WO2001053499A1 - Nouveau polypeptide, proteine nucleolaire humaine 18 de proliferation cellulaire, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine nucleolaire humaine 18 de proliferation cellulaire, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001053499A1
WO2001053499A1 PCT/CN2001/000026 CN0100026W WO0153499A1 WO 2001053499 A1 WO2001053499 A1 WO 2001053499A1 CN 0100026 W CN0100026 W CN 0100026W WO 0153499 A1 WO0153499 A1 WO 0153499A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
cell proliferation
human cell
sequence
Prior art date
Application number
PCT/CN2001/000026
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biodoor Gene Technology Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biodoor Gene Technology Ltd. Shanghai filed Critical Biodoor Gene Technology Ltd. Shanghai
Priority to AU2001229964A priority Critical patent/AU2001229964A1/en
Publication of WO2001053499A1 publication Critical patent/WO2001053499A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4738—Cell cycle regulated proteins, e.g. cyclin, CDC, INK-CCR
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human cell proliferation nucleoli protein 18, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • the nucleoli is one of the important organelles in the nucleus of the nucleus. It can be observed that the morphology of the nucleoli changes during cell proliferation.
  • the nucleoli polymorphism and high activity are the main manifestations of cancer cells. Some proteins are involved in the maintenance of nucleolar morphology and are related to the regulation of cell proliferation, and they are closely related in evolution.
  • mammalian proliferating cell nucleolar antigen P120 (gene NOL1).
  • the P120 antigen is associated with increased nucleolar activity.
  • Human NOL1 protein has a sudden increase at the junction of the Gl-S phase of the cell cycle, indicating that the P120 antigen is involved in regulating cell proliferation.
  • the Pl20 antigen can be found in many human tumors, but it is not expressed in normal tissues. P120 antigen is not expressed in cells that have stopped growing, but is expressed early in the G1 phase of the cell cycle.
  • pl20 antigen will lead to the transformation of NIH 3T3 cells, and pl20 antisense RNA can restore pl20 transformed cells to the original normal phenotype.
  • pl20 antisense RNA can restore pl20 transformed cells to the original normal phenotype.
  • the nucleolar protein NOP2 (or YNA1) in yeast is related to the nucleoli function during cell proliferation and the assembly of the large ribosomal subunit. NOP2 has very high homology to human pl20 antigen. When the cell changes from a resting state to a rapidly proliferating state, NOP2 expression can be detected. Although overexpression of NOP2 did not cause discernible proliferation of cells and synthesis of ribosomal subunits, observations from electron microscope showed that overexpression can affect the morphology of nucleoli. Overexpression causes the nucleoli to detach from the nuclear membrane and become more rounded or flaky. This shows that NOP2 is related to cell proliferation and also to the maintenance of nucleoli structure. ⁇ J Cell Biol 1994 Dec; 127 (6 Pt 2): 1799-813 ⁇
  • the protein sun also known as fnrn
  • the protein sun found in E. coli has very high homology with pl20.
  • Their conserved homologous sequences can be used as the characteristic sequence of such proteins: [FV] -D- [KRA]-[LIVMA] -L- x-D- [AV] -P-C- [ST]-[GA]
  • the polypeptide of the present invention contains the characteristic conserved sequences of the NOL1_N0P2_SUN protein family. It is a new member of this family and has similar biological functions. It is named human cell proliferation nucleoli protein XX. Since the human cell proliferation nucleolarin 18 protein plays an important role in important functions in the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more human cell proliferation nuclei involved in these processes. Renin 18 protein, especially the amino acid sequence of this protein. Isolation of the new human cell proliferation nucleolarin 18 protein encoding gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a method for producing human cell proliferating nucleoliin 18.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human cell proliferation nucleolarin 18.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human cell proliferation nucleolarin 18.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with an abnormality in human cell proliferation nucleolarin 18.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 A sequence of positions 1 39-642; and (b) a sequence of positions 1-342 0 in SEQ ID NO: 1.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human cell proliferation nucleoprotein 18 protein activity, which comprises utilizing the polypeptide of the present invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of human cell proliferation nucleolarin 18 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for the treatment of cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human cell proliferation nucleolarin 18.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • “Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human cell proliferation nucleolarin 18, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human cells to proliferate nucleolarin 18.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human cell proliferation nucleolarin 18 when combined with human cell proliferation nucleolarin 18.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds to human cells to proliferate nucleolarin 18.
  • Regular refers to a change in the function of human cell proliferation nucleolarin 18, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human cell proliferation change.
  • Substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human cell proliferation nucleoli protein 18 using standard protein purification techniques. Basic The pure human cell proliferation nucleolusin 18 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the human cell proliferation nucleolusin 18 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Sout hern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other specifically or selectively.
  • Percent identity means the sequence is the same or similar in the comparison of two or more amino acid or nucleic acid sequences Percentage.
  • the percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). 0
  • the MEGALIGN program can compare two or more sequences according to different methods, such as the Cl uster method ( Higgins, DG and PM Sharp (1988) Gene 73: 237-244) 0 C lus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun He in (Hein J., (1990) Me thods in emzumology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and? ⁇ It can specifically bind to the epitope of human cell proliferation nucleolarin 18.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if natural Matter, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human cell proliferating nucleoliin 18 means that human cell proliferating nucleoliin 18 is substantially free of other proteins, lipids, sugars, or other substances that are naturally associated with it.
  • Those skilled in the art can purify human cell proliferation nucleoli protein 18 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on a non-reducing polyacrylamide gel. The purity of the human cell proliferation nucleolusin 18 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human cell proliferation nucleolarin 18, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives, and analogs of human cell proliferation nucleolarin 18.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human cell proliferation nucleolarin 18 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 3420 bases in length and its open reading frame 139-642 encodes 167 amino acids.
  • This peptide has the characteristic sequence of N0L1 _N0P2 _SUN protein family members, and it can be deduced that the human cell proliferating nucleoli protein 18 has the structure and function represented by the members of the NOLI— N0P2 — SUN protein family.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genes Group DNA or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1Vj, bovine serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human cell proliferation nucleolarin 18.
  • the polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human cell proliferation nucleolarin 18 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determining the level of human cell proliferation nucleolarin 18 transcripts; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human cell proliferation nucleoprotein 18 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method using DNA technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be based on the polyglycolic acid sequence information of the present invention disclosed herein It is appropriately selected and synthesized by a conventional method.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human cells to propagate the nucleolarin 18 coding sequence, and the recombinant technology to produce the polypeptide of the present invention. method.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human cell proliferation nucleolarin 18 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, lysine synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human cell proliferation nucleoli protein 18 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • E. coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as insect cells such as fly S2 or S f 9
  • animal cells such as CH0, COS or Bowes melanoma cells, etc. .
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM may be harvested after exponential growth phase, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human cell proliferation nucleolarin 18 (Scence, 1984; 224: 14 31). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • FIG. 1 is a comparison diagram of the amino acid sequences of functional domains of human cell proliferation nucleolarin 18 and NOL1_N0P2_SUN protein family members of the present invention.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human cell proliferating nucleoli protein 18.
  • 18KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band. The best way to implement the invention
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0651 e 06 was new DNA.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • the results show that the 0651e06 clone contains a full-length cDNA of 3420bp (as shown in SeqIDN0: 1), and a 504bp open reading frame (0RF) from 139bp to 642bp, encoding a new protein (such as Seq ID NO: 2 (Shown).
  • Seq ID NO: 2 Seq ID NO: 2 (Shown).
  • this clone pBS-0651e06 and the protein encoded was named human cell proliferation nucleoli protein 18.
  • Example 2 Domain analysis of cDNA clones
  • the sequence of human cell proliferation nucleolarin 18 and its encoded protein sequence of the present invention were profiled using the GCG profile scan program (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215 : 403-10], performing domain analysis in databases such as prosite.
  • the human cell proliferation nucleolusin 18 of the present invention is homologous with members of the domain NOL1_N0P2_SUN protein family, and the homology results are shown Figure 1
  • Example 3 Cloning of a gene encoding human cell proliferation nucleolarin 18 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primer 1 5'- GGAGAAATTGAGGAGGAAACGTGA -3 '(SEQ ID NO: 3)
  • Primer2 5'- GAAAGGGTCTCTCGCTCTGTTGCC -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ol / L KC1, 10 mmol / L Tris-
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was prepared using 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (H7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation 32 P- DNA probe labeled with a- 32 P dATP by random priming method. The DNA probe used was the PCR-encoded human cell proliferating nucleolarin 18 coding region sequence (139bp to 642bp) shown in FIG.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 ( P H7.4)-5 ⁇ SSC-5 ⁇ Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In Vitro Expression, Isolation and Purification of Recombinant Human Cell Proliferating Nucleoprotein 18 According to SEQ ID NO: 1 and the coding region sequence shown in FIG. 1, a pair of specific amplification primers was designed, and the sequences are as follows:
  • Primer3 5'- CATGCTAGCATGCTGACCCAGCTGAAAGCAAAA -3 '(Seq ID No: 5)
  • Primer4 5'- CCCGAGCTCTTAAAAAGTTGTCAAATACTGAAA _3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Nhel and Sacl restriction sites, respectively.
  • the coding sequence at the end, the Nhel and Sacl restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET 28b (+) (Novagen, Cat. No. 69865.3).
  • PCR was performed using the pBS-0651e06 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0651e06 plasmid, Primer-3 Primer-4: ⁇ ! ⁇ 10 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
  • Nhel and Sacl were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into E. coli DH5 cc using the calcium chloride method.
  • positive clones were selected by colony PCR method and sequenced.
  • a positive clone (pET-0651e06) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host bacteria BL21 (pET-0651e06) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L, continue to cultivate for 5 hours.
  • the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human cell proliferation nucleolar protein 18-specific peptides:
  • NH2-Met-Leu-Thr-Gln-Leu-Lys-Ala-Lys-Ser-Glu-Gly-Lys-Leu-Ala-Lys-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin polypeptide complex and bovine serum albumin to form a complex, respectively.
  • Rabbits were immunized with 4rag of the above-mentioned cyanin polypeptide complex and complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex and incomplete Freund's adjuvant were used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharos B column and the total IgG Anti-peptide antibodies were isolated.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human cell proliferating nucleolarin 18.
  • Example 7 Use of a polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Sou thern imprinting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • GC content is 30% -70%, if it exceeds, non-specific hybridization increases
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements Region for homology comparison, if the homology with non-target molecular region is greater than 85% After 15 consecutive bases are identical, the primary probe should not be used in general;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • pre-hybridization solution 10xDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA).
  • Gene microarrays or DNA microarrays are currently used in many national laboratories and pharmaceutical companies.
  • the companies are starting to develop and develop a new technology. It refers to arranging a large number of target gene fragments in an orderly and high density on a carrier such as glass and silicon, and then using fluorescence detection and computer software to compare and analyze the data.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature for various references. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic instrument. After elution, the DM was fixed on the glass slide to prepare chips.
  • the specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
  • Kit (purchased from QiaGen) purified mRNA, and the fluorescent reagent Cy3dUTP (5- Amino- propargy 1-2 '-deoxyur dine 5'-tr iphate coupled to Cy3 fluorescent dye, respectively, purchased from Amersham Phamacia Biotech Company through reverse transcription )
  • Cy3dUTP 5- Amino- propargy 1-2 '-deoxyur dine 5'-tr iphate coupled to Cy3 fluorescent dye, respectively, purchased from Amersham Phamacia Biotech Company through reverse transcription
  • Cy5dUTP 5-Ami no-propargy 1-2 ⁇ -deoxyur i dine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech. Probes were prepared after purification.
  • Probes from the above two types of tissues and chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 SSC, 0.2% SDS) at room temperature and scanned with ScanArray 3000. Instrument (purchased from General Scanning Company, USA) for scanning. The scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA), and the Cy3 / Cy5 ratio of each point was calculated. Differentially expressed genes.
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • the nucleoli polymorphism and high activity are the main manifestations of cancer cells.
  • Mammalian proliferating cell nucleoli antigen pl20 (gene NOL1) is involved in regulating increased nucleoli activity.
  • Human 'N0L1 protein has a sudden increase at the junction of the G1-S phase of the cell cycle, indicating that the P120 antigen is involved in regulating cell proliferation.
  • P120 antigen can be found in many human tumors, but it is not expressed in normal tissues. The overexpression of human P120 antigen will lead to the transformation of NIH 3T3 cells, and pl20 antisense RNA can restore pl20 transformed cells to their original normal phenotype.
  • nucleolus protein NOP2 in yeast and the protein sun in E. coli have very high homology with human pl20 antigen. They have the same characteristically conserved sequences, and the characteristic sequences of this protein family are necessary for their biological activity.
  • the polypeptide of the present invention is a polypeptide containing a characteristic sequence of this protein family. Abnormal expression will cause abnormal regulation of nucleoli activity, cause abnormal changes in the cell cycle process, and then cause related diseases.
  • human cell proliferation nucleolarin 18 of the present invention will produce various diseases, especially various tumors and immune diseases. These diseases include, but are not limited to:
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal and sinus tumors, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma
  • Immune diseases rheumatoid arthritis, chronic active hepatitis, post-infection myocarditis, systemic lupus erythematosus, scleroderma, myasthenia gravis, Guillain-Barre syndrome, autoimmune hemolytic anemia, general variable immunity Defective disease, Primary B-lymphocyte immunodeficiency disease, Primary T-lymphocyte immunodeficiency disease, Severe combined immunodeficiency disease Wi skot t-Aldr ich syndrome, with ataxia capillaries, Primary phagocytosis Cellular immunodeficiency disease, primary complement system deficiency, acquired immunodeficiency syndrome, bronchial asthma, aspirin asthma, allergic rhinitis, diffuse pulmonary interstitial fibrosis, urticaria, specific dermatitis
  • the polypeptide of the present invention can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, immune diseases and the like.
  • the present invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human cell proliferation nucleolus 18.
  • Agonists enhance human cell proliferation, nucleolarin 18, and stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a human cell proliferating nucleolarin 18 membrane preparation can be cultured with a labeled human cell proliferating nucleolarin 18 in the presence of a drug. The ability of the drug to increase or suppress this interaction is then determined.
  • Antagonists of human cell proliferation nucleolus 18 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human cell proliferation nucleoliin 18 can bind to human cell proliferation nucleoliin 18 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
  • human cell proliferation nucleolusin 18 can be added to bioanalytical assays to determine whether a compound is Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Polypeptide molecules capable of binding to human cell proliferation nucleolusin 18 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, human cell proliferating nucleoliin 18 molecules should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human cell proliferation nucleolarin 18 epitopes. These antibodies include (but are not limited to): Polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human cell proliferation nucleolarin 18 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
  • Techniques for preparing monoclonal antibodies to human cell proliferation nucleolusin 18 include, but are not limited to, hybridoma technology (Kohler and Milstein, Nature, 1975, 256: 495-497), triple tumor technology, human beta -Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morr et al, PNAS, 1985, 81: 6851). 0
  • Existing techniques for producing single-chain antibodies US Pa t No. 4946778) can also be used to produce single-chain antibodies against human cell proliferation nucleolarin 18.
  • Antibodies against human cell proliferation nucleolusin 18 can be used in immunohistochemical techniques to detect human cell proliferation nucleoliin 18 in biopsy specimens.
  • Monoclonal antibodies that bind to human cell proliferation nucleolusin 18 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human cell proliferation nucleolus protein 18 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human cell proliferation nucleoli 18 positive cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human cell proliferation nucleolarin 18. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human cell proliferation nucleolusin 18.
  • the present invention also relates to a diagnostic test method for the quantitative and localized detection of human cell proliferation nucleolarin 18 levels. These tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the level of human cell proliferation nucleoliin 18 detected in the test can be used to explain the importance of human cell proliferation nucleoliin 18 in various diseases and to diagnose diseases in which human cell proliferation nucleoliin 18 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human cell proliferation nucleolarin 18 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human cell proliferation nucleolarin 18.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed for Expression of mutated nucleolarin 18 in human cell proliferation to inhibit endogenous human cell proliferation nucleolarin 18 activity.
  • a variant human cell proliferating nucleoliin 18 may be a shortened human cell proliferating nucleoliin 18 lacking a signal transduction domain. Although it can bind to a downstream substrate, it lacks signal transduction activity.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human cell proliferating nucleolar protein 18.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer polynucleotides encoding human cell proliferation nucleolar protein 18 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding human cell proliferation nucleolar protein 18 can be found in existing literature (Sambrook, etal.).
  • a recombinant polynucleotide encoding human cell proliferation nucleoprotein 18 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human cell proliferation of nucleolarin 18 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA and ribozymes can be obtained using any existing RNA or DM synthesis techniques, such as solid phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM.
  • This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human cell proliferation nucleolarin 18 can be used for the diagnosis of diseases related to human cell proliferation nucleolarin 18.
  • the polynucleotide encoding human cell proliferation nucleoliin 18 can be used to detect the expression of human cell proliferation nucleoliin 18 or the abnormal expression of human cell proliferation nucleoliin 18 in a disease state.
  • the DNA sequence encoding human cell proliferation nucleoli protein 18 can be used to hybridize biopsy specimens to determine the expression status of human cell proliferation nucleoli protein 18.
  • Hybridization techniques include Sout hern blotting, Nor t hern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Mic Roa ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and Genetic diagnosis.
  • Human cell proliferation nucleolus 18 specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human cell proliferation nucleolus 1 8 transcription products. Detection of mutations in the human cell proliferation nucleolusin 18 gene can also be used to diagnose human cell proliferation nucleoliin 18-related diseases.
  • Human cell proliferation nucleolusin 18 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human cell proliferation nucleoliin 18 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found, for example, in V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, The cDNA of the disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution and one gene per 20 kb).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human cell proliferating nucleoli protein 1 8 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human cell proliferating nucleolarin 18 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Toxicology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine nucléolaire humaine 18 de prolifération cellulaire, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine nucléolaire humaine 18 de prolifération cellulaire.
PCT/CN2001/000026 2000-01-21 2001-01-15 Nouveau polypeptide, proteine nucleolaire humaine 18 de proliferation cellulaire, et polynucleotide codant pour ce polypeptide WO2001053499A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001229964A AU2001229964A1 (en) 2000-01-21 2001-01-15 Novel polypeptide---human proliferating-cell nucleolar protein 18 and polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00111468.9 2000-01-21
CN 00111468 CN1307006A (zh) 2000-01-21 2000-01-21 一种新的多肽——人细胞增殖核仁蛋白18和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001053499A1 true WO2001053499A1 (fr) 2001-07-26

Family

ID=4581378

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000026 WO2001053499A1 (fr) 2000-01-21 2001-01-15 Nouveau polypeptide, proteine nucleolaire humaine 18 de proliferation cellulaire, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1307006A (fr)
AU (1) AU2001229964A1 (fr)
WO (1) WO2001053499A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115855894B (zh) * 2022-11-01 2023-08-08 深圳大学 识别核仁的探针和试剂盒、核仁标记方法

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 1 November 2000 (2000-11-01), FONAGY A. ET AL., Database accession no. Np-006161 *
DATABASE GENBANK [online] 3 December 1999 (1999-12-03), BECK A. ET AL., Database accession no. T40814 *

Also Published As

Publication number Publication date
AU2001229964A1 (en) 2001-07-31
CN1307006A (zh) 2001-08-08

Similar Documents

Publication Publication Date Title
WO2001053499A1 (fr) Nouveau polypeptide, proteine nucleolaire humaine 18 de proliferation cellulaire, et polynucleotide codant pour ce polypeptide
WO2001048223A1 (fr) Nouveau polypeptide, ubiquitine-protease 18, et polynucleotide codant pour ce polypeptide
WO2001074869A1 (fr) Nouveau polypeptide, proteine humaine de choc thermique 15, et polynucleotide codant pour ce polypeptide
WO2001048221A1 (fr) Nouveau polypeptide, colipase 12, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001088152A1 (fr) Nouveau polypeptide, enzyme de conjugaison de l'ubiquitine humaine 13, et polynucleotide codant pour ce polypeptide
WO2001075036A2 (fr) Nouveau polypeptide, immunophiline humaine 14, et polynucleotide codant pour ce polypeptide
WO2001055381A1 (fr) Nouveau polypeptide, facteur regulateur 80 de la transcription humaine, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001064721A1 (fr) Nouveau polypeptide, adenosine triphosphatase 30, et polynucleotide codant pour ce polypeptide
WO2001092326A1 (fr) Nouveau polypeptide, phosphatase acide 13, et polynucleotide codant ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001055415A1 (fr) Nouveau polypeptide, aminoacyl-arnt synthetase humaine de type ii 75, et polynucleotide codant pour ce polypeptide
WO2001074996A2 (fr) Nouveau polypeptide, c. elegans 52 humain, et polynucléotide codant pour ce polypeptide
WO2001055184A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 19, et polynucleotide codant pour ce polypeptide
WO2001074891A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 17, et polynucleotide codant pour ce polypeptide
WO2001046426A1 (fr) Nouveau polypeptide, enzyme de conjugaison de l'ubiquitine 10, et polynucleotide codant pour ce polypeptide
WO2001072814A1 (fr) Nouveau polypeptide, ubiquitine-conjugase humaine 17, et polynucleotide codant pour ce polypeptide
WO2001073061A1 (fr) Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide
WO2001064867A1 (fr) Nouveau polypeptide, facteur humain 33 associe a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001055401A1 (fr) Nouveau polypeptide, helicase atp-dependante humaine 31, et polynucleotide codant pour ce polypeptide
WO2001064722A1 (fr) Nouveau polypeptide, proteine humaine 9 associee a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2001074877A1 (fr) Nouveau polypeptide, proteine humaine de transport 12 d'acides amines excitateurs, et polynucleotide codant pour ce polypeptide
WO2001074887A1 (fr) Nouveau polypeptide, proteine humaine 9 humsiah, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP