WO2001068688A1 - Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001068688A1
WO2001068688A1 PCT/CN2001/000279 CN0100279W WO0168688A1 WO 2001068688 A1 WO2001068688 A1 WO 2001068688A1 CN 0100279 W CN0100279 W CN 0100279W WO 0168688 A1 WO0168688 A1 WO 0168688A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
protein kinase
human protein
sequence
Prior art date
Application number
PCT/CN2001/000279
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU46315/01A priority Critical patent/AU4631501A/en
Publication of WO2001068688A1 publication Critical patent/WO2001068688A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human protein kinase TAK1-27, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • Cell communication refers to the transmission of information from one cell to another through a medium to produce a corresponding response. Intercellular communication is necessary for the occurrence of multicellular organisms and the construction of tissues, to coordinate cell functions, and to control cell growth and division.
  • the process of cell-to-cell communication by secreting chemical signals includes 6 basic steps: (1) synthesis of chemical signal molecules; (2) release of chemical signal molecules by signal cells; (3) transport of signal molecules to target cells; (4) ) Recognition of signal molecules, usually through specific receptor recognition; (5) Transmembrane transmission of information; (6) Biological effects.
  • the cell's chemical signal molecules can be divided into two types: lipophilic and hydrophilic: (1) lipophilic signal molecules, mainly represented by steroid hormones and thyroxine, can enter the cell through the plasma membrane of the cell, and the cytoplasm or nucleus The receptors combine to form complexes; (2) Hydrophilic signal molecules, including neurotransmitters, growth factors, local chemical transmitters, and most hormones, cannot pass through the plasma membrane of target cells, but communicate with cell surface receptors Combined, and through the signal conversion mechanism, a second messenger is generated in the cell to transmit information across the membrane.
  • lipophilic signal molecules mainly represented by steroid hormones and thyroxine
  • the receptors combine to form complexes
  • Hydrophilic signal molecules including neurotransmitters, growth factors, local chemical transmitters, and most hormones, cannot pass through the plasma membrane of target cells, but communicate with cell surface receptors Combined, and through the signal conversion mechanism, a second messenger is generated in the cell to transmit information across the membrane.
  • TA 1 is a mouse protein kinase. It participates in and regulates the transcription of transforming growth factor (TGF- ⁇ ) through phosphorylation of signaling molecules. Further research showed that the protein kinase activity of TAK1 is activated by TGF- ⁇ and bone morphogenetic protein. This indicates that ⁇ functions as a regulator of TGF- ⁇ superfamily member signaling pathways [yoko Yamaguch i, Kyoko Shiakabe et. A 1., Science 270 (5244), 2008-2011 (1995)] contradict
  • the TAKl gene encodes a 579 amino acid protein.
  • the basic sequence of the TAK1 protein contains an N-terminal domain with a protein kinase catalytic domain and a C-terminal domain of approximately 300 amino acid residues.
  • the N-terminal catalytic domain of the TAK1 protein contains a consensus sequence that corresponds to the subdomains of the protein kinases RAF-1 and MEKK1. [S.. Hanks, AM Quinn, T. Hunter, Science241, 42 (1988)]
  • the TA 1 protein's N-terminal catalytic domain is 30 ° / »consistent with the catalytic domains of RAF-1 and MEKK1 [TI Bonner et al., Nucleic Acids Res. 14, 1009 (1986)] [CA Lange-Car ter, CM
  • TAK1 protein has no obvious similarity with other protein kinases. Eleven of the 22 amino acids at the N-terminus of the TAK1 protein are serine or threonine residues after phosphorylation, which may play a catalytic role in recruiting signal molecules or participating in limiting kinase activity.
  • the human gene of the present invention has 50% identity and 71% similarity at the protein level with members of the protein kinase TAK1 family. And the protein sequences of both contain characteristic repeats of the protein kinase TAII family. Based on the above points, the new gene of the present invention is considered to be a new member of the human protein kinase TAK1 family, and is named human protein kinase TAK1-27. It is inferred that it is similar to human protein kinase TAK1, is a member of the human protein kinase family, and has similar biological functions.
  • the human protein kinase TAK1-27 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes
  • the human protein kinase TAK1-27 protein in particular, identifies the amino acid sequence of this protein. Isolation of the novel human protein kinase TAK1-27 protein-coding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so isolating its coding DNA is important. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human protein kinase TAII-27.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human protein kinase TAK1-27.
  • Another object of the present invention is to provide a method for producing human protein kinase TAK1-27.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of human protein kinase TAK1-27.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 567-1294 in SEQ ID NO: 1; and (b) having a sequence of 1- 2285-bit sequence.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the human protein kinase TAII-27 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human protein kinase TAII-27 protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or The amount or biological activity of a polypeptide of the invention in a sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human protein kinase TAK1-27.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with the human protein kinase TAK 1-27, causes the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds the human protein kinase TAK 1-27.
  • Antagonist refers to a molecule that, when combined with human protein kinase TAII-27, can block or regulate the biological or immunological activity of human protein kinase TAK 1-27.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human protein kinase TAK 1-27.
  • Regular refers to a change in the function of human protein kinase TAII-27, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human protein kinase TAK 1-27 .
  • substantially pure ' means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can purify human protein kinase TAII-27 using standard protein purification techniques. Basically Pure Human protein kinase TAK1-27 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human protein kinase TAK1- 27 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southerr! Imprinting or Northern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 C 1 us ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence ⁇ 1 and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645) 0 "similarity" refers to the amino acid sequence The degree of identical or conservative substitutions of amino acid residues at corresponding positions when aligning between them.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? , It can specifically bind to the epitope of human protein kinase TAII-27.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it exists in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human protein kinase TAII-27 means that human protein kinase TAII-27 is substantially free of other proteins, lipids, sugars, or other substances that are naturally associated with it.
  • Those skilled in the art can purify the human protein kinase ⁇ 1-27 using standard protein purification techniques. Substantially pure peptides on a non-reducing polyacrylamide gel can produce a single main band. The purity of human protein kinase ⁇ -27 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human protein kinase TAK1-27, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • Polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of the human protein kinase TAII-27.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human protein kinase TAII-27 of the present invention.
  • Fragments, derivatives or The analog may be: (I) a type in which one or more amino acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be inherited Codon-encoded; or (II) one in which a group on one or more amino acid residues is substituted with another group to include a substituent; or (III) one in which a mature polypeptide is linked to another A compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence (such as a leader sequence or a secretory sequence or a sequence used to fuse additional amino acid sequences into a mature polypeptide) Purify the sequence of this polypeptide or protease sequence) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a c DNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2285 bases, and its open reading frame 566-1 294 encodes 242 amino acids.
  • this polypeptide has 50% homology with human protein kinase TAK 1, and it can be deduced that the human protein kinase TAII-27 has similar structure and function to human protein kinase TAK 1.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • the DNA form includes C DNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of S EQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); and Non-coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% FicolI, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, more preferably 97% or more hybridization occurs.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human protein kinase TAII-27.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human protein kinase TAK1-27 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the Huan-chain DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Building cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Labora tory Manua 1, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of the transcript of human protein kinase TAK1-27; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is the same as any part of the polynucleotide of the present invention.
  • the source has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human protein kinase TAII-27 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method of applying a PCR technique to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human protein to stimulate the TAII-27 coding sequence, and the recombinant technology to produce the polypeptide of the present invention. method.
  • a polynucleotide sequence encoding the human protein kinase TAK1-27 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human protein kinase TAK1-27 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human protein kinase TAII-27 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as insect cells such as Fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human protein kinase TAK1- 27 (Science, 1984; 224: 1431). Generally there are the following steps: (1). Use the polynucleotide (or variant) encoding the human human protein kinase TAK1- 27 of the present invention, or transform or transduce a suitable recombinant expression vector containing the polynucleotide Host cell (2) culturing host cells in a suitable medium;
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • Fig. 1 is a comparison diagram of the amino acid sequence homology of human protein kinase TAK1-27 and human protein kinase TAII of the present invention.
  • the upper sequence is human protein kinase TAK1-27
  • the lower sequence is human protein kinase TAK1.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human protein kinase TAII-27.
  • 27KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • poly (A) mRNA is c DN A by reverse transcription. Directly insert the c DN A fragment into pBSK (+) using a Sma rtc DN A cloning kit (purchased from C 1 on tech) DH5a was transformed into the multiple cloning site of the vector (product of Clontech), and the bacteria formed a cDNA library. Dye termin te cycle reaction ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones.
  • the sequence of the human protein kinase TAK1-27 of the present invention and the protein sequence encoded by the same were performed using the Blast program (Basiclocal Alignment search tool) [Al tsc ul, SF et a 1. J. Mol. Biol. 1990; 215: 403 -10], perform homology search in databases such as Genbank and Swissport.
  • the gene with the highest homology to the human protein kinase TAII-27 of the present invention is a known human protein kinase TAII, and the accession number encoded by the protein in Genbank is AL050393.
  • the results of protein homology are shown in Figure 1. The two are highly homologous with 50% identity; 71% similarity.
  • Example 3 Cloning of a gene encoding human protein kinase TAK1-27 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.
  • PCR amplification was performed with the following primers:
  • Primerl 5'- GGAATTAAGGTGCTGTGGTCTCAA-3 '(SEQ ID NO: 3)
  • Primer2 5 "-TTTTGATCCATGTTTAATGAAAAA —3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 mmol / L KC1, 10 mmol / L Tris-Cl, (pH 8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a 50 ⁇ 1 reaction volume, 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-2285bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human protein kinase TAKl-27 gene expression:
  • RNA was prepared by random primer method using ⁇ - "P dATP.
  • the DNA probe used was the PCR amplified human protein kinase TAK1-27 coding region sequence (566bp to 1294bp) shown in Fig. 1.
  • Primer3 5'- CCCCATATGATGGTTCAGCTGATTGCACCTTTA -3 '(Seq ID No: 5)
  • Primer4 5'- CATGGATCCTTAGGACGAGCCCTGCCTCTTCTGTG -3, (Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the pBS-0363b02 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ i contains 10 pg of pBS-0363b02 plasmid, primers Primer-3 and Primer-4, and 1 J is lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on an LB plate containing kanamycin (final concentration 30yg / ml), positive clones were screened by colony PCR method and sequenced. A positive clone (pET-0363b02) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In a LB liquid medium containing kanamycin (final concentration 30 g / ml), the host strain BL21 (pET-0363b02) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added.
  • Protein A-Sepharose was used to isolate total IgG from antibody-positive home-immunized serum.
  • the peptide was bound to a cyanogen bromide-activated SepharosMB column and the anti-peptide antibody was separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human protein kinase TAK1-27.
  • Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select suitable oligonucleotide fragments from the polynucleotide SEQ ID NO: of the present invention as hybridization probes, and to use a membrane hybridization method to identify whether some tissues contain the polynucleotide sequence of the present invention. Or a homologous polynucleotide sequence thereof.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps Off.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt) :
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Gene microarray or DNA microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After being stripped, the slides were fixed to fix the DNA on the glass slides to prepare chips. The specific method steps have been variously reported in the literature. The post-spotting processing steps of this embodiment are:
  • Total mRNA was extracted from normal liver and liver cancer by one-step method, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5- Amino- propargy l-2'-deoxyur idine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech company) labeled mRNA of normal liver tissue, using a fluorescent reagent Cy5dUTP (5-Amino-propargy 1-2 '-deoxyur idine 5'-triphate coupled to Cy5 fluorescent Dye, purchased from Aniersham Phamacia Biotech Co., Ltd.), labeled with Crescent stem cancer tissue mRNA, and the probe was prepared after purification.
  • Cy3dUTP 5- Amino- propargy l-2'-deoxyur idine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech company
  • Cy5dUTP (5
  • the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • a scanner purchased from the United States-General Scanning
  • the scanned image was analyzed by Imagene software (Biodiscovery), and the Cy3 / Cy5 ratio of each point was calculated. The points with the ratio less than 0.5 and greater than 2 were scanned. It is considered to be a gene whose expression is different.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • TAK1 as a protein kinase, participates in and regulates transformation by phosphorylating signaling molecules Transcription of growth beta factor (TGF-beta). Further research showed that the protein kinase activity of TAK 1 is activated by TGF- ⁇ and bone morphogenetic protein. This shows that TAK 1 functions as a regulatory protein of the TGF- (3 superfamily member signaling pathway. TAK 1 mRNA is present in almost all tissues and organs, especially in the thymus and brain, and is relatively abundant in liver. less.
  • the polypeptide of the present invention and members of the protein kinase TAK 1 family are homologous proteins, containing characteristic sequences of the protein kinase TAK 1 family, and have similar biological functions. It regulates the signaling pathways of members of the TG F- ⁇ superfamily in the body, and its abnormal expression can cause abnormalities or errors in cell communication connections, physiological and pathological functions, and other related diseases.
  • the abnormal expression of the human protein kinase TAK 1-2 7 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, growth and development disorders, inflammation, and immune diseases. These diseases include but not limited to:
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defects, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness, growth and development disorders: mental illness Stunting, brain development disorders, skin, fat and muscular dysplasia, bone and joint cyanosis, various metabolic defects, stunting, dwarfism, Cushing syndrome, sexual developmental retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • the abnormal expression of the human protein kinase TAK 1 -2 7 of the present invention will also produce certain hereditary, hematological diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc.
  • the invention also provides screening compounds to identify improving (agonist) or suppressing (antagonist) human protein
  • the method of enzyme agent 7-2 ⁇ Agonists enhance biological functions such as human protein kinase TAK1-27 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human protein kinase TAII-27 can be cultured together with labeled human protein kinase TAK1-27 in the presence of drugs. The ability of the drug to enhance or suppress this interaction is then determined.
  • Antagonists of human protein kinase TAK1-27 include antibodies, compounds, receptor deletions, and the like that have been screened.
  • the antagonist of human protein kinase ⁇ 1-27 can bind to human protein kinase TAK1-27 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human protein kinase TAK1-27 When screening compounds as antagonists, human protein kinase TAK1-27 can be added to bioanalytical assays to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human protein kinase TAII-27 and its receptor . Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human protein kinase TAK1-27 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human protein kinase ⁇ 1- 27 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human protein kinase ⁇ 1- 27 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human protein kinase TAK1-27 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
  • Techniques for preparing monoclonal antibodies to human protein kinase TAK1-27 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridoma technology, EBV -Hybridoma technology, etc.
  • Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against human protein kinase TAK1-27.
  • Antibodies to human protein kinase TAK1-27 can be used in immunohistochemistry to detect human protein kinase TAK1-27 in biopsy specimens.
  • Monoclonal antibodies that bind to human protein kinase TAK1-27 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method The method is used to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • Human protein kinase Human protein kinase
  • TA 1-27 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human protein kinase TAII-27 positive cells .
  • the antibodies in the present invention can be used to treat or prevent diseases related to the human protein kinase ⁇ -27.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human protein kinase ⁇ -27.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human protein kinase TAK1-27.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the levels of human protein kinase ⁇ 1-27 detected in the test can be used to explain the importance of human protein kinase ⁇ -27 in various diseases and to diagnose diseases in which human protein kinase ⁇ -27 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human protein kinase TAII-27 is also useful for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human protein kinase TAK1- 27.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express the mutated human protein kinase TAII-27 to inhibit endogenous human protein kinase TAII-27 activity.
  • a mutated human protein kinase ⁇ 1-27 may be a shortened human protein kinase TKII-27, which lacks a signaling functional domain.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human protein kinase TAK1-27.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer polynucleotides encoding human protein kinase TAK1- 27 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding the human protein kinase TAK1-27 can be found in the existing literature (Sambrook, et al.).
  • the polynucleotide encoding human protein kinase TAK1-27 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human protein kinase TAK1-27 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically breaks down specific RNAs. Its mechanism of action is that the ribozyme molecule specifically hybridizes to a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human protein kinase TAK1-27 can be used for the diagnosis of diseases related to human protein kinase TAK1-27.
  • the polynucleotide encoding human protein kinase TAII-27 can be used to detect the expression of human protein kinase TAK1-27 or the abnormal expression of human protein kinase TAII-27 in a disease state.
  • the DNA sequence encoding human protein kinase TAK1-27 can be used to hybridize biopsy specimens to determine the expression of human protein kinase TAII-27.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a DNA chip (also called a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
  • a microarray Microarray
  • a DNA chip also called a "gene chip”
  • Human protein kinase TAK1-27 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human protein kinase TAK1-27 transcripts.
  • Human protein kinase TAII-27 mutant forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human protein kinase TAIII-27 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect the expression of proteins, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • sublocalization can be achieved by a similar method using a set of fragments from a specific chromosome or a large number of genomic clones.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human protein kinase ⁇ 1-27 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human protein kinase TAK1-27 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine kinase humaine TAK1-27, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de tumeurs malignes, de l'hémopathie, des troubles du développement, de l'infection par VIH, des maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine kinase humaine TAK1-27.
PCT/CN2001/000279 2000-03-02 2001-02-26 Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide WO2001068688A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU46315/01A AU4631501A (en) 2000-03-02 2001-02-26 A novel polypeptide, a human protein kinase tak1-27 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00111810.2 2000-03-02
CN 00111810 CN1311312A (zh) 2000-03-02 2000-03-02 一种新的多肽——人蛋白激酶tak1－27和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001068688A1 true WO2001068688A1 (fr) 2001-09-20

Family

ID=4581706

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000279 WO2001068688A1 (fr) 2000-03-02 2001-02-26 Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1311312A (fr)
AU (1) AU4631501A (fr)
WO (1) WO2001068688A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006023210A2 (fr) * 2004-07-23 2006-03-02 Aveo Pharmaceuticals, Inc. Gene gp132: techniques et compositions de traitement du cancer

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109999184A (zh) * 2019-03-15 2019-07-12 南京恒健文化传播有限公司 Tak1蛋白在制备食管癌预后评估试剂或试剂盒中的应用

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 21 December 1999 (1999-12-21), Database accession no. AC004931 *
DNA RES., vol. 1, no. 1, 1994, pages 27 - 35 *
GENOME RES., vol. 8, no. 11, November 1998 (1998-11-01), pages 1097 - 1108 *
GENOMICS, vol. 60, no. 3, 15 September 1999 (1999-09-15), pages 295 - 308 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006023210A2 (fr) * 2004-07-23 2006-03-02 Aveo Pharmaceuticals, Inc. Gene gp132: techniques et compositions de traitement du cancer
WO2006023210A3 (fr) * 2004-07-23 2006-09-14 Aveo Pharmaceuticals Inc Gene gp132: techniques et compositions de traitement du cancer

Also Published As

Publication number Publication date
AU4631501A (en) 2001-09-24
CN1311312A (zh) 2001-09-05

Similar Documents

Publication Publication Date Title
WO2002026973A1 (fr) Nouveau polypeptide, une ribonucleoproteine nucleaire heterogene humaine 32.01, et un polynucleotide codant ce polypeptide
WO2001068688A1 (fr) Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide
WO2001068684A1 (fr) Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001075023A2 (fr) Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001064727A1 (fr) Nouveau polypeptide, adenosinate cyclase soluble 25 de souris, et polynucleotide codant pour ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001073061A1 (fr) Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide
WO2001081592A1 (fr) Nouveau polypeptide, proteine humaine 11 contenant un fragment de sequence particulier d'une signal peptidase i, et polynucleotide codant pour ce polypeptide
WO2001079491A1 (fr) Nouveau polypeptide, canal ionique humain 12 pour le chlore, et polynucleotide codant pour ce polypeptide
WO2001048198A1 (fr) Nouveau polypeptide, proteine ribosomale s4 8, et polynucleotide codant pour ce polypeptide
WO2001068876A1 (fr) Nouveau polypeptide, proteine humaine 16 a multiples liaisons avec la dyneine atpase beta, et polynucleotide codant pour ce polypeptide
WO2001064867A1 (fr) Nouveau polypeptide, facteur humain 33 associe a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001055419A1 (fr) Nouveau polypeptide, site de liaison 27 d'arn s1, et polynucleotide codant pour ce polypeptide
WO2001081393A1 (fr) Nouveau polypeptide, proteine kinase ysk1 humaine 20, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2001081571A1 (fr) Nouveau polypeptide, proteine humaine 11 contenant un site de conservation d'un recepteur lie a une proteine g, et polynucleotide codant pour ce polypeptide
WO2001068878A1 (fr) Nouveau polypeptide, proteine de transport c 28 a orientation de membrane fixe, et polynucleotide codant pour ce polypeptide
WO2001074996A2 (fr) Nouveau polypeptide, c. elegans 52 humain, et polynucléotide codant pour ce polypeptide
WO2001079428A2 (fr) Nouveau polypeptide, proteine humaine de reparation 8.9 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP