WO2001075020A2 - Nouveau polypeptide, neuroproteine humaine y 11, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, neuroproteine humaine y 11, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001075020A2
WO2001075020A2 PCT/CN2001/000358 CN0100358W WO0175020A2 WO 2001075020 A2 WO2001075020 A2 WO 2001075020A2 CN 0100358 W CN0100358 W CN 0100358W WO 0175020 A2 WO0175020 A2 WO 0175020A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
protein
polynucleotide
human neuropeptide
sequence
Prior art date
Application number
PCT/CN2001/000358
Other languages
English (en)
Chinese (zh)
Other versions
WO2001075020A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU50256/01A priority Critical patent/AU5025601A/en
Publication of WO2001075020A2 publication Critical patent/WO2001075020A2/fr
Publication of WO2001075020A3 publication Critical patent/WO2001075020A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human neuropeptide prion protein 11, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • Neuropeptide ⁇ is a kind of protein peptide with abundant and widely distributed in mammalian nervous system.
  • the protein peptide was first isolated from pig brain.
  • Porcine neuropeptide ⁇ has high homology with pancreatic polypeptide and polypeptide ⁇ which exist in endothelial cells.
  • the protein peptide is widely distributed in the neural tissue of the brain, and it may play an important role in neural signal transmission and regulation.
  • the protein polypeptide also has immune activity in some tissues related to the heart, coronary vessels, and myocardial fibers.
  • the protein polypeptide also has immunological activity in tumors related to the above tissues, such as pheoblastoma, and may play a very important regulatory role in the autoimmune process of organism-related diseases.
  • neuropeptide ⁇ plays an important regulatory role in the transmission of mammalian nervous system information and related tissue metabolism. Mutations or abnormal expression of this protein will lead to the abnormal function of the nervous system and the occurrence of malignant diseases in related tissues. [Carolyn D. Minth, Stephen R. Bloom et a l., 1984, Proc. Na t l. Acad. Sc i. USA, 81: 4577-4581] 0
  • Both protein sequences contain conserved sequence fragments: Hi s-Tyr-I le-Asn-Leu; and the nucleic acid sequences of both contained 86 to 174 bases of 5, and 3, non-coding regions. Its protein consists of a signal fragment of 28 amino acid residues, a central region of 36 amino acids, and a C-terminus of approximately 30 amino acid residues. It is also highly expressed in the cerebral nervous system, which may play an important role in the transmission and regulation of nervous system signals.
  • the neuropeptide Y is an important protein commonly existing in the mammalian nervous system.
  • the neuropeptide Y from different biological sources has a high similarity in protein sequences.
  • the segment and the central sequence fragment together constitute a complete protein with biological activity.
  • the protein is involved in regulating the transmission of various neural signals in various organisms. It also plays an immunological role in some heart tissue-related nodular tissues, coronary blood vessels, and myocardial fibers. It may play a role in these tissue-related diseases. It plays an important regulatory role in the autoimmune process. Mutations or abnormal expression of this protein are usually associated with the occurrence of related neurological diseases. It is usually closely related to the occurrence of diseases related to nervous system disorders, tumors of related tissues, and cancers such as pheoblastoma. It can also be used to diagnose and treat the various related diseases mentioned above.
  • the human neuropeptide Y protein 11 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes
  • the human neuropeptide Y protein 11 protein, especially the amino acid sequence of this protein is identified. Isolation of the new human neuropeptide Y protein 11 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the diagnosis and / or treatment of developing disease, so it is important to isolate its coding for DM. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human neuropeptide Y protein 11.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human neuropeptide Y protein 1 1.
  • Another object of the present invention is to provide a method for producing human neuropeptide gamma protein 11.
  • Another object of the present invention is to provide antibodies against the polypeptide of the present invention-human neuropeptide Y protein 11.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 835 to 1128 in SEQ ID NO: 1; and (b) a sequence having 1-3314 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human neuropeptide Y protein 11 protein, which comprises using the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of a human neuropeptide Y protein 11 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the invention also relates to the polypeptides and / or polynucleotides of the invention in the preparation for the treatment of neurological diseases, various tumors, cardiovascular diseases, development disorders, inflammation, immune diseases, blood diseases, HIV infection or other human Use of a medicament for diseases caused by abnormal expression of neuropeptide Y protein 11.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DM or RM, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human neuropeptide Y protein 1 1, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human neuropeptide Y protein 11.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human neuropeptide Y protein 11 when combined with human neuropeptide Y protein 11.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human neuropeptide gamma protein 11.
  • Regular refers to a change in the function of human neuropeptide Y protein 11, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human neuropeptide Y protein 11.
  • substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human neuropeptide Y protein 11 using standard protein purification techniques. Essentially pure human neuropeptide Y protein 11 produces a single main band on a non-reducing polyacrylamide gel. The purity of human neuropeptide Y protein 11 peptide can be analyzed by amino acid sequence.
  • Complementary or “complementary” refers to base pairing by allowing base salt concentration and temperature Polynucleotides bind naturally.
  • sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by the Clus ter method or using methods known in the art such as Jotun Hein.
  • the percent identity between nucleic acid sequences He in J., (1990) Methods in emzumo logy 183: 625- 645) 0 "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification can be Replace a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? , It can specifically bind to the epitope of human neuropeptide Y protein 11.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human neuropeptide Y protein 11 means that human neuropeptide Y protein 11 is substantially free of other proteins, lipids, sugars, or other substances that are naturally associated with it. Those skilled in the art can purify human neuropeptide Y protein 11 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human neuropeptide Y protein 11 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human neuropeptide Y protein 11, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human neuropeptide Y protein 11.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human neuropeptide Y protein 11 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid can be It may not be encoded by the genetic code; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (in) such a type, Wherein the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (such as a leader Sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences)
  • an additional amino acid sequence is fused into the mature polypeptide (such as a leader Sequences or secreted sequences or sequences
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 3314 bases in length and its open reading frame 835-1128 encodes 97 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with human neuropeptide Y, and it can be deduced that the human neuropeptide Y protein 11 has a similar function to human neuropeptide Y.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to the present invention under strict conditions.
  • the polynucleotide is a polynucleotide that can hybridize.
  • strict conditions means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 l //.
  • the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 and active.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human neuropeptide Y protein 11.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human neuropeptide Y protein 11 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These technologies include, but are not limited to:
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded MA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Qiagene). Construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DNA or DNA-RM hybridization; (2) the appearance or loss of marker gene function; (3) measuring the level of human neuropeptide Y protein 11 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides. It is preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human neuropeptide Y protein 11 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method of applying the PCR technique to amplify DM / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDM sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a coding sequence of human neuropeptide Y protein 11, and a method for producing the polypeptide of the present invention by recombinant technology .
  • a polynucleotide sequence encoding the human neuropeptide Y protein 11 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
  • an expression vector containing a DNA sequence encoding human neuropeptide Y protein 11 and appropriate transcription / translation regulatory elements can be used to construct an expression vector containing a DNA sequence encoding human neuropeptide Y protein 11 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DM synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human neuropeptide Y protein 11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS, or Bowes s melanoma cells, etc. .
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase, and treated with the ( 12 method, the steps used are well known in the art.
  • MgC l 2 If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipids. Body packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human neuropeptide Y protein 11 (Scence, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human neuropeptide Y protein 11 and human neuropeptide Y according to the present invention.
  • the upper graph is a graph of the expression profile of human neuropeptide Y protein 11, and the lower graph is the graph of the expression profile of human neuropeptide Y.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human neuropeptide Y protein 11.
  • lKDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDNA cloning kit (purchased from Clontech) was used to orient the 00 ⁇ fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ , and the bacteria formed a cDNA library.
  • the terminate cycle react ion sequencing kit (Perkin-Elmer) and the ABI 377 automatic sequencer (Perkin-Elmer) determined the sequences at the 5 'and 3' ends of all clones.
  • the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0460b06 was new DNA.
  • a series of primers were synthesized to perform bidirectional determination of the inserted CDM fragments contained in this clone.
  • Example 2 Cloning of a gene encoding human neuropeptide prion protein 11 by RT-PCR
  • the total RM of fetal brain cells was used as a template and ol igo-dT was used as a primer for reverse transcription reaction to synthesize cDM.
  • PCR amplification was performed with the following primers:
  • Primer 1 5,-CCCTAAATGCCAGTGATCTTTCCT -3 '(SEQ ID NO: 3)
  • Pr imer2 5'- GTTGCTGCTGCTGCTTTGGGTGTT -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50 mmol / L KC1, 10 mmol / L Tr is-CI, (pH 8.5.5), 1.5 mraol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol in a reaction volume of 50 ⁇ 1 Primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elraer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-3314bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human neuropeptide Y protein 11 gene expression:
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RM was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH 7.4) -5 x SSC-5 x Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, filter was placed in 1 x SSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human neuropeptide Y protein 11
  • Primer3 5'- CATGCTAGCATGTATTGTCTCAATTACTCCTCA -3 '(Seq ID No: 5)
  • Primer4 5'- CCCGAGCTCTCAACGTGGCGAAACCCCGTCTCT -3, (Seq ID No: 6)
  • the 5' ends of these two primers contain Nhel and Sacl restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Nhel and Sacl restriction sites correspond to the selectivity on the expression vector plasmid pET- 2 8b (+) (Novagen, Cat. No. 69865.3). Endonuclease site.
  • the PCR reaction was performed using the pBS-0460b06 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of pBS-0460b06 plasmid in a total volume of 50 ⁇ ,
  • the ligation product was transformed into the colibacillus DH5 ⁇ by the calcium chloride method. After being cultured overnight on an LB plate containing kanamycin (final concentration 30 ⁇ g / ml), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0460b06) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host bacteria BL21 (pET-0460b06) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L. Continue incubation for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidines (6His-Tag). The purified human neuropeptide Y protein 11 was purified.
  • a peptide specific to human neuropeptide Y protein 11 was synthesized using a peptide synthesizer (product of PE): NH2-Met-Tyr-Cys-Leu-Asn-Tyr-Ser-Ser-Gln-Ile-Pro-Trp-Glu -Val-Gly- C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total Ag G was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human neuropeptide Y protein 11.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred size of the probe ranges from 18 to 50 nucleotides; 2, GC content is 30 »/»-70 »/. If it exceeds, non-specific hybridization increases;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • pre-hybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And Hel le, RA, Schema, M., Cha i, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Ki t (purchased from QiaGen).
  • Cy3dUTP (5- Amino- propargy 1-2'- deoxyuridine 5> -triphate coupled to Cy3 f luorescent dye, purchased from Amershara Phamacia Biotech) labeled mRNA of human mixed tissues, using a fluorescent reagent Cy5dUTP (5- Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech Corporation) labeled mRM of specific tissues (or stimulated cell lines) of the body, and purified probes.
  • fluorescent reagent Cy5dUTP (5- Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy5 f luorescent dye,
  • Solut ion (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1> ⁇ SSC, 0.2% SDS) at room temperature and scanned with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Neuropeptide Y is very abundant and widely distributed in the mammalian nervous system. It plays an important role in neural signal transmission and regulation. In other tissue systems, the protein polypeptide also has immune activity in some tissues such as heart-related nodular tissue, coronary vessels, and myocardial fibers. In addition, the protein polypeptide also has immune activity in cells related to the above-mentioned tissues, such as pheoblastoma, and it also plays a very important regulatory role in the autoimmune process of body-related diseases. It can be seen that neuropeptide Y plays an important regulatory role in the transmission of mammalian nervous system information and related tissue metabolism. Mutations or abnormal expression of this protein will lead to the abnormal function of the nervous system and the occurrence of malignant diseases in related tissues. .
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human neuropeptide Y protein, and both have similar biological functions. It has a regulatory effect on neurotransmitters in the nervous system, an active function on the immune system, and a regulatory effect on the cardiovascular system. Its abnormal expression is usually closely related to neurological dysfunction, the exertion of the body's immune function, cardiovascular diseases, embryonic development, tumors, etc., and related diseases.
  • the abnormal expression of the human neuropeptide Y protein 11 of the present invention will produce various diseases, especially neurological diseases, various tumors, cardiovascular diseases, development disorders, inflammation, and immune diseases. These diseases include but are not Limited to:
  • Neurological diseases Alzheimer's disease, Parkinson's disease, Chorea, Depression, Amnesia, Huntington's disease, Epilepsy, Migraine, Multiple sclerosis, Neuromuscular disease, Neurocutaneous syndrome, Schizophrenia, Depression, neural decline, neural tube insufficiency, brain developmental abnormalities, neuronal migration disorders
  • Tumors of various tissues neuroblastoma, astrocytoma, ependymoma, glioblastoma, neurofibromatosis, gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, uterine fibroids, Uterine cancer
  • Cardiovascular diseases myocarditis, cardiomyopathy, hypertension, arrhythmia
  • neural tube defects neural tube defects, congenital hydrocephalus, congenital abortion, cleft palate, limb absentness, limb differentiation disorder, atrial septal defect, congenital glaucoma or cataract, congenital deafness, mental retardation, brain development disorder, Skin, fat and muscular dysplasia, stunting, dwarfism, Cushing syndrome, sexual retardation
  • Inflammation Chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, spherulitis, atherosclerosis, gastric ulcer, cervicitis, various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • the abnormal expression of the human neuropeptide Y protein 11 of the present invention will also cause certain hereditary, hematological diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially neurological diseases, various tumors, cardiovascular diseases, developmental disorders, inflammation, Immune diseases, certain hereditary, 'blood diseases', etc.
  • the invention also provides screening compounds to identify those that increase (agonist) or suppress (antagonist) Method of Pharmacy for Peptide Y Protein 11.
  • Agonists enhance biological functions such as human neuropeptide Y protein 11 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing human neuropeptide Y protein 11 can be cultured with labeled human neuropeptide Y protein 11 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human neuropeptide Y protein 11 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human neuropeptide Y protein 11 can bind to human neuropeptide Y protein 11 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human neuropeptide Y protein 11 When screening compounds as antagonists, human neuropeptide Y protein 11 can be added to the bioanalytical assay to determine whether the compound is antagonistic by measuring the effect of the compound on the interaction between human neuropeptide Y protein 11 and its receptor Agent. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human neuropeptide Y protein 11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human neuropeptide Y protein 11 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human neuropeptide Y protein 11 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human neuropeptide Y protein 11 directly into immunized animals (such as rabbits, mice, rats, etc.). Various adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant Wait. Techniques for preparing monoclonal antibodies to human neuropeptide Y protein 11 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta cell hybridoma technology, EBV-hybridoma technology, etc. Embedding antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human neuropeptide Y protein 11.
  • Anti-human neuropeptide prion protein 11 antibodies can be used in immunohistochemical techniques to detect human neuropeptide prion protein 11 in biopsy specimens.
  • Monoclonal antibodies that bind to human neuropeptide prion protein 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method The method is used to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human neuropeptide Y protein 11 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human neuropeptide Y protein 11 positive cells .
  • the antibodies of the present invention can be used to treat or prevent diseases related to the human neuropeptide Y protein 1 1.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human neuropeptide gamma protein 11.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human neuropeptide gamma protein 11.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human neuropeptide Y protein 11 detected in the test can be used to explain the importance of human neuropeptide Y protein 11 in various diseases and to diagnose diseases in which human neuropeptide Y protein 11 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human neuropeptide Y protein 11 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human neuropeptide Y protein 1 1.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human neuropeptide Y protein 11 to inhibit endogenous human neuropeptide Y protein 11 activity.
  • a mutated human neuropeptide Y protein 11 may be a shortened human neuropeptide Y protein 11 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human neuropeptide Y protein 11.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer a polynucleotide encoding human neuropeptide Y protein 11 into a cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human neuropeptide Y protein 1 1 can be found in existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human neuropeptide Y protein 11 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human neuropeptide prion protein 11 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically breaks down specific RNAs. Its mechanism of action is that the ribozyme molecule specifically hybridizes to a complementary target RM to perform endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human neuropeptide Y protein 11 can be used for the diagnosis of diseases related to human neuropeptide Y protein 11.
  • the polynucleotide encoding human neuropeptide Y protein 11 can be used to detect the expression of human neuropeptide Y protein 11 or the abnormal expression of human neuropeptide Y protein 11 in a disease state.
  • the DM sequence encoding human neuropeptide Y protein 11 can be used to hybridize biopsy specimens to determine the expression of human neuropeptide Y protein 11.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DM chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human neuropeptide Y protein 11 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human neuropeptide Y protein 11 transcription products.
  • Detection of mutations in the human neuropeptide Y protein 11 gene can also be used to diagnose human neuropeptide Y protein 11-related diseases.
  • Human neuropeptide Y protein 11 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human neuropeptide Y protein 11 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DM sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • sublocalization can be achieved by a similar method using a set of fragments from a specific chromosome or a large number of genomic clones.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals, and the mutation is observed in any normal individual, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human neuropeptide Y protein 11 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human neuropeptide Y protein 11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une neuroprotéine humaine Y 11, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des maladies psychiques, de toutes sortes de tumeurs, de l'angiocardiopathie, des troubles du développement, des inflammations, des maladies immunitaires, de l'hémopathie et de l'infection par VIH. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la neuroprotéine humaine Y 11.
PCT/CN2001/000358 2000-03-22 2001-03-19 Nouveau polypeptide, neuroproteine humaine y 11, et polynucleotide codant pour ce polypeptide WO2001075020A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU50256/01A AU5025601A (en) 2000-03-22 2001-03-19 A novel polypeptide, human neuroprotein y 11 and the polynucleotide encoding thepolypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00115045 CN1314397A (zh) 2000-03-22 2000-03-22 一种新的多肽——人神经多肽y蛋白11和编码这种多肽的多核苷酸
CN00115045.6 2000-03-22

Publications (2)

Publication Number Publication Date
WO2001075020A2 true WO2001075020A2 (fr) 2001-10-11
WO2001075020A3 WO2001075020A3 (fr) 2002-06-13

Family

ID=4584516

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000358 WO2001075020A2 (fr) 2000-03-22 2001-03-19 Nouveau polypeptide, neuroproteine humaine y 11, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1314397A (fr)
AU (1) AU5025601A (fr)
WO (1) WO2001075020A2 (fr)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BOLLENGIER F. ET AL. J. NEUROCHEM. vol. 50, no. 4, April 1988, pages 1210 - 1214 *
SEDDIQI N. ET AL. J. MOL. EVOL. vol. 39, no. 6, December 1994, pages 655 - 660 *

Also Published As

Publication number Publication date
AU5025601A (en) 2001-10-15
WO2001075020A3 (fr) 2002-06-13
CN1314397A (zh) 2001-09-26

Similar Documents

Publication Publication Date Title
WO2001072786A1 (fr) Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide
WO2001074869A1 (fr) Nouveau polypeptide, proteine humaine de choc thermique 15, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001075103A1 (fr) Nouveau polypeptide, proteine humaine 9 de toxine de scorpion a chaine courte, et polynucleotide codant pour ce polypeptide
WO2001055376A1 (fr) Nouveau polypeptide, proteine humaine 28 a doigt de zinc contenant un motif structural hit, et polynucleotide codant pour ce polypeptide
WO2001075020A2 (fr) Nouveau polypeptide, neuroproteine humaine y 11, et polynucleotide codant pour ce polypeptide
WO2001083743A1 (fr) Polypeptide sous-unite 11 d'adducine alpha de globule rouge humain et polynucleotide codant pour ce polypeptide
WO2001090348A1 (fr) Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide
WO2002012297A1 (fr) Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide
WO2001064721A1 (fr) Nouveau polypeptide, adenosine triphosphatase 30, et polynucleotide codant pour ce polypeptide
WO2001055381A1 (fr) Nouveau polypeptide, facteur regulateur 80 de la transcription humaine, et polynucleotide codant pour ce polypeptide
WO2001053499A1 (fr) Nouveau polypeptide, proteine nucleolaire humaine 18 de proliferation cellulaire, et polynucleotide codant pour ce polypeptide
WO2001055414A1 (fr) Nouveau polypeptide, proteine rgs 17, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001094371A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001075036A2 (fr) Nouveau polypeptide, immunophiline humaine 14, et polynucleotide codant pour ce polypeptide
WO2001070983A1 (fr) Nouveau polypeptide, proteine antigene prostatique specifique membranaire 9, et polynucleotide codant pour ce polypeptide
WO2001075059A2 (fr) Nouveau polypeptide, proteine humaine 11 de regulation de gtp, et polynucleotide codant pour ce polypeptide
WO2002020595A1 (fr) Nouveau polypeptide, proteine a doigt de zinc humaine 18.04, et polynucleotide codant ce polypeptide
WO2001074886A1 (fr) Nouveau polypeptide, glycoproteine amyloidogenique humaine 9, et polynucleotide codant pour ce polypeptide
WO2001055184A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 19, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2001055192A1 (fr) Nouveau polypeptide, facteur de croissance neuronal humain 34, et polynucleotide codant pour ce polypeptide
WO2001068692A1 (fr) Nouveau polypeptide, proteine humaine conjuguee du cancer de la retine 9, et polynucleotide codant pour ce polypeptide
WO2001087968A1 (fr) Proteine s4-36 ribosomale, polypeptide humain, et polynucleotide la codant

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP