WO2001064868A1 - Nouveau polypeptide, recepteur humain de cytokine 12, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, recepteur humain de cytokine 12, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001064868A1
WO2001064868A1 PCT/CN2001/000250 CN0100250W WO0164868A1 WO 2001064868 A1 WO2001064868 A1 WO 2001064868A1 CN 0100250 W CN0100250 W CN 0100250W WO 0164868 A1 WO0164868 A1 WO 0164868A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
cytokine receptor
human cytokine
sequence
Prior art date
Application number
PCT/CN2001/000250
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU46301/01A priority Critical patent/AU4630101A/en
Publication of WO2001064868A1 publication Critical patent/WO2001064868A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human cytokine receptor 12, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • hydrophilic signal molecules include neurotransmitters, growth factors, and cytokines. They cannot pass through the double lipid layer of the plasma membrane of the target cell, they can only bind to specific receptors on the cell surface, and through signal transduction mechanisms, they produce a second messenger-activated protein kinase and protein-proteinase activity in the cell. The second messenger quickly changed the activity of the enzyme in the target cell or the activity of the non-enzyme protein, causing the cell to respond to external signals.
  • the cytokine receptor is a superfamily of transmembrane proteins. The structures outside their membranes have two barrel-shaped structures formed by seven bundled structures. Cytokine receptors mediate many non-tyrosine protein kinase receptor signaling, including growth hormone, prolactin, many growth factors of the hematopoietic system and their interferons, etc. Therefore, cytokine receptors are involved in a variety of cell physiology. Activities play important regulatory roles, such as regulating cell proliferation, regulating cell differentiation, immunity, and development during hematopoietic effects. For example: The cytokine receptor cM P l plays an important role in stimulating megakaryocyte development and platelet formation. [Current Opinion in Hematology 1995, 2: 22-28.]
  • cytokine delivery cells The mechanism of cytokine delivery cells is closely related to the action of a protein tyrosine kinase JAK.
  • JAK protein tyrosine kinase
  • the expression profile of the peptide is very similar to the expression profile of the human cytokine receptor CRF2-4, so the functions of the two may also be similar.
  • the invention is named human cytokine receptor 12.
  • the human cytokine receptor 12 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more involved in these processes.
  • the human cytokine receptor 12 protein, especially the amino acid sequence of this protein is identified.
  • the isolation of the new human cytokine receptor 12 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic agents for disease 1 and it is therefore important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human cytokine receptor 12.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human cytokine receptor 12.
  • Another object of the present invention is to provide a method for producing human cytokine receptor 12.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human cytokine receptor 12.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human cytokine receptor 12.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human cytokine receptor 12.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 29-355 in SEQ ID NO: 1; and (b) a sequence having positions 1-1989 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the human cytokine receptor 12 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human cytokine receptor 12 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of malignant tumors, hematological diseases, developmental disorders, HIV infection and immune diseases and various types of inflammation, or other human cytokine receptor 12 Use of medicines for diseases caused by abnormal expression.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
  • the changes may include amino acid sequences or nucleotides A deletion, insertion, or substitution of an amino acid or nucleotide in a sequence.
  • Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when bound to human cytokine receptor 12, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to the human cytokine receptor 12.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human cytokine receptor 12 when bound to human cytokine receptor 12.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human cytokine receptor 12.
  • Regular refers to a change in the function of human cytokine receptor 12, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immunological changes in human cytokine receptor 12.
  • substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human cytokine receptor 12 using standard protein purification techniques. Basically Pure human cytokine receptor 12 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human cytokine receptor 12 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. Inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nort hern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and suppress identical Binding of the source sequence to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences based on different methods such as the Cluster method (Higgins, D. G. and P.M. Sharp (1988) Gene 73: 237-244). The Cluster method arranges each group of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
  • sequence A and sequence B The percent identity between two amino acid sequences, such as sequence A and sequence B, is calculated by the following formula: Number of residues matching between sequence A and sequence X 100 Number of residues in sequence A-number of interval residues in sequence A Number of interval residues in a sequence B
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art, such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the epitope of human cytokine receptor 12.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide exists in a living animal. It is not isolated, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human cytokine receptor 12 means that human cytokine receptor 12 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human cytokine receptor 12 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human cytokine receptor 12 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human cytokine receptor 12, which is basically composed of SEQ ID NO: 1;
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of the human cytokine receptor 12.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human cytokine receptor 12 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence)
  • fragments, 00 derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of an amino acid encoding SEQ ID NO: 2 Polynucleotide composition of a polypeptide of the amino acid sequence.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence that is 1989 bases in length and its open reading frames 29-355 encode 108 amino acids.
  • this polypeptide has a similar expression profile with the human cytokine receptor CRF2-4, and it can be concluded that the human cytokine receptor 12 has a similar function to the human cytokine receptor CRF2-4.
  • the polynucleotide of the present invention may be in the DM form or the RM form.
  • MA forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (there is at least 50./ »between the two sequences, preferably 70% identity).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 Nucleotides, preferably at least 100 nucleotides. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human cytokine receptor 12.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human cytokine receptor 12 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the MA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been developed for mRNA extraction, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) measuring the level of human cytokine receptor 12 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human cytokine receptor 12 gene.
  • ELISA enzyme-linked immunosorbent assay
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes the CDM sequence of multiple clones needs to be determined in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human cytokine receptor 12 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology .
  • a polynucleotide sequence encoding the human cytokine receptor 12 may be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human cytokine receptor 12 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus Enhancer, etc.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human cytokine receptor 12 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the MA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequences of the present invention can be used to express or produce recombinant human cytokine receptor 12 by conventional recombinant DNA technology (Scence, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasound Processing, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasound Processing, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC
  • Fig. 1 is a comparison diagram of gene chip expression profiles of human cytokine receptor 12 and human cytokine receptor CRF2-4 in the present invention.
  • the upper graph is a graph of the expression profile of the human cytokine receptor 12, and the lower sequence is the graph of the expression profile of the human cytokine receptor CRF2-4.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human cytokine receptor 12.
  • 12KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5,-AATGTAGATCAATAAGTACTTTTT -3, (SEQ ID NO: 3)
  • Primer2 5'- GTCAGATGTCCTTTATTTACAAAT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer 2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l KL1, 10 ol / L Tris-Cl, (pH 8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP in a 50 ⁇ 1 reaction volume , lOpmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • 3-act in was used as a positive control and template blank was used as a negative control.
  • the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the PCR reaction was performed using pBS-0108 g 05 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ containing 10 pg of pBS-0108g05 plasmid, Primer-3 and Primer-4 primers were lpmmoi, Advantage polymerase Mix (Clontech) 1 ⁇ i, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68T 2 min, a total of 25 cycles.
  • Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5c by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0108 g 05) with the correct sequence was selected, and the recombinant plasmid was transformed into Escherichia coli BL21 (DE3) plySs (Nova g en) by the calcium chloride method.
  • the host strain BL21 (pET-0108g05) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 to make ol / L. Continue incubation for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidine (6His-Tag). The purified human cytokine receptor 12 was purified.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human cytokine receptor 12-specific peptides: NH2-Met-Trp-Gln-Lys-Ser-Leu-Leu-Ile-Leu-Ser-Phe-Arg-Val -Ser-Phe-C00 H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this example is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods, etc. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the spot imprint method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe l which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • RNA enzyme A was added to the DNA solution to a final concentration of 100ug / ml, 37 D C for 30 minutes.
  • Add SDS and proteinase K the final concentrations are 0.5% and 100ug / ml, respectively. Incubate at 37 ° C for 30 minutes.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the hybridization experiments performed under low-intensity membrane washing conditions did not differ significantly in the radioactivity of the hybridization spots of the above two probes; while the hybridization experiments conducted under high-intensity membrane washing conditions, the radioactive intensity of hybridization spots of probe 1 was significantly stronger than The radioactive intensity of the hybridization spot of the other probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1.
  • Gene microarray or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments. Listed on glass, silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze data to achieve the purpose of fast, efficient and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRisi, LL., Lyer, V. & Brown, P.0.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were dried to fix the DNA on glass slides to prepare chips. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
  • Probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • the scanner purchased from General Scanning Company, USA
  • the scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA- Ecv304 cell line, and non-starved L02 cell line.
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Cytokine receptors mediate many non-tyrosine protein kinase receptor signaling, including growth hormone, prolactin, many growth factors of the hematopoietic system and their interferons, etc. Therefore, cytokine receptors are involved in a variety of cell physiology. Activities play important regulatory roles, such as regulating cell proliferation, regulating cell differentiation, immunity, and development during hematopoietic effects. For example: The cytokine receptor c-Mpl plays an important role in stimulating megakaryocyte development and platelet formation.
  • cytokine delivery cells The mechanism of cytokine delivery cells is closely related to the action of a protein tyrosine kinase JAK.
  • the pathways activated by Ras to the mitogen-activated protein (MAP) kinase cascade, and the signaling pathways activated by tyrosine phosphorylation of a transcription factor called a signaling agent and a transcriptional activator can be determined by Cytokine receptor activation.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human cytokine receptor CRF2-4, and both have similar biological functions. It regulates cell proliferation in the body, and regulates cell differentiation, immunity and development during hematopoietic action. Its abnormal expression is closely related to abnormalities in the immune system, tumorigenesis, blood system, and body development, and produces related diseases.
  • the abnormal expression of the human cytokine receptor 12 of the present invention will produce various diseases, especially various tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases. Illnesses include, but are not limited to:
  • Tumors of various tissues leukemia, lymphoma, gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • Abnormal expression of the human cytokine receptor 12 of the present invention will also cause certain hereditary, hematological diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic developmental disorders, growth and development disorders, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human cytokine receptor 12.
  • Agonists enhance human cytokine receptor 12 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human cytokine receptor 12 can be cultured with labeled human cytokine receptor 12 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human cytokine receptor 12 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human cytokine receptor 12 can bind to human cytokine receptor 12 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert biological functions.
  • human cytokine receptor 12 When screening compounds as antagonists, human cytokine receptor 12 can be added to bioanalytical assays to determine the effect of the compound on the interaction between human cytokine receptor 12 and its receptor. Determine whether the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human cytokine receptor 12 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the human cytokine receptor 12 molecule should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the human cytokine receptor 12 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human cytokine receptor 12 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
  • Techniques for preparing monoclonal antibodies to human cytokine receptor 12 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta- Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0
  • Existing techniques for producing single-chain antibodies US Pa t No. 4946778) can also be used to produce single chain antibodies against human cytokine receptor 12.
  • Antibodies against human cytokine receptor 12 can be used in immunohistochemical techniques to detect human cytokine receptor 12 in biopsy specimens.
  • Monoclonal antibodies that bind to human cytokine receptor 12 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human cytokine receptor 12 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human cytokine receptor 12 positive cells .
  • the antibodies of the present invention can be used to treat or prevent diseases related to human cytokine receptor 12. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human cytokine receptor 12.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human cytokine receptor 12 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The levels of human cytokine receptor 12 detected in the test can be used to explain the importance of human cytokine receptor 12 in various diseases and to diagnose diseases in which human cytokine receptor 12 plays a role.
  • the polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human cytokine receptor 12 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human cytokine receptor 12.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human cytokine receptor 12 to inhibit endogenous human cytokine receptor 12 activity.
  • a mutated human cytokine receptor 12 may be a shortened human cytokine receptor 12 lacking a signal transduction domain. Although it can bind to downstream substrates, it lacks signal transduction activity.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human cytokine receptor 12.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human cytokine receptor 12 into cells.
  • Methods for constructing a recombinant viral vector carrying a polynucleotide encoding a human cytokine receptor 12 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human cytokine receptor 12 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human cytokine receptor 12 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that can specifically decompose specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human cytokine receptor 12 can be used for the diagnosis of diseases related to human cytokine receptor 12.
  • the polynucleotide encoding human cytokine receptor 12 can be used to detect the expression of human cytokine receptor 12 or the abnormal expression of human cytokine receptor 12 in a disease state.
  • hybrid technologies encoding human cytokine receptors include Sou thern blotting, Nor thern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • a microarray or a DNA chip also referred to as a "gene chip”
  • the 12-specific primers of RM-polymerase chain reaction (RT-PCR) can also be used to detect the human cytokine receptor 12 transcript.
  • Detection of mutations in the human cytokine receptor 12 gene can also be used to diagnose human cytokine receptor 12-related diseases.
  • Human cytokine receptor 12 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human cytokine receptor 12 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DM sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization (FI SH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FI SH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mende l ian Inher i tance in Man (available online with Johns Hopkins University Welch Med ica l Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for staining Structural changes in the body, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping) Resolving power and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
  • the polypeptide of the present invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human cytokine receptor 12 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human cytokine receptor 12 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, un récepteur humain de cytokine 12, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour le récepteur humain de cytokine 12.
PCT/CN2001/000250 2000-03-02 2001-02-26 Nouveau polypeptide, recepteur humain de cytokine 12, et polynucleotide codant pour ce polypeptide WO2001064868A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU46301/01A AU4630101A (en) 2000-03-02 2001-02-26 A novel polypeptide, a human cytokine receptor 12 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00111850 CN1311237A (zh) 2000-03-02 2000-03-02 一种新的多肽——人细胞因子受体12和编码这种多肽的多核苷酸
CN00111850.1 2000-03-02

Publications (1)

Publication Number Publication Date
WO2001064868A1 true WO2001064868A1 (fr) 2001-09-07

Family

ID=4581746

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000250 WO2001064868A1 (fr) 2000-03-02 2001-02-26 Nouveau polypeptide, recepteur humain de cytokine 12, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1311237A (fr)
AU (1) AU4630101A (fr)
WO (1) WO2001064868A1 (fr)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 16 July 1998 (1998-07-16), Database accession no. AC004124 *
DATABASE GENBANK [online] 17 November 1994 (1994-11-17), Database accession no. U14573 *
DATABASE GENBANK [online] 24 November 1998 (1998-11-24), Database accession no. AC006046 *
DATABASE GENBANK [online] 9 September 1997 (1997-09-09), Database accession no. AC002322 *

Also Published As

Publication number Publication date
CN1311237A (zh) 2001-09-05
AU4630101A (en) 2001-09-12

Similar Documents

Publication Publication Date Title
WO2001072786A1 (fr) Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001096560A1 (fr) Nouveau polypeptide, proteine humaine stat2, et polynucleotide codant ce polypeptide
WO2001064868A1 (fr) Nouveau polypeptide, recepteur humain de cytokine 12, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001075023A2 (fr) Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001064719A1 (fr) Nouveau polypeptide, facteur de regulation humain negatif 21 de la mort programmee des cellules, et polynucleotide codant pour ce polypeptide
WO2001083536A1 (fr) Nouveau polypeptide, recepteur 15 du facteur cellulaire, et polynucleotide codant pour ce polypeptide
WO2001068692A1 (fr) Nouveau polypeptide, proteine humaine conjuguee du cancer de la retine 9, et polynucleotide codant pour ce polypeptide
WO2001075059A2 (fr) Nouveau polypeptide, proteine humaine 11 de regulation de gtp, et polynucleotide codant pour ce polypeptide
WO2001081571A1 (fr) Nouveau polypeptide, proteine humaine 11 contenant un site de conservation d'un recepteur lie a une proteine g, et polynucleotide codant pour ce polypeptide
WO2001064917A1 (fr) Nouveau polypeptide, proteine kinase humaine de transduction de signal 11, et polynucleotide codant pour ce polypeptide
WO2001066577A1 (fr) Nouveau polypeptide, proteine kinase humaine 17 de transmission de signal, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2001074995A2 (fr) Nouveau polypeptide, protéine humaine de mutation 15 de l'ataxie telangiectasie, et de polynucléotide codant pour ce polypeptide
WO2001081392A1 (fr) Nouveau polypeptide, phosphoproteine nucleolaire humaine 13, et polynucleotide codant pour ce polypeptide
WO2001073061A1 (fr) Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide
WO2001055419A1 (fr) Nouveau polypeptide, site de liaison 27 d'arn s1, et polynucleotide codant pour ce polypeptide
WO2001064731A1 (fr) Nouveau polypeptide, phosphorylase kinase humaine 18, et polynucleotide codant pour ce polypeptide
WO2001075029A2 (fr) Nouveau polypeptide, facteur humain 11 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001077165A1 (fr) Nouveau polypeptide, proteine humaine de liaison 12 d'une proteine precurseur de l'amyloide, et polynucleotide codant pour ce polypeptide
WO2001075001A2 (fr) Nouveau polypeptide, protéine kinase humaine dépendant de l'adénosine cyclique 9, et poynucléotide codant pour ce polypeptide
WO2001081395A1 (fr) Nouveau polypeptide, adn topo-isomerase i-15, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP