WO2001081571A1 - Nouveau polypeptide, proteine humaine 11 contenant un site de conservation d'un recepteur lie a une proteine g, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine 11 contenant un site de conservation d'un recepteur lie a une proteine g, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001081571A1
WO2001081571A1 PCT/CN2001/000594 CN0100594W WO0181571A1 WO 2001081571 A1 WO2001081571 A1 WO 2001081571A1 CN 0100594 W CN0100594 W CN 0100594W WO 0181571 A1 WO0181571 A1 WO 0181571A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
polypeptide
polynucleotide
conserved region
human
Prior art date
Application number
PCT/CN2001/000594
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU70435/01A priority Critical patent/AU7043501A/en
Publication of WO2001081571A1 publication Critical patent/WO2001081571A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/723—G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH receptor
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human protein containing a G protein-coupled receptor conserved region, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique
  • Hydrophilic signal molecules include neurotransmitters, growth factors, cytokines, local chemical transmitters, and most hormones. They cannot pass through the plasma membrane and can only bind to receptors on the cell surface to form ligand-receptor complexes for signaling. divert. According to the mechanism of signal transduction and the types of receptor proteins, cell surface receptors can be divided into three types: (1) ion channel-coupled receptors; (2) ligase surface receptors; (3) with G proteins Coupling receptor.
  • G protein-coupled receptors include many hormone receptors, neurotransmitter receptors, odorant molecular receptors, and light receptors. Their structures are very similar, and they each have a peptide surface receptor that spans the plasma membrane seven times. The N-terminus is extracellular and is usually glycosylated. The C-terminus is located inside the membrane and is usually phosphorylated. Most receptors lack signal peptides. The most conserved regions are located in the transmembrane region and the first two cyclic structures within the membrane that connect the transmembrane chains.
  • the binding of the ligand to the receptor changes the conformation of the receptor, so that it binds to the trimer of GTP-binding regulatory protein (G protein) on the inner side of the plasma membrane, and together activates the target protein (enzyme or ion channel) on the plasma membrane. ). It can be seen that the ligand receptor complex acts on the effector indirectly through the G protein. Ion channel Permeability of enzymes, enzymes affect cell behavior by affecting intracellular substrates and other proteins.
  • the polypeptide of the invention contains a conserved domain of a G protein-coupled receptor. Therefore, it is considered to be a G protein-coupled receptor with similar biological functions.
  • the present invention is named human protein 1 containing a conserved region of the G protein-coupled receptor.
  • the human protein 1 1 containing the conserved region of the G protein-coupled receptor plays an important role in important functions in the body, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there is always a need to identify more participants in the field. In these processes, the human protein 1 1 containing a conserved region of the G protein-coupled receptor is specifically identified, especially the amino acid sequence of this protein.
  • the newcomer's isolation of the protein 1 1 containing the conserved region of the G protein-coupled receptor also provides a basis for the study to determine the role of the protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human protein 1 1 containing a conserved region of a G protein-coupled receptor.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a human protein 1 1 containing a conserved region of a G protein-coupled receptor.
  • Another object of the present invention is to provide a method for producing human protein 1 1 containing a conserved region of a G protein-coupled receptor.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, namely a human protein 1 1 containing a conserved region of a G protein-coupled receptor.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, which are proteins 1 1 containing a conserved region of the G protein coupling receptor.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with a protein 1 1 abnormality containing a conserved region of a G protein-coupled receptor in human.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID D0: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 122-412 in SEQ ID NO: 1; and (b) a sequence having 1-3090 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening a compound that mimics, activates, antagonizes, or inhibits the protein 11 protein activity of a human protein containing a conserved region of a G protein-coupled receptor, which comprises using the polypeptide of the present invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of protein 1 1 in a human G-containing coupled receptor-conserved region in vitro, which comprises detecting the polypeptide or a polynucleotide encoding the same in a biological sample. A mutation in a sequence, or the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to polypeptides and / or polynucleotides of the present invention prepared for use in the treatment of cancer, developmental or immune diseases, or other diseases caused by abnormal expression of protein 1 1 in humans containing a conserved region of the G protein-coupled receptor. Use of drugs.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, where substitutions Amino acids have similar structural or chemical properties as the original amino acids, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with a human protein 1 1 containing a conserved region of the G protein-coupled receptor, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to a human G-containing protein-containing conserved region of a protein 1 1 molecule.
  • Antagonist refers to a protein that blocks or regulates a human G protein-containing receptor conserved region when it binds to the protein 1 1 A biologically or immunologically active molecule.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to a human protein 1-containing conserved region of a G protein-coupled receptor.
  • Regular refers to a change in the function of human protein 1 containing a conserved region of a G protein-coupled receptor, including an increase or decrease in protein activity, a change in binding properties, and a protein of a human G protein-contained receptor-conserved region 1 1 of any other biological, functional or immune change.
  • substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can use standard protein purification techniques to purify human proteins containing a conserved region of the G protein-coupled receptor 11.
  • a substantially pure human protein containing a conserved region of the G protein-coupled receptor 1 1 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human protein 1 1 polypeptide containing a conserved region of the G protein-coupled receptor can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be achieved by hybridization under conditions of reduced stringency (Sou t he rn blot or Nor t he rn Blot, etc.) to detect.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences.
  • the percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.).
  • the MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P.M. Sharp (1988) Gene 73: 237-244).
  • the Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein J., (1990) Methods in emzumology 183: 625-645) relations
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
  • Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b ') 2 and F V, which specifically binds to an antigen containing human G protein-coupled receptor protein 11 conserved region determinants.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human protein 11 containing a conserved region of a G protein coupled receptor means that human protein 11 containing a conserved region of a G protein coupled receptor is substantially free of other proteins, lipids, Sugars or other substances.
  • Those skilled in the art can purify human proteins containing a conserved region of the G protein-coupled receptor 11 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human protein 11 polypeptide containing a conserved region of the G protein-coupled receptor can be analyzed by amino acid sequences.
  • the present invention provides a new polypeptide, a human protein 11 containing a conserved region of a G protein coupling receptor, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptides of the invention may be glycosylated, or they may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of human protein 11 containing a conserved region of the G protein-coupled receptor.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human protein G-containing receptor-containing conserved region of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ )
  • Such a type in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence such as a leader sequence or a secreted sequence or a sequence used to purify the
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains 3090 bases of polynucleotide sequence and its open reading frame (122-412) encodes 96 amino acids.
  • This polypeptide has the characteristic sequence of a human protein containing a conserved region of the G protein-coupled receptor, and it can be deduced that the human protein containing a conserved region of the G protein-coupled receptor is a protein having a human G protein-contained receptor region Structure and function represented.
  • the polynucleotide of the present invention may be in the form of DM or RNA.
  • DNA forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID D NO: 2 but different from the coding region sequence shown in SEQ ID D NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 xSSC, 0.1% SDS, 60 ° C; or (2 ) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only in two sequences Between Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human proteins containing a conserved region of the G protein-coupled receptor.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence of the present invention encoding human protein 11 containing a conserved region of the G protein-coupled receptor can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (DDNA-DNA or DM-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determination of human transcripts of protein 11 containing a conserved region of the G protein-coupled receptor (4) Detecting protein products of gene expression through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 3Q nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the detection of the protein product of the protein 11 gene containing the conserved region of the G protein-coupled receptor can be performed by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait.
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait.
  • a method using DNA technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell generated by genetic engineering using the vector of the present invention or directly using a human G protein-containing receptor conserved region of the protein 11 coding sequence, and produced by recombinant technology A method of a polypeptide according to the invention.
  • a polynucleotide sequence encoding a human protein 11 containing a conserved region of a G protein-coupled receptor can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human 11 containing a conserved region of the G protein-coupled receptor and suitable transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be effectively linked to an appropriate promoter in an expression vector, To guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human protein 1 1 containing a conserved region of a G protein-coupled receptor or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute the polynucleotide or the recombinant vector.
  • Genetically engineered host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes s melanoma cells, etc. .
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. Alternatively, M g C l 2 is used.
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human protein G 1 containing a conserved region of a protein-coupled receptor (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • FIG. 1 is a comparison diagram of amino acid sequence homology of a protein of the G protein-coupled receptor-conserved region of the inventor of 43 amino acids in 51-93 and a domain of the protein of the human G-protein-coupled receptor-conserved region.
  • the upper sequence is human protein 1 1 containing the conserved region of the G protein-coupled receptor, and the lower sequence is the human domain protein containing the G protein-coupled receptor-conserved region.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of an isolated human protein 1 1 containing a conserved region of the G protein-coupled receptor.
  • lKDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using the Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 ⁇ fragment was inserted into the multiple cloning site of pBSK (+) vector (Clontech), and transformed into DH5 cc. The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0368 e 06 was new DNA.
  • a series of primers were synthesized to perform bidirectional determination of the inserted c DNA fragments contained in the clone.
  • the sequence of the human protein G containing the conserved region of the G protein-coupled receptor of the present invention and its encoded protein sequence ⁇ 'J were used with the prof i le scan program (Bas icloca 1 Alignment search tool) in GCG [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], domain analysis was performed in databases such as prosite.
  • the protein 11 of the human G protein-coupled receptor-conserved region of the present invention is homologous with the protein of the human region containing the G-protein-coupled receptor conserved region at 51-93. The homology results are shown in FIG. It is 0.09 and the score is 4.05; the threshold is 3.98.
  • Example 3 Cloning of a gene encoding human protein 11 containing a conserved region of the G protein-coupled receptor by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- GAAGAGAAAGAAGGCAGTAAGAAG -3 '(SEQ ID NO: 3)
  • Primer2 5'- TTTTATATTTCCCCGTTTTTTATT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l of KC1 and 10 ol / L Tris- in a reaction volume of 50 ⁇ 1
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC- 5 x Denhardt, s solution and 200 g / ml salmon sperm DNA. After hybridization, the filters were placed in 1 x SSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human protein 11 containing a conserved region of the G protein-coupled receptor
  • Primer3 5'- CATGCTAGCATGCATGCAAAGATCTTTCCAAGA -3 '(Seq ID No: 5)
  • Primer4 5'- CCCGAGCTCCTACAGGCACCAGCCACAGTGCCT -3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Nhel and Sacl digestion sites, respectively, followed by the coding sequences of the 5 'and 3, ends of the target gene, respectively.
  • Nhel and Sacl restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET 28b (+) (Novagen, Cat. No. 69865.3).
  • the PCR reaction was performed using the pBS-0368e06 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of pBS-0368e06 plasmid, Primer-3 and Primer-4 were included in a total volume of 50 ⁇ l, and 1 j was lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 Loop. Nhel and Sacl were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into the colibacillus DH5 ⁇ by the calcium chloride method.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human 11 specific peptides containing the conserved region of the G protein-coupled receptor:
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Se P ha rOS e4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to protein 11 of human G protein-containing receptor-conserved region.
  • Example 7 Use of a polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Sou thern blotting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID D NO: 1 (41 Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41 Nt) :
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And Helle, RA, Schema, M. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • (A) spotting A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ ! . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from normal liver and liver cancer in one step, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5- Amino- propargyl-2'-deoxyuridine 5) was separately reverse-transcribed. '-triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of normal liver tissue.
  • Cy5dUTP (5-Amino-propargy 1-2' -deoxyur i dine 5'-tr iphate coupled to Cy5 fluorescent Dye (purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification. For specific steps and methods, see:
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Hydrophilic signal molecules such as neurotransmitters, growth factors, cytokines, local chemical transmitters and most hormones cannot pass through the plasma membrane and can only combine with receptors on the cell surface to form ligand-receptor complexes for signal transduction .
  • G protein-coupled receptors are an important cell surface receptor.
  • G protein-coupled receptors include many hormone receptors, neurotransmitter receptors, odorant molecular receptors, and light receptors. They can further regulate cell growth, division, death, differentiation to form tissues, and various life processes.
  • G protein-coupled receptors with specific conserved sequences are required to form their active mot i f.
  • the abnormal expression of the specific G protein-coupled receptor mot if will cause the function of the polypeptide containing the mot if of the present invention to be abnormal, resulting in certain hormone receptors or neurotransmitter receptors or other receptors.
  • Abnormal regulatory functions downstream of the body affect cell growth, division, death, differentiation to form tissues, and multiple life processes, and produce related diseases.
  • the abnormal expression of the protein 11 containing the conserved region of the G protein-coupled receptor of the present invention will cause various diseases, especially various tumors, embryonic developmental disorders, and disorders of growth and development. These diseases include, but are not Limited to:
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome
  • Sexual retardation Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • Abnormal expression of the protein 1 1 containing the conserved region of the G protein-coupled receptor of the present invention will also cause certain genetic and hematological diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human proteins containing a conserved region of the G protein-coupled receptor 1 1.
  • Agonists increase human proteins containing G protein-coupled receptor-conserved regions. They stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing a protein 1 1 containing a conserved region of a human G protein coupled receptor can be combined with a labeled protein 1 1 containing a conserved region of a human G protein coupled receptor. to cultivate. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human protein 1 1 containing a conserved region of the G protein-coupled receptor include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human protein 1 1 containing a conserved region of a G protein-coupled receptor can bind to human protein 1 1 containing a conserved region of a G protein-coupled receptor and eliminate its function, or inhibit the production of the polypeptide, or The active site binding of the polypeptide prevents the polypeptide from performing a biological function.
  • human proteins containing the G protein-coupled receptor-conserved region of protein 1 1 can be added to the bioanalytical assay. The effect of their receptor interactions to determine whether a compound is an antagonist.
  • Receptor deletions and analogues that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human proteins containing a conserved region of the G protein-coupled receptor can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase.
  • human proteins containing a conserved region of the G protein-coupled receptor should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the present invention also provides an antibody against a human protein 1 1 epitope containing a conserved region of a G protein-coupled receptor.
  • These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fa b fragments and Fab Expression library generated fragments.
  • Polyclonal antibodies can be produced by immunizing animals (such as rabbits, mice, rats, etc.) with a protein 11 'containing a conserved region of the G protein-coupled receptor directly.
  • Various adjuvants can be used to enhance the immune response. , Including but not limited to Freund's adjuvant.
  • Techniques for preparing human monoclonal antibodies containing the protein 11 conserved region of the G protein-coupled receptor include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta- Cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human protein 11 containing a conserved region of the G protein coupled receptor.
  • Antibodies against protein 11 containing the conserved region of the G protein-coupled receptor in humans can be used in immunohistochemical techniques to detect human protein 11 containing the conserved region of the G protein-coupled receptor in biopsy specimens.
  • Monoclonal antibodies that bind to human protein 11 containing a conserved region of the G protein-coupled receptor can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human proteins containing G protein-coupled receptor-conserved regions 11 High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human G protein-containing coupled receptors. Conservation Regions of protein 11 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human protein 11 containing a conserved region of the G protein-coupled receptor.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human protein 11 containing a conserved region of the G protein-coupled receptor.
  • the present invention also relates to a diagnostic test method for quantitatively and locally detecting a protein 11 level in a human protein containing a conserved region of a G protein-coupled receptor.
  • tests are well known in the art and include FISH and radioimmunoassays.
  • the level of protein 11 in the conserved region of human G protein-coupled receptor detected in the test can be used to explain the importance of protein 11 in the conserved region of human G protein-coupled receptor in various diseases and to diagnose humans. Diseases in which protein 11 containing a conserved region of the G protein-coupled receptor plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human protein 11 containing a conserved region of the G protein-coupled receptor can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat humans with protein 11 containing a conserved region of the G protein-coupled receptor Abnormal cell proliferation, development, or metabolism caused by no expression or abnormal / inactive expression.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human G-protein-coupled receptor-conserved regions of protein 11 to suppress endogenous human G-protein-coupled receptor-conserved regions of protein 11 active.
  • a variant of human 11 protein containing a conserved region of a G protein-coupled receptor may be shortened and lacking a signal transduction domain of human protein 11 containing a conserved region of a G protein-coupled receptor. Substrate binding, but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of protein 11 in the conserved region of the G protein-coupled receptor.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc.
  • a polynucleotide encoding human protein 11 containing a conserved region of the G protein-coupled receptor can be used to transfer a polynucleotide encoding human protein 11 containing a conserved region of the G protein-coupled receptor to a cell Inside.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human protein 11 containing a conserved region of the G protein-coupled receptor can be found in the literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human protein 11 containing a conserved region of the G protein-coupled receptor can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides that inhibit human protein 11 mRNA containing a conserved region of the G protein-coupled receptor are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA to perform endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding human protein 11 containing a conserved region of the G protein-coupled receptor can be used for diagnosis of diseases related to human protein 11 containing a conserved region of the G protein-coupled receptor.
  • Polynucleotides encoding human protein 11 containing a conserved region of a G protein-coupled receptor can be used to detect the expression of human protein 11 containing a conserved region of a G protein-coupled receptor or human G protein-containing coupling under a disease state Abnormal Expression of Protein 11 in conserveed Regions of the Body
  • a DNA sequence encoding human protein 11 containing a conserved region of a G protein coupled receptor can be used to hybridize biopsy specimens to determine the expression of human protein 11 containing a conserved region of a G protein coupled receptor.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • One of the polynucleotides of the invention Part or all can be used as probes to be fixed on a microarray (Microarray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human G-protein-coupled receptor-conserved region of protein 11 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human G-protein-coupled receptor-conserved region of protein 11 transcription .
  • Detecting mutations in the protein 11 gene of the human G protein-coupled receptor-conserved region can also be used to diagnose human protein 11-containing conserved regions of the protein 11-related disease.
  • Forms of human protein 11 mutations that contain conserved regions of the G protein-coupled receptor include point mutations, translocations, deletions, recombinations, and others compared to the normal wild-type human G protein-coupled receptor-conserved regions of protein 11 DNA sequences Any exceptions etc. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendenan Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions. Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease.
  • Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR.
  • the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase Figure resolution and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human protein 1 containing a conserved region of the G protein-coupled receptor is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dosage range of the protein 1 1 containing a conserved region of the G protein-coupled receptor in a human being administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Endocrinology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine 11 contenant un site de conservation d'un récepteur lié à une protéine G, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, des troubles du développement, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine 11 contenant un site de conservation d'un récepteur lié à une protéine G.
PCT/CN2001/000594 2000-04-27 2001-04-23 Nouveau polypeptide, proteine humaine 11 contenant un site de conservation d'un recepteur lie a une proteine g, et polynucleotide codant pour ce polypeptide WO2001081571A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU70435/01A AU7043501A (en) 2000-04-27 2001-04-23 A novel polypeptide, a human protein 11 containing g protein coupling receptor conserved region and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115463.X 2000-04-27
CN 00115463 CN1320623A (zh) 2000-04-27 2000-04-27 一种新的多肽——人含g蛋白耦连受体保守区域的蛋白11和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001081571A1 true WO2001081571A1 (fr) 2001-11-01

Family

ID=4584909

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000594 WO2001081571A1 (fr) 2000-04-27 2001-04-23 Nouveau polypeptide, proteine humaine 11 contenant un site de conservation d'un recepteur lie a une proteine g, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1320623A (fr)
AU (1) AU7043501A (fr)
WO (1) WO2001081571A1 (fr)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 1 April 1999 (1999-04-01), Database accession no. AC005182 *
DATABASE GENBANK [online] 22 November 1999 (1999-11-22), accession no. EMBL Database accession no. Z68746 *
DATABASE GENBANK [online] 22 October 1995 (1995-10-22), accession no. EMBL Database accession no. Z62573 *
DATABASE GENBANK [online] 23 October 1999 (1999-10-23), Database accession no. AC006449 *

Also Published As

Publication number Publication date
AU7043501A (en) 2001-11-07
CN1320623A (zh) 2001-11-07

Similar Documents

Publication Publication Date Title
WO2001068684A1 (fr) Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide
WO2001068688A1 (fr) Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001074888A1 (fr) Nouveau polypeptide, $g(b)-preprotachykinine humaine 9, et polynucleotide codant pour ce polypeptide
WO2001081571A1 (fr) Nouveau polypeptide, proteine humaine 11 contenant un site de conservation d'un recepteur lie a une proteine g, et polynucleotide codant pour ce polypeptide
WO2001064727A1 (fr) Nouveau polypeptide, adenosinate cyclase soluble 25 de souris, et polynucleotide codant pour ce polypeptide
WO2001075023A2 (fr) Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001081592A1 (fr) Nouveau polypeptide, proteine humaine 11 contenant un fragment de sequence particulier d'une signal peptidase i, et polynucleotide codant pour ce polypeptide
WO2001064868A1 (fr) Nouveau polypeptide, recepteur humain de cytokine 12, et polynucleotide codant pour ce polypeptide
WO2001075029A2 (fr) Nouveau polypeptide, facteur humain 11 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001083536A1 (fr) Nouveau polypeptide, recepteur 15 du facteur cellulaire, et polynucleotide codant pour ce polypeptide
WO2001064893A1 (fr) Nouveau polypeptide, transcriptase inverse humaine 13, et polynucleotide codant pour ce polypeptide
WO2001064722A1 (fr) Nouveau polypeptide, proteine humaine 9 associee a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2001081395A1 (fr) Nouveau polypeptide, adn topo-isomerase i-15, et polynucleotide codant pour ce polypeptide
WO2001079438A2 (fr) Nouveau polypeptide, proteine humaine de liaison 9 d'une proteine precurseur de l'amyloide, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001064730A1 (fr) Nouveau polypeptide, 5-phosphatase humaine 18, et polynucleotide codant pour ce polypeptide
WO2001081537A2 (fr) Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide
WO2001074995A2 (fr) Nouveau polypeptide, protéine humaine de mutation 15 de l'ataxie telangiectasie, et de polynucléotide codant pour ce polypeptide
WO2001083728A1 (fr) Nouveau polypeptide, proteine humaine de transport d'acides amines excitateurs 9, et polynucleotide codant pour ce polypeptide
WO2001081392A1 (fr) Nouveau polypeptide, phosphoproteine nucleolaire humaine 13, et polynucleotide codant pour ce polypeptide
WO2002002768A1 (fr) Nouveau polypeptide, recepteur peptidique natriuretique humain 9, et polynucleotide codant ce polypeptide
WO2001071000A1 (fr) Nouveau polypeptide, znt-1-22, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP