348A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
heavy chain
myosin heavy
human myosin
Prior art date
Application number
PCT/CN2001/000625
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU67277/01A priority Critical patent/AU6727701A/en
Publication of WO2001090348A1 publication Critical patent/WO2001090348A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/795Porphyrin- or corrin-ring-containing peptides
    • C07K14/805Haemoglobins; Myoglobins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human myosin heavy chain 11, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • Cytoskeleton protein acts as a contractile protein in the cell and promotes the mutual movement of cells.
  • the energy required for cell movement is provided by ATP.
  • actin and myosin There are two major contractile proteins in all animal cells: actin and myosin. Actin usually exists in the cell in a multimeric and lysed state. It interacts with myosin, and through the synergistic effect of intermediate mediators, it promotes the movement between cells in the body and the completion of the cell cycle nuclear division process.
  • Myosin is composed of a heavy chain molecule and a light chain molecule, wherein the light chain is connected with the spherical domain of the N-terminus of the myosin heavy chain to form a complete myosin molecule.
  • the spherical structure domain also contains an ATP binding site and an actin binding site. These two binding sites are important centers of interaction between myosin and actin and regulating cell movement.
  • the C-terminal domain of the myosin heavy chain mainly forms a cx helix structure, and this domain interacts with the helix structure of the second myosin heavy chain monomer to form a complete myosin molecule.
  • actin heavy chain molecules are expressed in all tissues of animals, and they play an important regulatory role in the process of egg development and cell differentiation in the organism, regulating some of the important physiological responses in the body.
  • the protein molecule responds correctly to changes in the content of calcium ions and other substances in the surrounding environment to regulate the normal progress of related metabolic and developmental processes.
  • the mutation or abnormal expression will directly affect the completion of some related biological functions in the organism, and then cause various related diseases.
  • myosin heavy chain 12 proteins People have cloned a variety of myosin heavy chain 12 proteins from different biological sources. In 1995, Steinacker et al. Cloned a myosin heavy chain 12 protein from humans and found the amino group of the protein. The sequence has 95.8% homology with the known amino acid sequence of the mouse myosin heavy chain 12. From this, it can be known that the myosin heavy chain protein may be highly conservative in evolution. It was found that the protein is expressed in various tissues of the human body, and it plays an important role in regulating egg development and cell differentiation in organisms. The mutation or abnormal expression of this protein will usually cause the abnormality of cell cycle process in vivo, and then affect the progress of a series of related metabolic processes.
  • the protein is usually associated with The occurrence of some related disorders of embryonic developmental disorders, hereditary diseases, immune system diseases, and tumors and cancers of related tissues are closely related. It can also be used for the diagnosis and treatment of various related diseases mentioned above [Ste inacker JM, Opitz-Gres s A. et al., 1995, Cytogenet Ce ll Genet, 69: 53-58].
  • the human myosin heavy chain 11 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there is a need in the art to identify more involved in these The process of human myosin heavy chain 11 protein, especially the amino acid sequence of this protein was identified.
  • the isolation of the novel human myosin heavy chain 11 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so isolating its coding DNA is important.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human myosin heavy chain ⁇ .
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human myosin heavy chain 11.
  • Another object of the present invention is to provide a method for producing human myosin heavy chain 11.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human myosin heavy chain 11.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human myosin heavy chain 11.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of human myosin heavy chain 11. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 38-337 in SEQ ID NO: 1; and (b) a sequence having 1-1338 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human myosin heavy chain 11 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human myosin heavy chain 11 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of embryonic developmental disorders, growth disorders, infertility, neurological diseases, tumors of the reproductive system, inflammation, immune diseases or other causes Use of a medicament for diseases caused by abnormal expression of human myosin heavy chain 11.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human myosin heavy chain 11 and human myosin heavy chain of the present invention.
  • the upper graph is a graph of the expression profile of the human myosin heavy chain 11 and the lower graph is the graph of the expression profile of the human myosin heavy chain.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates non-starved L02
  • 8 indicates L02 +, l hr, As 3+
  • 9 ECV304 PMA-, 10 ECV304 PMA +, 1 1 fetal liver, 12 normal liver, 13 3 thyroid, 14 skin, 15 fetal lung, 16 lung, 17 lung cancer, 18 fetal spleen, 19
  • 20 indicates the prostate
  • 21 indicates the fetal heart
  • 22 indicates the heart
  • 23 indicates muscle
  • 24 indicates testes
  • 25 indicates fetal thymus
  • 26 indicates thymus.
  • FIG. 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human myosin heavy chain 11.
  • lKDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bio activity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when bound to human myosin heavy chain 11, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human myosin heavy chain 11.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human myosin heavy chain 11 when combined with human myosin heavy chain 11.
  • Antagonists and inhibitors may include proteins, nucleic acids, 'carbohydrates, or any other molecules that can bind human myosin heavy chain 11.
  • Regular refers to a change in the function of human myosin heavy chain 11, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human myosin heavy chain 11. change.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human myosin heavy chain 11 using standard protein purification techniques.
  • the substantially pure human myosin heavy chain 11 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human myosin heavy chain 11 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues that match between sequences
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun He in (He in J., (1990) Me thods in enzymology 183: 625-645). 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the epitope of human myosin heavy chain 11.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human myosin heavy chain 11 means that human myosin heavy chain 11 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human myosin heavy chain 11 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Purity of human myosin heavy chain 11 peptide Analysis of amino acid sequences.
  • the present invention provides a new polypeptide, human myosin heavy chain 11, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human myosin heavy chain 11.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human myosin heavy chain 11 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a type, in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1338 bases, and its open reading frames 38-337 encode 99 amino acids.
  • this polypeptide has a similar expression profile to human myosin heavy chain, and it can be deduced that the human myosin heavy chain 11 has a similar function to human myosin heavy chain.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; The coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence (and optional additional coding sequences) of the mature polypeptide and non-coding sequences.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 'C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human myosin heavy chain 11.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human myosin heavy chain 11 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the D fragment sequence of the present invention can also be obtained by the following methods: 1) separating a double-stranded DNA sequence from genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate the mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid Or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RM hybridization; (2) the presence or absence of a marker gene function; (3) measuring the level of human myosin heavy chain 11 transcripts; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • the D probe can be labeled with a radioisotope, luciferin, or an enzyme (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human myosin heavy chain 11 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various D fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human myosin heavy chain 11 coding sequence, and a recombinant technology for producing the polypeptide of the present invention method.
  • a polynucleotide sequence encoding the human myosin heavy chain 11 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacteria well known in the art Plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, eta l.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing DM sequences encoding human myosin heavy chain 11 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, synthesizing technology, and in vivo recombination technology (Sambroook, et al. Moleculolar Cloning, a Labora tory Manua, Cold Harbor Labora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mR synthesis. Representative examples of these promoters are: l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human myosin heavy chain 11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells Cells if fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing D can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human myosin heavy chain l l (Sc ience, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Cytoskeleton protein acts as a contractile protein in the cell and promotes mutual movement between cells, and the energy required for cell movement is provided by ATP.
  • actin There are two major contractile proteins in all animal cells: actin and myosin. Actin usually exists in cells in a multimeric and lysed state. It interacts with myosin and through the synergistic action of intermediate mediators, it promotes the movement between cells in the body and the completion of the cell cycle nuclear division process.
  • Myosin is composed of a heavy chain molecule and a light chain molecule. Studies have found that actin heavy chain molecules are expressed in various tissues.
  • myosin heavy chain 12 proteins play an important regulatory role in egg development and cell differentiation, and regulate some important organisms. Physiological response. The protein molecule responds correctly to changes in the content of calcium ions and other substances in the surrounding environment to regulate the normal progress of related metabolic and developmental processes. Its mutation or abnormal expression will directly affect the completion of some related biological functions in the organism, and then cause various related diseases.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human myosin heavy chain 12 protein, and both have similar biological functions. It is a very important protein in the body and is involved in the formation of the cytoskeleton during cell development. It plays an extremely important role in embryonic tissues and germ cells. Its abnormal expression is usually closely related to the development of embryonic disorders, growth disorders, infertility, and reproductive system tumors such as ovarian cancer.
  • human myosin heavy chain 11 of the present invention will produce various diseases, especially embryonic developmental disorders, growth disorders, infertility, neurological diseases, reproductive system tumors, inflammation, and immunity Sexually transmitted diseases, including but not limited to:
  • Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, ventricular septal defect, pulmonary stenosis, open ductus arteriosus, hyaline membrane disease, pulmonary insufficiency, polycystic kidney, cryptorchidism, Congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, iris defect, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, Sexual retardation
  • Neurological diseases neural tube defects, congenital hydrocephalus, epilepsy, glioma, meningiomas, neurofibromas, pituitary adenomas, intracranial granulomas
  • Reproductive system tumors ovarian cancer, testicular tumor, epididymal tumor, breast cancer, uterine cancer, endometrial cancer, uterine fibroids
  • Inflammation gastric ulcer, cervicitis, myocarditis, cardiomyopathy, atherosclerosis, chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, Various infectious inflammations
  • Immune diseases systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, Guillain-Barre syndrome, general variable immunodeficiency disease, primary B lymphocyte immunodeficiency disease, acquired immunodeficiency syndrome Disease
  • Abnormal expression of the human myosin heavy chain 11 of the present invention will also produce certain hereditary, bloody diseases Disease, etc.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially embryonic developmental disorders, growth disorders, infertility, and neurological diseases. , Tumors of the reproductive system, inflammation, immune diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human myosin heavy chain 11.
  • Agonists enhance human myosin heavy chain 11 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing human myosin heavy chain 11 can be cultured with labeled human myosin heavy chain 11 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human myosin heavy chain 11 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human myosin heavy chain 11 can bind to human myosin heavy chain 11 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
  • human myosin heavy chain 11 can be added to a bioanalytical assay to determine whether the compound is a compound by measuring the effect of the compound on the interaction between human myosin heavy chain 11 and its receptor. Antagonist. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human myosin heavy chain 11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 11 molecules of human myosin heavy chain should be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human myosin heavy chain 11 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human myosin heavy chain 11 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
  • Techniques for preparing monoclonal antibodies to human myosin heavy chain 11 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies can also be used to produce single chain antibodies against human myosin heavy chain 11.
  • Antibodies against human myosin heavy chain 11 can be used in immunohistochemical techniques to detect human myosin heavy chain 11 in biopsy specimens.
  • Monoclonal antibodies that bind to human myosin heavy chain 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • SPDP sulfhydryl crosslinker
  • This hybrid antibody can be used to kill human myosin heavy chain 11 positive cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human myosin heavy chain 11.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human myosin heavy chain 11.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human myosin heavy chain 11.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human myosin heavy chain 11 detected in the test can be used to explain the importance of human myosin heavy chain 11 in various diseases and to diagnose diseases in which human myosin heavy chain 11 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human myosin heavy chain 11 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human myosin heavy chain 11.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express the variant human myosin heavy chain 11 to inhibit endogenous human myosin heavy chain 11 activity.
  • a variant human myosin heavy chain 11 may be a shortened human myosin heavy chain 11 lacking a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human myosin heavy chain 11.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human myosin heavy chain 11 into a cell.
  • Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human myosin heavy chain 11 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human myosin heavy chain 11 can be packaged into liposomes and transferred into cells.
  • Methods for introducing polynucleotides into tissues or cells include: Injecting polynucleotides directly into tissues in vivo Or in vitro through a vector (such as a virus, phage, or plasmid) to introduce the polynucleotide into the cell, and then transplant the cell into the body.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human myosin heavy chain 11 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like R molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target R to perform endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense R molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human myosin heavy chain 11 can be used for the diagnosis of diseases related to human myosin heavy chain 1 1.
  • the polynucleotide encoding human myosin heavy chain 11 can be used to detect the expression of human myosin heavy chain 11 or the abnormal expression of human myosin heavy chain 11 in a disease state.
  • the DNA sequence encoding human myosin heavy chain 11 can be used to hybridize biopsy specimens to determine the expression of human myosin heavy chain 11.
  • Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on micro arrays or DNA chips (also known as “gene chips") for analyzing differential expression analysis of genes in tissues and genetic diagnosis.
  • Human myosin heavy chain 11 specific primers can also be used to detect the transcription products of human myosin heavy chain 11 by performing R-polymerase chain reaction (RT-PCR) in vitro amplification.
  • RT-PCR R-polymerase chain reaction
  • Detection of mutations in the human myosin heavy chain 11 gene can also be used to diagnose human myosin heavy chain 11-related diseases.
  • the forms of human myosin heavy chain 11 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human myosin heavy chain 11 DNA sequence. Mutations can be detected using existing techniques such as Sou thern blotting, D sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome. In short, PCR primers (preferably 15-35 bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR primers preferably 15-35 bp
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human myosin heavy chain 11 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dosage range of human myosin heavy chain 11 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Quik mRNA Isolat ion Kit product of Qiegene was used to isolate poly (A) m legs from total RNA. 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smar t cDNA cloning kit purchased from CI ont ech was used to insert the cDNA fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5 ct. The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0596g09 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the 0596 g 09 clone contained a full-length cDNA of 1338bp (as shown in Seq ID N0: l), and a 300bp open reading frame (0RF) from 38bp to 337bp, encoding a new protein (such as Seq ID NO: 2).
  • Example 2 Cloning of a gene encoding human myosin heavy chain 11 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imerl 5'- CAAGAAAGGGAGTTAGGGCTTAAA -3 '(SEQ ID NO: 3)
  • Pr imer2 5'- AACTGAGATTTTTACTGACATGCA -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l reaction volume contains 50 mmol / LKCl, 10 ⁇ l / LTris-HCl pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1/1 dNTP, lOpmol primer, 1U Taq DNA polymerase ( Clontech products). The reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min contemplatSet ⁇ -act in as a positive control and template blank as a negative control at the same time during RT-PCR.
  • Amplification products were purified using a QIAGEN kit, and connected to a PCR vector using a TA cloning kit (Invitrogen product)
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l-1338bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human myosin heavy chain 11 gene expression
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0, 8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
  • RNA containing 20mM 3- (N- morpholino) propanesulfonic acid (pH7.0) -5mM sodium acetate - electrophoresed on ImM EDTA-2.2M formaldehyde-1.2% agarose gel. It was then transferred to a nitrocellulose membrane.
  • A- 32 P dATP with DM probe prepared by random primer labeled SYSTEM. The DNA probe used was the PCR amplified human myosin heavy chain 11 coding region sequence (38bp to 337bp) shown in FIG. 1.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 x SSC-5 x Denhardt's solution and 20 g / ml salmon sperm DNA. After hybridization, the filter was washed in lx SSC-0.1 ° /. SDS at 55 ° C for 30 min. Then, Analysis and quantification were performed using Phosphor Imager.
  • Example 4 In vitro expression, isolation and purification of recombinant human myosin heavy chain 11
  • Primer3 5'- CCCCATATGATGTCCCAGATAGTTCCCATTCTA —3, (Seq ID No: 5)
  • Primer4 5'- CCCCATATGATGTCCCAGATAGTTCCCATTCTA -3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and EcoRI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and EcoRI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the PCR reaction was performed using pBS-0596g09 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0596g09 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage, respectively polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into the colibacillus DH5 ct by the calcium chloride method. After being cultured overnight on an LB plate containing kanamycin (final concentration 30 ⁇ 8 / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0596g09) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the following peptides specific for human myosin heavy chain 11 were synthesized using a peptide synthesizer (product of PE company): NH2-Me t-Ser-G ln-I l e-Va l-Pro-I 1 e-Leu- Leu -G 1 y-Asp-Leu-A 1 a-Phe- Pro- C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avrameas, et al. Immunochemis try, 1969; 6:43.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment: 5'- TGTCCCAGATAGTTCCCATTCTACTTGGAGATTTGGCTTTTTT -3 '(SEQ ID NO: 9)
  • probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment: 5'- TGTCCCAGATAGTTCCCATTCTACTTGGAGATTTGGCTTTTTT -3 '(SEQ ID NO: 9)
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml) was added.
  • CT DM calf thymus DNA
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target D for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And Helle, RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian, USA). The distance is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • Light test Cy3dUTP (5-Amino-propargyl-2 , -deoxyuridine 5'-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargy The 2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification.
  • Cy3dUTP (5-Amino-propargyl-2 , -deoxyuridine 5'-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham P
  • Probes from the above two tissues and chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • Scanner purchased from General Scanning, USA
  • the scanned images were processed with Imagene software (Biodiscovery, USA) for data analysis, and the Cy3 / Cy5 ratio of each point was calculated.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une chaîne lourde de myoglobuline humaine 11, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des troubles du développement de l'embryon, des troubles du développement et de la croissance, de la stérilité, des neuropathologies, des tumeurs du système reproductif, des inflammations et des maladies immunitaires. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la chaîne lourde de myoglobuline humaine 11.
PCT/CN2001/000625 2000-04-29 2001-04-28 Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide WO2001090348A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU67277/01A AU6727701A (en) 2000-04-29 2001-04-28 A novel polypeptide, a human myoglobulin heavy chain 11 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115538.5 2000-04-29
CN 00115538 CN1321666A (zh) 2000-04-29 2000-04-29 一种新的多肽——人肌球蛋白重链11和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001090348A1 true WO2001090348A1 (fr) 2001-11-29

Family

ID=4584984

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000625 WO2001090348A1 (fr) 2000-04-29 2001-04-28 Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1321666A (fr)
AU (1) AU6727701A (fr)
WO (1) WO2001090348A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6835332B2 (ja) * 2016-02-16 2021-02-24 公立大学法人横浜市立大学 動脈硬化を検出するための血中バイオマーカー

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 11 November 1999 (1999-11-11), NAGASE T. ET AL., Database accession no. AB033117 *
DATABASE GENBANK [online] 22 February 2000 (2000-02-22), ISOGAI T. ET AL., Database accession no. AK001195 *
DATABASE GENBANK [online] 27 April 1999 (1999-04-27), MOTTIER ET AL., Database accession no. AL031027 *
DATABASE GENBANK [online] 4 February 1999 (1999-02-04), MATOBA R., Database accession no. D17000 *

Also Published As

Publication number Publication date
AU6727701A (en) 2001-12-03
CN1321666A (zh) 2001-11-14

Similar Documents

Publication Publication Date Title
WO2001090348A1 (fr) Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide
WO2001083743A1 (fr) Polypeptide sous-unite 11 d'adducine alpha de globule rouge humain et polynucleotide codant pour ce polypeptide
WO2001094371A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001092515A1 (fr) Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2002012314A1 (fr) Nouveau polypeptide, proteine-1 humaine associee a la dihydropyrimidinase (drp-1) 9.68, et polynucleotide codant ce polypeptide
WO2001079434A2 (fr) Nouveau polypeptide, signal peptidase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001094539A2 (fr) Nouveau polypeptide, facteur humain d'inhibition 11 de type kazal, et polynucleotide codant ce polypeptide
WO2001075008A2 (fr) Nouveau polypeptide, protéine hélicase-anneau-hélicase 11, et polynucleotide codant pour ce polypeptide
WO2001087968A1 (fr) Proteine s4-36 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001081537A2 (fr) Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide
WO2001083678A2 (fr) Nouveau polypeptide, uridylate kinase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001073041A1 (fr) Nouveau polypeptide, adn ligase humaine 15, et polynucleotide codant pour ce polypeptide
WO2001077286A2 (fr) Nouveau polypeptide, globine humaine 58 de l'uterus, et un polynucleotide codant pour ce polypeptide
WO2001072800A1 (fr) Nouveau polypeptide, proteine humaine d'echange nucleotidique 13 contenant un domaine de liaison atp/gtp, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2001094534A2 (fr) Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide
WO2001075033A2 (fr) Veau polypeptide, proteine humaine 9 de regulation du cycle mi totique, et polynucleotide codant pour ce polypeptide
WO2001075020A2 (fr) Nouveau polypeptide, neuroproteine humaine y 11, et polynucleotide codant pour ce polypeptide
WO2001075059A2 (fr) Nouveau polypeptide, proteine humaine 11 de regulation de gtp, et polynucleotide codant pour ce polypeptide
WO2001087916A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s5-13, et polynucleotide codant pour ce polypeptide
WO2001074998A2 (fr) Nouveau polypeptide, proteine humaine de regulation 10 de la serine proteinase, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP