WO2001064867A1 - Nouveau polypeptide, facteur humain 33 associe a la transcription inverse, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, facteur humain 33 associe a la transcription inverse, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001064867A1
WO2001064867A1 PCT/CN2001/000248 CN0100248W WO0164867A1 WO 2001064867 A1 WO2001064867 A1 WO 2001064867A1 CN 0100248 W CN0100248 W CN 0100248W WO 0164867 A1 WO0164867 A1 WO 0164867A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
reverse transcription
related factor
sequence
Prior art date
Application number
PCT/CN2001/000248
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU2001246300A priority Critical patent/AU2001246300A1/en
Publication of WO2001064867A1 publication Critical patent/WO2001064867A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a human reverse transcription-related factor 33, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide.
  • the L1 factor can be found in all mammalian genomes and is involved in the reverse transcription process. In the human genome, it exists on LRE2 on chromosome lq. Structurally, the L1 factor does not have a long terminal repeat sequence, and its poly-A tail at the 3, -terminus is special, and it is not fixed on every L 1 factor.
  • the proliferation process of the L1 factor includes transcription, reverse transcription, and reintegration into a new site on the genome.
  • the 5 'end of the L 1 factor is mostly a blunt-end structure, which is different from the general sticky-end structure, but does not affect its transcription integration process.
  • the 5 'end untranslated region (UTR) contains an internal promoter that regulates and controls the speed of the entire reverse transcription process.
  • the LRE2 site contains two complete open reading frames (0RF1 and 0RF2).
  • the 0RF1 frame encodes an approximately 40Kd embryonic cancer cell protein.
  • the 0RF2 frame is sequenced with reverse transcriptase and other retroviral proteins. Similarity can mediate the process of reverse transcription. Using experimental methods to remove the first 32Bp of the L1 factor, the resulting product can only show 20% of normal transcription efficiency.
  • the inserted gene on LRE2 proved that the flanking sequence produced by the L1 factor during the read-through process can reverse transcription, because its tail has a different poly A structure.
  • this type of read-through process can also be achieved by retroviruses, which can also obtain the desired intracellular DNA sequence. Insertion rearrangement at the LRE2 site can lead to some abnormalities in gene expression.
  • a more typical example is muscular dystrophy. In the muscles of malnourished patients, a dystrophin protein is found.
  • This protein gene has a 2Kb insertion gene that contains a rearranged L1 factor.
  • the patient's chromosome 1q There is an allele at the LRE2 locus, which corresponds to the inserted sequence.
  • LRE2 has a complete copy of the target site of 1 3-1 5B P , and an unusual blunt end of 21Bp at the 5 'end, which proves that the blunt end
  • the structure is still capable of reverse transcription.
  • the insertion of two bases on the L1 factor can lead to Duchenne muscular dystrophy (B, Bakker, & G. Van Omenn, pers ona 1 commun i ca ti on), which is a family inherited disease and suffers from People with this disease usually die in infancy or earlier adulthood.
  • the polypeptide of the present invention is 90% identical to the aforementioned L1 factor, 94% similar, and contains L 1 A family-specific conserved sequence, this protein is considered to be a new L 1 factor with similar biological functions as L 1 factor, and is named human reverse transcription-related factor 33.
  • the human reverse transcription-related factor 33 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so it has been necessary to identify more involved in these processes in the art
  • the human reverse transcription-associated factor 33 protein especially the amino acid sequence of this protein was identified.
  • the isolation of the novel human transcription factor 33 protein-coding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding DNA. Disclosure of invention
  • An object of the present invention is to provide an isolated novel polypeptide-human reverse transcription-related factor 33 and fragments, analogs and derivatives thereof.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human reverse transcription-related factor 33.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human reverse transcription-related factor 33.
  • Another object of the present invention is to provide a method for producing human reverse transcription-related factor 33.
  • Another object of the present invention is to provide an antibody against a human reverse transcription-related factor 33 of a polypeptide of the present invention.
  • Another object of the present invention is to provide analog compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human reverse transcription-related factor 3 3.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of human reverse transcription-related factor 33.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human reverse transcription-related factor 33 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human reverse transcription-related factor 33 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
  • the present invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human reverse transcription-related factor 33.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human reverse transcription-related factor 33, causes the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human reverse transcription-related factor 33.
  • Antagonist refers to a molecule that, when combined with human reverse transcription-related factor 33, can block or regulate the biological or immunological activity of human reverse transcription-related factor 33.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human reverse transcription-related factor 33.
  • Regular refers to a change in the function of human reverse transcription-related factor 33, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human reverse transcription-related factor 33. .
  • substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human reverse transcription-related factors 33 using standard protein purification techniques. Basically Pure human reverse transcription-related factor 33 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human reverse transcription-related factor 33 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. Inhibition of such hybridization can be detected by performing hybridization (Sou t hern blot or Nor t hern blot, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require the binding of two sequences to each other. Combined as specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences.
  • the percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.).
  • the MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P.M. Sharp (1988) Gene 73: 237-244).
  • the Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the epitope of human reverse transcription-related factor 33.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not its natural environment The ingredients, they are still separated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human RT-related factor 33 means that human RT-related factor 3 3 is essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human RT-related factors 33 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human RT-related polypeptide 33 can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide-human reverse transcription-related factor 33, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human reverse transcription-related factor 33.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human reverse transcription-related factor 33 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
  • such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue.
  • polypeptide contains a polynucleotide sequence of 2 707 bases in length and its open reading frame of 1426-2 328 encodes 300 amino acids According to the amino acid sequence homology comparison, it was found that the polypeptide has 90% homology with the L1 factor, and it can be deduced that the human reverse transcription-related factor 33 has a similar structure and function to the L1 factor.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DM forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least two sequences between
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • stringent conditions means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 l e /. SDS, 60 ° C; or (2) adding denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; Or (3) Hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 60-60 nucleotides, and most preferably at least 100 nucleotides. More than nucleotides. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human reverse transcription-related factor 33.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human reverse transcription-related factor 33 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been developed for mRNA extraction, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human reverse transcription-related factor 33 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human reverse transcription-related factor 33 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method using PCR technology to amplify DM / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified MA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • Polynucleotide sequences of the gene of the present invention obtained as described above, or various DNA fragments can be used The standard method is determined by dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human reverse transcription-related factor 33 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology. .
  • a polynucleotide sequence encoding human reverse transcription-related factor 33 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human reverse transcription-related factor 33 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selecting transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture, and And green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • selectable marker genes to provide phenotypic traits for selecting transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture, and And green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human reverse transcription-related factor 33 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • Drosophila S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human reverse transcription-related factors 33 (Scence, 1984; 224: 14 31). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
  • Fig. 1 is a comparison diagram of amino acid sequence homology of the reverse transcription-related factor 33 and L1 factor of the present inventors.
  • the upper sequence is human reverse transcription-related factor 33, and the lower sequence is L1 factor.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human reverse transcription-related factor 33.
  • 33KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Use Quik mRNA Isolation Kit (( ⁇ 6 ⁇ 11 ⁇ 2 company products) to isolate 0 ⁇ (eight) mMA from total 1 ⁇ 8. 2ug poly (A) mRNA was reverse transcribed to form cDNA.
  • Smart cDNA cloning kit (purchased from Clontech) ) Directly insert the cDNA fragment into the multicloning site of pBSK (+) vector (Clontech), transform DH5oc, and form a cDNA library with bacteria.
  • 1426bp to 2328bp has a 903bp open reading frame (ORF), which encodes a new protein (as shown in Seq ID NO: 2).
  • ORF open reading frame
  • pBS- 0102f 02 the encoded protein is named human reverse transcription-related factor 33.
  • Example 2 Homologous search of cDNA clones
  • the sequence of the human reverse transcription-associated factor 33 and the protein sequence encoded by the present invention were performed using the Blast program (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], homology search in databases such as Genbank, Swissport.
  • the gene with the highest homology to the human reverse transcription-related factor 33 of the present invention is a known L1 factor, and the accession number of the encoded protein in Genbank is 1109116.
  • the protein homology results are shown in Figure 1. The two are highly homologous, with 90% identity; 94% similarity.
  • Example 3 Cloning of a gene encoding human reverse transcription-related factor 33 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primer 1 5'- GAACTGAAGCTATCTATACATAAG —3, (SEQ ID NO: 3)
  • Primer2 5'- AAAACATTCTTTATTTGGTCAATA-3, (SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50 ol / L KC1, 10 legs ol / L Tris-CI, (pH8.5), 1.5mmol / L MgCl 2 , 200 ⁇ mol / L dNTP in 50 ⁇ 1 reaction volume , lOpmol primer, 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2707bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human RT-related gene 33 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. I.e. with 4M guanidine isothiocyanate - 25mM sodium citrate, 0.2M sodium acetate (P H4.0) of the tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform - isoamyl alcohol (49: 1) Centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA was precipitated with 70. /. Wash with ethanol, dry and dissolve in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 20 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was placed in 1 SSC-0.1% SDS at 55 ° C Wash for 30min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human reverse transcription-related factor 33
  • Primer 3 5,-CATGCTAGCATGCTAGAAGAAAACCTAGGCAAT -3, (Seq ID No: 5)
  • Primer 4 5,-CCCGAGCTCTCAATTCCCACCTATGAGTGAGAA -3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Nhel and Sacl restriction sites, respectively , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the Nhel and Sacl restriction sites correspond to the selectivity on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Endonuclease site.
  • PCR was performed using the pBS-0102f 02 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS- 0102f02 plasmid, primers Primer-3 and Primer- 4 points, and J was lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1.
  • Cycle parameters 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
  • Nhel and Sacl were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into E. coli DH5ct by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 g / ml), positive clones were selected by colony PCR method and sequenced. A positively-active clon (pET- 0102f02) with the correct sequence was selected to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host bacteria BL21 (pET-0102f02) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mol / L. , Continue to cultivate for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (Novagen) was used to obtain 6 histidines (6His-Tag). Purified the target protein human reverse transcription-related factor 33. After SDS-PAGE electrophoresis, a single band was obtained at 33 KDa ( Figure 2).
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then use the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps. In this embodiment, higher-intensity washing conditions (such as lower salt concentration and higher temperature) are used to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the invention; the second type of probes are partially related to the invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • the selected probes are compared for homology with their source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complementary regions. If the homology with the non-target molecular region is greater than 85% or more than 15 Two consecutive bases are completely the same, the primary probe should generally not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that it can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free Y - 32 P-dATP) is prepared.
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRisi, L L., Lyer, V. & Brown, P.0.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and a Cartesian 7500 spotter (purchased from Cartesian Corporation, USA) was used to spot the glass medium. The distance between them is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in an ultraviolet cross-linking instrument. After elution, the DNA was fixed on the glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified using Oligotex mRNAMidi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5- Amino- propargyl-2--deoxyur idine 5- -tr iphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) to label mRNA of normal liver tissue with fluorescent reagent Cy5dUTP (5-Amino-propargyl-2'-deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label the liver cancer tissue mRNA, and the probe was prepared after purification.
  • Cy3dUTP 5- Amino- propargyl-2--deoxyur idine 5- -tr iphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) to label mRNA of normal liver
  • the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1> ⁇ SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray.
  • the 3000 scanner purchased from General Scanning Company, USA was used to scan.
  • the scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA), and the Cy3 / Cy5 ratio of each point was calculated. It is considered to be a gene whose expression is different.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • LRE2 on mammalian chromosome lq participates in the reverse transcription process.
  • the proliferation process of LRE2 includes three processes: transcription, reverse transcription, and reintegration into a new site on the genome. Insertion rearrangement at the LRE2 site can lead to some abnormalities in gene expression. Such as the development of muscular dystrophy (Duchenne muscular dystrophy).
  • the polypeptide of the present invention is homologous to LRE2 on mammalian chromosome lq, and contains the characteristic sequence of the LRE2 family. It is involved in the reverse transcription process in the body and regulates the expression of certain genes. Its abnormal expression can cause errors in the regulation of related genes and cause related diseases.
  • the abnormal expression of the human reverse transcription-related factor 33 of the present invention will produce various diseases, especially muscular dystrophy, various tumors, embryonic development disorders, growth and development disorders, inflammation, and immune diseases. These diseases include, but are not limited to:
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, Thyroid tumors, uterine fibroids, neuroblastomas, astrocytomas, ependymomas, gliomas, neurofibromas, colon cancers, melanomas, bladder cancers, uterine cancers, endometrial cancers, colon cancers, Tumors of the thymus, nasopharyngeal carcinoma, larynx, trachea, fibroids, fibrosarcoma, lipomas, liposarcomas
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • Abnormal expression of the human reverse transcription-related factor 33 of the present invention will also produce certain hereditary, hematological diseases, and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially muscular dystrophy, various tumors, embryonic development disorders, and developmental disorders. Diseases, inflammation, immune diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human reverse transcription-related factor 33.
  • Agonists enhance biological functions such as human reverse transcription-related factor 33 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human reverse transcription-related factor 33 can be cultured with labeled human reverse transcription-related factor 33 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human reverse transcription-related factor 3 3 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human reverse transcription-related factor 33 can bind to human reverse transcription-related factor 33 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human reverse transcription-related factor 3 3 can be added to the bioanalytical assay to determine whether the compound is antagonistic by measuring the effect of the compound on the interaction between human reverse transcription-related factor 33 and its receptor.
  • Agent Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Peptide molecules capable of binding to human reverse transcription-related factor 3 3 It is obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the 33 molecules of human reverse transcription-related factor should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the present invention also provides antibodies directed against the epitope of human reverse transcription-related factor 33. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • polyclonal antibodies can be obtained by injecting human reverse transcription-related factor 33 directly into immunized animals (such as home immunity, mice, rats, etc.).
  • immunized animals such as home immunity, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant .
  • Techniques for preparing monoclonal antibodies to human reverse transcription-related factor 33 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cells Hybridoma technology, EBV-hybridoma technology, etc.
  • the chimeric antibody variable region and a human constant region of non-human origin in combination produce the available prior art (Morr i son etal, PNAS, 1985, 81: 6851) 0 only some technical production of single chain antibodies (US Pa t No. 4946778) can also be used to produce single chain antibodies against human reverse transcription-related factor 33.
  • Antibodies against human reverse transcription-related factor 33 can be used in immunohistochemical techniques to detect human reverse transcription-related factor 33 in biopsy specimens.
  • Monoclonal antibodies that bind to human reverse transcription-related factor 33 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • Human reverse transcription related factor Human reverse transcription related factor
  • High-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • SPDP thiol cross-linking agent
  • This hybrid antibody can be used to kill human reverse transcription-related factor 33 positive cells .
  • the antibodies of the present invention can be used to treat or prevent diseases related to human reverse transcription-related factor 33.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human reverse transcription-related factor 33.
  • the present invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human reverse transcription-related factor 33.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the levels of human RT-related factor 33 detected in the test can be used to explain the importance of human RT-related factor 33 in various diseases and to diagnose diseases in which human RT-related factor 33 plays a role.
  • the polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human reverse transcription-related factor 33 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human reverse transcription-related factor 33.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human RT-related factor 33 to inhibit endogenous human RT-related factor 33 activity.
  • a variant human RT-related factor 33 may be a shortened human RT-related factor 33 lacking a signaling functional domain, and although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human reverse transcription-related factor 33.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human retrovirus-related factor 33 into a cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding human reverse transcription-related factor 33 can be found in the existing literature (Sambrook, eta l.).
  • a recombinant polynucleotide encoding human reverse transcription-related factor 33 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human reverse transcription-related factor 33 raRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human reverse transcription-related factor 33 can be used for the diagnosis of diseases related to human reverse transcription-related factor 33.
  • the polynucleotide encoding human reverse transcription-related factor 33 can be used to detect the expression of human reverse transcription-related factor 33 or the abnormal expression of human reverse transcription-related factor 33 in a disease state.
  • the DNA sequence encoding human reverse transcription-related factor 33 can be used to hybridize biopsy specimens to determine the expression status of human reverse transcription-related factor 33.
  • Hybridization techniques include Southern blotting, Nor thern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a micro array (Mi croar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissue .
  • RNA-polymerase chain reaction (RT-PCR) using human reverse transcription-related factor 33-specific primers for in vitro amplification also The transcription product of human reverse transcription-related factor 33 can be detected.
  • Human RT-related factor 33 gene can also be used to diagnose human RT-related diseases.
  • Human RT-related factor 33 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human RT-related factor 33 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. This data can be found, for example, in V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions visible at the chromosomal level or detectable with cDNA sequence-based PCR Or translocation. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase Figure resolution and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
  • the polypeptide of the present invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human reverse transcription-related factor 33 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human RT-related factor 3 3 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, un facteur humain 33 associé à la transcription inverse, et un polynucleotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des dystrophies musculaires, des tumeurs malignes, de l'hémopathie, de l'infection par VIH, des maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucleotide codant pour le facteur humain 33 associé à la transcription inverse.
PCT/CN2001/000248 2000-03-02 2001-02-26 Nouveau polypeptide, facteur humain 33 associe a la transcription inverse, et polynucleotide codant pour ce polypeptide WO2001064867A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001246300A AU2001246300A1 (en) 2000-03-02 2001-02-26 A novel polypeptide, a human reverse transcription relative factor 33 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00111857.9 2000-03-02
CN 00111857 CN1311239A (zh) 2000-03-02 2000-03-02 一种新的多肽——人逆转录相关因子33和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001064867A1 true WO2001064867A1 (fr) 2001-09-07

Family

ID=4581753

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000248 WO2001064867A1 (fr) 2000-03-02 2001-02-26 Nouveau polypeptide, facteur humain 33 associe a la transcription inverse, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1311239A (fr)
AU (1) AU2001246300A1 (fr)
WO (1) WO2001064867A1 (fr)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 14 December 1999 (1999-12-14), accession no. EMBL Database accession no. AL034384 *
DATABASE GENBANK [online] 21 December 1999 (1999-12-21), Database accession no. AC006017 *
DATABASE GENBANK [online] 23 November 1999 (1999-11-23), accession no. EMBL Database accession no. AL031319 *
DATABASE GENBANK [online] 23 November 1999 (1999-11-23), accession no. EMBL Database accession no. AL049743 *

Also Published As

Publication number Publication date
AU2001246300A1 (en) 2001-09-12
CN1311239A (zh) 2001-09-05

Similar Documents

Publication Publication Date Title
WO2001064892A1 (fr) Nouveau polypeptide, threonyl-arnt synthetase humaine 14, et polynucleotide codant pour ce polypeptide
WO2001068688A1 (fr) Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide
WO2001068684A1 (fr) Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide
WO2001048223A1 (fr) Nouveau polypeptide, ubiquitine-protease 18, et polynucleotide codant pour ce polypeptide
WO2001064867A1 (fr) Nouveau polypeptide, facteur humain 33 associe a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001064733A1 (fr) Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001053499A1 (fr) Nouveau polypeptide, proteine nucleolaire humaine 18 de proliferation cellulaire, et polynucleotide codant pour ce polypeptide
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001075000A2 (fr) Nouveau polypeptide, facteur humain 15 lié á la rétrotransposition, et polynucléotide codant pour ce polypeptide
WO2001081592A1 (fr) Nouveau polypeptide, proteine humaine 11 contenant un fragment de sequence particulier d'une signal peptidase i, et polynucleotide codant pour ce polypeptide
WO2001064722A1 (fr) Nouveau polypeptide, proteine humaine 9 associee a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001073061A1 (fr) Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide
WO2001081537A2 (fr) Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide
WO2001073008A1 (fr) Nouveau polypeptide, nucleoproteine humaine 13 associee aux tumeurs, et polynucleotide codant pour ce polypeptide
WO2001075124A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 9, et polynucleotide codant pour ce polypeptide
WO2001055419A1 (fr) Nouveau polypeptide, site de liaison 27 d'arn s1, et polynucleotide codant pour ce polypeptide
WO2001074891A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 17, et polynucleotide codant pour ce polypeptide
WO2001048198A1 (fr) Nouveau polypeptide, proteine ribosomale s4 8, et polynucleotide codant pour ce polypeptide
WO2001074892A1 (fr) Nouveau polypeptide, proteine antigene prostatique specifique membranaire 12, et polynucleotide codant pour ce polypeptide
WO2001081395A1 (fr) Nouveau polypeptide, adn topo-isomerase i-15, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP