WO2001081592A1 - Nouveau polypeptide, proteine humaine 11 contenant un fragment de sequence particulier d'une signal peptidase i, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, proteine humaine 11 contenant un fragment de sequence particulier d'une signal peptidase i, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001081592A1 WO2001081592A1 PCT/CN2001/000585 CN0100585W WO0181592A1 WO 2001081592 A1 WO2001081592 A1 WO 2001081592A1 CN 0100585 W CN0100585 W CN 0100585W WO 0181592 A1 WO0181592 A1 WO 0181592A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- signal peptidase
- protein
- fragment
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human protein 11 containing a characteristic sequence fragment of signal peptidase I, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
- Signal peptidase is a common and important enzyme in living organisms, which is involved in catalyzing the removal of signal peptides in the sequence of endocrine protein precursors to generate biologically active protein polypeptides.
- type I signal peptidases are responsible for participating in the processing of multiple transport precursor proteins; type II signal peptidases are only involved in the processing of lipoproteins; and type III signal peptidases are Participate in the process of prokaryotic pilus formation.
- the type I signal peptidase is an integral membrane protein, which is bound to the plasma membrane through one or two transmembrane domains at the N-terminus of the protein sequence.
- the protein polypeptide also contains a conserved catalytically active subunit, in which serine and lysine amino acid residues are necessary for enzyme catalytic activity.
- the signal peptidase complex is an oligomeric enzyme complex composed of at least five subunits and is localized to the cell. On the endoplasmic reticulum.
- the mammalian signal peptidase complex consists of two subunits, 18KD and 21KD.
- Characteristic sequence fragment 1 [GS]-XSMX- [PS]-[AT]-[LF] (where S Is the active site); characteristic sequence fragment 2: K— R— [LIVMSTA] (2)-[GA] -X- [PG] -G- [DE] -X- [LIVM] -X- [LI VMFY] (where K is the active site); characteristic sequence fragment 3: [LIVMFYW] (2)-X (2)-GD- [NH] -X (3)-[SND] -X (2)- [SG]; Sequence fragment 1 of the above three characteristic sequence fragments contains a serine active site.
- the characteristic sequence fragment 2 contains a lysine active action center. This characteristic sequence fragment exists only in some signal peptidases, such as IMP1, and not in all signal peptidases.
- the characteristic sequence fragment 3 is present at the C-terminus of all signal peptidase protein sequences. These three characteristic sequence fragments all play an important regulatory role in the process of protein activity. Any mutation or abnormal expression will lead to the inactivation of the enzyme or the abnormal function, and then affect the progress of a series of related biological processes. .
- the protein is usually closely related to the occurrence of developmental disorders, immune system diseases, tumors of related tissues, and cancers in some signaling systems.
- the novel human protein 11 containing a characteristic sequence fragment of signal peptidase I of the present invention also contains the information shown above.
- Three conserved characteristic sequence fragments of peptidase, which is a new signal peptidase, are also involved in regulating the processes of splicing and maturation of various proteins in vivo.
- the protein is usually closely related to the development of disorders such as developmental disorders, immune system diseases, and tumors and cancers in related tissues caused by signaling disorders. It can also be used to diagnose and treat various diseases mentioned above.
- the human protein 11 protein containing the characteristic sequence fragment of signal peptidase I plays an important role in important functions in the body, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there has been a need in the art to identify more involved in these Process of human protein 11 protein containing a characteristic sequence fragment of signal peptidase I, especially the amino acid sequence of this protein is identified.
- the protein 11 protein containing the characteristic sequence fragment of signal peptidase I was isolated by the newcomer.
- the isolation of the coding gene also provided the basis for the research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolation of its coding DNA is important. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human protein 11 fragment containing a characteristic sequence of signal peptidase I.
- Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a human protein 11 fragment containing a characteristic sequence of signal peptidase I.
- Another object of the present invention is to provide a method for producing a human protein 11 containing a fragment characteristic of a signal peptidase I sequence.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human protein 11 containing a characteristic sequence fragment of signal peptidase I.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide 11 of the present invention, which are proteins 11 containing characteristic sequence fragments of signal peptidase I.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human protein 11 containing a characteristic sequence fragment of signal peptidase I.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of Variants:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 225-5 and 33 in SEQ ID NO: 1; and (b) having a sequence 1- in SEQ ID NO: 1 1 578-bit sequence.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of a protein 11 protein containing a characteristic sequence fragment of signal peptidase I, which comprises utilizing the polypeptide of the present invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of protein 1 1 protein containing a characteristic sequence fragment of human signal peptidase I in vitro, comprising detecting the polypeptide or a polynucleotide encoding the same in a biological sample. A mutation in a sequence, or the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the preparation of polypeptides and / or polynucleotides of the present invention for use in the treatment of cancer, developmental or immune diseases, or other diseases caused by abnormal expression of protein 1 1 containing a characteristic sequence fragment of signal peptidase I in humans. Use of drugs.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
- the change may include an amino acid sequence or a nucleotide sequence Amino acid or nucleotide deletions, insertions or substitutions.
- Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- a “deletion” is a deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with human protein 11 containing a characteristic sequence fragment of signal peptidase I, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds to human protein 11 containing a characteristic sequence of signal peptidase I.
- Antagonist refers to an organism that can block or regulate human protein 11 containing a characteristic sequence fragment of signal peptidase I when combined with human protein 11 containing a characteristic sequence fragment of signal peptidase I.
- Molecularly active or immunologically active molecule may include proteins, nucleic acids, carbohydrates or any other molecule that binds to human protein 11 containing a fragment of a characteristic sequence of signal peptidase I.
- Regular refers to a change in the function of human protein 11 containing a characteristic sequence fragment of signal peptidase I, including an increase or decrease in protein activity, a change in binding characteristics, and human protein 11 containing a characteristic sequence fragment of signal peptidase I Of any other biological, functional or immune properties.
- Substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can use standard protein purification techniques to purify human signal peptidase I characteristic sequences. Fragment of protein 11. Essentially pure human with signal peptidase I characteristic sequence fragment of protein 11 can generate a single main band on a non-reducing polyacrylamide gel. Human signal peptidase I characteristic sequence fragment The purity of the protein 11 peptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partially homologous means A partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. Inhibition of such hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences.
- the percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.).
- the MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P.M. Sharp (1988) Gene 73: 237-244).
- the Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
- the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100
- the percentage of identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645) 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? , It can specifically bind to the human epitope of protein 11 containing a characteristic sequence fragment of signal peptidase I.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated human protein 11 containing a characteristic sequence fragment of signal peptidase I means that human protein 11 containing a characteristic sequence fragment of signal peptidase I is substantially free of other proteins, lipids, Sugars or other substances. Those skilled in the art can use standard protein purification techniques to purify human proteins containing signal peptidase I characteristic sequence fragments. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human protein 11 polypeptide containing a characteristic sequence fragment of signal peptidase I can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide-human protein 11 containing a characteristic sequence fragment of signal peptidase I, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptide of the present invention may be a naturally purified product or a chemically synthesized product, or may be produced from a prokaryotic or eukaryotic host (for example, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technology.
- polypeptides of the invention may be glycosylated, or they may be non-glycosylated.
- the polypeptides of the invention may also include or exclude the initial methionine residue.
- the present invention also includes fragments, derivatives and analogs of human protein 11 containing a fragment of a characteristic sequence of signal peptidase I.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the protein 11 of the present invention containing a fragment of a characteristic sequence of signal peptidase I.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (in)
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
- such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1578 bases in length and its open reading frame (225-533) encodes 102 amino acids.
- This peptide has a characteristic sequence of a characteristic sequence of signal peptidase I, and it can be inferred that the human protein containing a characteristic sequence fragment of signal peptidase I 1 has the structure and function represented by the characteristic sequence of signal peptidase I.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DM can be coded or non-coded.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
- These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 xSSC, 0.1% SDS, 60 ° C; or (2 ) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95%, and more preferably Hybridization only occurred at 97% or more.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human protein 11 containing fragments characteristic of signal peptidase I sequences.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence of the present invention encoding a protein 11 containing a characteristic sequence fragment of signal peptidase I can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from C1 on tech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) the determination of human protein 11 containing a characteristic sequence fragment of signal peptidase I The level of transcripts; (4) Detecting protein products expressed by genes by immunological techniques or by measuring biological activity. The above methods can be used alone or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probes used here are usually the gene sequence information of the present invention Based on chemically synthesized DNA sequences. The genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of the human protein 11 gene containing a characteristic sequence fragment of signal peptidase I can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait.
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait.
- a method using PCR to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE- rapid cDNA end amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human protein 11 coding sequence containing a characteristic sequence fragment of signal peptidase I, and produced by recombinant technology A method of a polypeptide according to the invention.
- a polynucleotide sequence encoding a protein 11 containing a characteristic sequence fragment of a signal peptidase I can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods well known to those skilled in the art can be used to construct expression vectors containing the DNA sequence of protein 11 encoding the human signal-containing peptidase I characteristic sequence fragment and suitable transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include the SV40 enhancer of 100 to 270 base pairs on the late side of the origin of replication, the polyoma enhancer and the adenovirus enhancer on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human protein 1 1 containing a characteristic sequence fragment of signal peptidase I or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute the polynucleotide or the recombinant vector.
- Genetically engineered host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells
- fly S2 or Sf 9 animal cells
- animal cells such as CH0, COS or Bowes s melanoma cells, etc. .
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (Method 12, using the procedure well known in the art.
- Alternative is MgC l 2.
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant protein 1 1 containing a characteristic sequence fragment of signal peptidase I (Scence, 1 984; 224: 1 431). Generally there are the following steps:
- a multi-core protein n encoding human human signal signal peptide-containing characteristic sequence fragment of the present invention is used.
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- Fig. 1 is a comparison diagram of the amino acid sequence homology of 56 amino acids and signal peptidase I characteristic sequence domains of the protein 11 1 containing the characteristic sequence fragment of signal peptidase I of the present invention.
- the upper sequence is the human protein 1 1 containing the characteristic sequence fragment of signal peptidase I, and the lower sequence is the characteristic sequence domain of signal peptidase I.
- Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".
- Figure 2 is a polyacrylamide gel electrophoresis diagram (SDS-PAGE) of an isolated human protein 1 1 containing a characteristic sequence fragment of signal peptidase I.
- KL is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using the Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 ⁇ fragment was inserted into the multiple cloning site of pBSK (+) vector (Clontech), and transformed into DH5a. The bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0559c05 was new DNA.
- the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
- the sequence of the protein 11 containing the characteristic sequence fragment of the signal peptidase I of the present invention and its encoded protein sequence ⁇ 1 J were used by the prof i le scan program (Basiclocal Alignment search tool) in GCG [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], domain analysis was performed in databases such as prosite.
- the protein 11 containing the characteristic sequence fragment of the signal peptidase I of the present invention is homologous with the characteristic sequence of the domain signal peptidase I at 30-85, and the homology result is shown in FIG. 1.
- the homology rate is 0.37, and the score is 20.95;
- the threshold is 16.91.
- Example 3 Cloning of a gene encoding human protein 11 containing a characteristic sequence fragment of signal peptidase I by RT-PCR method. Fetal brain cells were used as a template, and oligo-dT was used as a primer for reverse transcription to synthesize cDNA. After purification of the kit, PCR amplification was performed with the following primers:
- Primerl 5'- AGATCTGAGGACATTGAATCAACA -3 '(SEQ ID NO: 3)
- Primer2 5'- GTGAAGTCTCACTGTGTTGCCCAG-3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 ⁇ l / L KC1, 10 mmol / L Tris- in a reaction volume of 50 ⁇ 1
- This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM K 2 2 P 0 4 ( ⁇ 7.4)-5 ⁇ SSC- 5 ⁇ Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, filter was placed in 1 x SSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 5 In vitro expression, isolation and purification of recombinant human protein 11 containing a characteristic sequence fragment of signal peptidase I Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers was designed The sequence is as follows:
- Primer3 5'- CATGCTAGCATGATCAGTACCATATTTTTTTTA —3 '(Seq ID No: 5)
- Primer4 5'- CATGGATCCTTACAGCCATATGCCACCACGCCC -3 '(Seq ID No: 6)
- the 5' ends of these two primers contain Nhel and BamHI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively.
- the Nhe I and BamH I restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET 28 b (+) (Novagen product, Cat. No. 69865.3).
- the PCR reaction was performed using the pBS-0559c05 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ l containing 10 pg of pBS-0559c05 plasmid, Primer-3 and Primer-4, and 1 J was lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 Loop. Nhel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E. coli DH5 CC using the calcium chloride method.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutation sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe for subsequent experiments.
- the film is washed with high-strength conditions and strength conditions, respectively.
- Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. For example, see the literature DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And the literature Helle, RA, Schema, M. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
- Total mRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP (5- Amino- propargy 1-2 '-deoxyur i dine 5'-tr i phate coupled to Cy 3 fluorescent dye (purchased from Amershani Phamacia Biotech) was used to label mRNA of normal liver tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargy 1-2 '-deoxyur i dine 5'- tr iphate coupled to Cy5 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the liver cancer tissue mRNA, and the probe was prepared after purification.
- Cy3dUTP 5- Amino- propargy 1-2 '-deoxyur i dine 5'-tr i phate coupled to Cy 3 fluorescent dye (purchased from Amers
- the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2 SDS) at room temperature and scanned with ScanArray 3000. Instrument (purchased from General Scanning Company, USA) for scanning. The scanned images were analyzed and processed with Imagene software (Biodiscovery Company, USA), and the Cy3ZCy5 ratio of each point was calculated. The points with the ratio less than 0.5 and greater than 2 were considered to be expressed. Difference genes.
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Signal peptidase is a common and important enzyme in organisms, which is involved in catalyzing the removal of signal peptides in the secretory protein precursor sequence to generate biologically active protein peptides. In eukaryotes, the removal of signal peptides of various related proteins is catalyzed by a signal peptidase complex.
- the signal peptidase complex is an oligomeric enzyme complex composed of at least five subunits and is localized to the cell. Endoplasmic reticulum.
- the mammalian signal peptidase complex consists of two subunits, 18KD and 21KD.
- the novel human protein 11 containing the characteristic sequence fragment of signal peptidase I of the present invention also contains the type I characteristic sequence fragment of the above-mentioned signal peptidase family, which is a new member of the enzyme protein family.
- This protein is involved in regulating the excision of signal peptides of various related proteins in the body to form proteins with normal biological functions. Its mutation or abnormal expression will lead to a variety of protein shear errors, which will lead to pathological processes such as embryonic development disorders, growth and development disorders, tumorigenesis, inflammatory abnormalities, and immune regulation disorders, and related diseases.
- the abnormal expression of the protein 11 containing the characteristic sequence fragment of the signal peptidase I of the present invention will produce various diseases, especially various tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases. These diseases include, but are not limited to:
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
- Embryonic disorders congenital abortion, cleft palate, limb absentness, limb differentiation disorder, atrial septal defect Damage, neural tube defects, congenital hydrocephalus, congenital glaucoma or cataract, congenital hearing loss, growth and development disorders: mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia Sexual diseases, various metabolic defects, stunting, dwarfism, Cushing syndrome, sexual retardation
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- the abnormal expression of the protein 11 containing the characteristic sequence fragment of the signal peptidase I of the present invention will also cause certain hereditary and hematological diseases.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc.
- the invention also provides methods for screening compounds to identify agents that enhance (agonist) or suppress (antagonist) human proteins containing signal peptidase I characteristic sequence fragments.
- Agonists enhance human proteins containing signal peptidase I characteristic sequence fragments 1 1 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
- a mammalian cell or a membrane preparation expressing a protein 11 containing a characteristic sequence fragment of a signal peptidase I can be cultured in the presence of a drug together with a labeled protein 1 1 containing a characteristic sequence fragment of the signal peptidase I. . The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human protein 11 containing characteristic sequence fragments of signal peptidase I include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human protein 1 1 containing a characteristic sequence fragment of signal peptidase I can bind to human protein 1 1 containing a characteristic sequence fragment of signal peptidase I and eliminate its function, or inhibit the production of the polypeptide, or The active site binding of the polypeptide prevents the polypeptide from performing a biological function.
- human protein 11 containing a characteristic sequence fragment of signal peptidase I can be added to a bioanalytical assay, and by measuring the compound against human protein 1 1 containing a characteristic sequence fragment of signal peptidase I and its The effect of receptor interactions is used to determine whether a compound is an antagonist.
- Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human protein 11 containing a characteristic sequence fragment of signal peptidase I can be screened by various The possible combined amino acids are obtained by binding to a random peptide library composed of solid phases.
- human 11 molecules containing signal peptidase I characteristic sequence fragments should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the present invention also provides an antibody against a human protein 11 epitope containing a characteristic sequence fragment of signal peptidase I. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human proteins containing characteristic sequence fragments of signal peptidase I directly into immunized animals (such as rabbits, mice, rats, etc.).
- Various adjuvants can be used to enhance the immune response. Including but not limited to Freund's adjuvant and the like.
- Techniques for preparing human monoclonal antibodies of protein 11 containing characteristic sequence fragments of signal peptidase I include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), Three tumor technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrie et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against human protein 11 containing a characteristic sequence fragment of signal peptidase I.
- Antibodies against protein 11 containing a characteristic sequence fragment of signal peptidase I can be used in immunohistochemical techniques to detect human protein 11 containing a characteristic sequence fragment of signal peptidase I in a biopsy specimen.
- Monoclonal antibodies that bind to human protein 1 1 containing characteristic sequence fragments of signal peptidase I can also be labeled with radioisotopes and injected into the body to track their location and distribution.
- This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human protein containing a characteristic sequence fragment of signal peptidase I 1 1 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human characteristic sequences containing signal peptidase I Fragment of protein 11 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to human protein 11 containing a characteristic sequence fragment of signal peptidase I.
- Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human protein 11 containing a characteristic sequence fragment of signal peptidase I.
- the present invention also relates to a diagnostic test method for quantitatively and locally detecting the level of protein 11 containing a characteristic sequence fragment of signal peptidase I in humans.
- tests are well known in the art and include FI SH assays and radioimmunoassays.
- the level of human protein 11 containing the characteristic sequence of signal peptidase I detected in the test can be used The purpose is to explain the importance of human protein 11 containing a characteristic sequence fragment of signal peptidase I in various diseases and to diagnose diseases in which human protein 11 containing a characteristic sequence fragment of signal peptidase I functions.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding human protein 11 containing a characteristic sequence fragment of signal peptidase I can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of protein 11 containing a characteristic sequence fragment of signal peptidase I.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human signal peptide-containing characteristic sequence fragments of protein ⁇ to inhibit endogenous human signal peptide-containing characteristic sequence fragments of protein 1 1 activity.
- a mutated human protein 11 containing a characteristic sequence fragment of signal peptidase I may be a shortened human protein 11 containing a characteristic sequence fragment of signal peptidase I, although it may be related to the downstream Substrate binding, but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of protein 11 containing a characteristic sequence fragment of signal peptidase I.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc.
- a polynucleotide encoding a protein 1 1 containing a characteristic sequence fragment of human signal peptidase I can be used to transfer a polynucleotide encoding a protein 1 1 containing a characteristic sequence fragment of human signal peptidase I to in the cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human protein 11 containing a characteristic sequence fragment of signal peptidase I can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human protein 11 containing a characteristic sequence fragment of signal peptidase I can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human protein 11 mRNA containing fragments of characteristic sequences of signal peptidase I are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length of the two hydrazones, and using phosphorothioate or peptide bonds instead of phosphodiester bonds for the linkage between ribonucleosides.
- the polynucleotide encoding human protein 11 containing a characteristic sequence fragment of signal peptidase I can be used for diagnosis of diseases related to human protein 11 containing a characteristic sequence fragment of signal peptidase I.
- the polynucleotide encoding human protein 11 containing the characteristic sequence fragment of signal peptidase I can be used to detect the expression of human protein 11 containing the characteristic sequence fragment of signal peptidase I or the characteristics of human signal peptidase I in the disease state Sexual Sequence Fragment Abnormal Expression of Protein 11.
- a DNA sequence encoding a protein 1 1 containing a characteristic sequence fragment of signal peptidase I can be used to hybridize a biopsy specimen to determine the expression status of protein 11 containing a characteristic sequence fragment of signal peptidase I.
- Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- RNA-Polymerase Chain Reaction (RT-PCR) in vitro amplification of human protein 1 1 characteristic sequence fragments containing characteristic signal peptidase I can also detect the transcription of human protein 11 sequence characteristic fragments containing signal peptidase I product.
- Detection of mutations in the protein 11 gene containing the characteristic sequence fragment of signal peptidase I can also be used to diagnose diseases related to protein 1 1 containing the characteristic sequence fragment of signal peptidase I.
- Forms of human protein 1 1 characteristic sequence fragments containing signal peptidase I mutations include point mutations, translocations, deletions, and recombinations compared to normal wild type human protein 1 1 DNA sequence fragments characteristic of signal peptidase I And any other exceptions. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosome localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybrids to construct chromosome-specific cDNA library.
- Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human protein 11 containing a characteristic sequence fragment of signal peptidase I is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of human protein 11 containing the signal peptidase I characteristic sequence fragment to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU73793/01A AU7379301A (en) | 2000-04-27 | 2001-04-23 | A novel polypeptide, a human protein 11 containing signalase i characteristic sequence fragment and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115476 CN1320701A (zh) | 2000-04-27 | 2000-04-27 | 一种新的多肽——人含信号肽酶ⅰ特征性序列片段的蛋白11和编码这种多肽的多核苷酸 |
CN00115476.1 | 2000-04-27 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001081592A1 true WO2001081592A1 (fr) | 2001-11-01 |
Family
ID=4584922
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000585 WO2001081592A1 (fr) | 2000-04-27 | 2001-04-23 | Nouveau polypeptide, proteine humaine 11 contenant un fragment de sequence particulier d'une signal peptidase i, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1320701A (fr) |
AU (1) | AU7379301A (fr) |
WO (1) | WO2001081592A1 (fr) |
-
2000
- 2000-04-27 CN CN 00115476 patent/CN1320701A/zh active Pending
-
2001
- 2001-04-23 WO PCT/CN2001/000585 patent/WO2001081592A1/fr active Application Filing
- 2001-04-23 AU AU73793/01A patent/AU7379301A/en not_active Abandoned
Non-Patent Citations (5)
Title |
---|
DATABASE EMBL [online] 2 March 2000 (2000-03-02), Database accession no. AL121654 * |
DATABASE EMBL [online] 2 March 2000 (2000-03-02), Database accession no. AL133247 * |
DATABASE GENBANK [online] 12 December 1999 (1999-12-12), accession no. EMBL Database accession no. Z95115 * |
DATABASE GENBANK [online] 21 December 1999 (1999-12-21), Database accession no. AC007240 * |
DATABASE GENBANK [online] 29 July 1998 (1998-07-29), Database accession no. AC005274 * |
Also Published As
Publication number | Publication date |
---|---|
CN1320701A (zh) | 2001-11-07 |
AU7379301A (en) | 2001-11-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001068689A1 (fr) | Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide | |
WO2001068688A1 (fr) | Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide | |
WO2001068684A1 (fr) | Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001081592A1 (fr) | Nouveau polypeptide, proteine humaine 11 contenant un fragment de sequence particulier d'une signal peptidase i, et polynucleotide codant pour ce polypeptide | |
WO2001075023A2 (fr) | Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001079432A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide | |
WO2001090376A1 (fr) | Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide | |
WO2001064867A1 (fr) | Nouveau polypeptide, facteur humain 33 associe a la transcription inverse, et polynucleotide codant pour ce polypeptide | |
WO2001081536A2 (fr) | Nouveau polypeptide, proteine kinase ysk1 humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001075024A2 (fr) | Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001081537A2 (fr) | Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001064893A1 (fr) | Nouveau polypeptide, transcriptase inverse humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001073061A1 (fr) | Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide | |
WO2001064732A1 (fr) | Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide | |
WO2001081393A1 (fr) | Nouveau polypeptide, proteine kinase ysk1 humaine 20, et polynucleotide codant pour ce polypeptide | |
WO2001064730A1 (fr) | Nouveau polypeptide, 5-phosphatase humaine 18, et polynucleotide codant pour ce polypeptide | |
WO2001075079A1 (fr) | Nouveau polypeptide, dihydroorotase humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001081392A1 (fr) | Nouveau polypeptide, phosphoproteine nucleolaire humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001081571A1 (fr) | Nouveau polypeptide, proteine humaine 11 contenant un site de conservation d'un recepteur lie a une proteine g, et polynucleotide codant pour ce polypeptide | |
WO2001064722A1 (fr) | Nouveau polypeptide, proteine humaine 9 associee a la transcription inverse, et polynucleotide codant pour ce polypeptide | |
WO2001081395A1 (fr) | Nouveau polypeptide, adn topo-isomerase i-15, et polynucleotide codant pour ce polypeptide | |
WO2001077165A1 (fr) | Nouveau polypeptide, proteine humaine de liaison 12 d'une proteine precurseur de l'amyloide, et polynucleotide codant pour ce polypeptide | |
WO2001083536A1 (fr) | Nouveau polypeptide, recepteur 15 du facteur cellulaire, et polynucleotide codant pour ce polypeptide | |
WO2001048198A1 (fr) | Nouveau polypeptide, proteine ribosomale s4 8, et polynucleotide codant pour ce polypeptide | |
WO2001066591A1 (fr) | Nouveau polypeptide, proteine humaine 11 de reception tyrosine phosphatase, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |