WO2001072786A1 - Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001072786A1 WO2001072786A1 PCT/CN2001/000331 CN0100331W WO0172786A1 WO 2001072786 A1 WO2001072786 A1 WO 2001072786A1 CN 0100331 W CN0100331 W CN 0100331W WO 0172786 A1 WO0172786 A1 WO 0172786A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- tumor suppressor
- sequence
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4703—Inhibitors; Suppressors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a tumor suppressor 63, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Background technique
- the sina gene is a gene involved in determining the fate of R7 image-receiving cells [Carthew, RW & Rubin, GM (1990) Cel 163, 561-577] 0
- the function of the sina gene and the role of tyrosine kinases Sevenless is related to Ras-1 signal transduction [Fortini, ME, Simon, MA et al., (1992) Nature 355, 559-561] [Gaul, U., Mardon, G. et
- a homolog of the sina gene, the HUMSIAH gene, is also found in humans, which encodes a 282 amino acid protein.
- the protein has a C3HC4 ring finger zinc finger protein domain, which is consistent with murine and Drosophila proteins.
- WT1 Wil tumor protein
- HUMSIAH protein is also similar to the RNA recognition domain of WT1, and they may be related to tumor suppressor function [Kenn edy, D., Ramsdale, T., Mattick, et al., (1994) Nat
- the HI SIAH gene encodes a 1.3 kb mRNA expressed in all different tissues.
- One segment of the HUMSIAH gene is thought to be a tumor suppressor region of various cancers, including breast cancer and Wilms tumors [Bieche, I. & Lidereau, R. (1995) Genes Chromosomes Cancerl4, 227-251] [ang- Wu u, S., Soukup, S., et
- HUMSIAH protein Although the structure and function of HUMSIAH protein have not been thoroughly studied so far, it is certain that HUMSIAH protein is similar to P21 protein and is a tumor suppressor in many tumors.
- tumor suppressor 63 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there has been a need in the art to identify more tumors involved in these processes. Inhibitor 63 protein, especially the amino acid sequence of this protein is identified. The isolation of the new tumor suppressor 63 protein encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a tumor suppressor 63.
- Another object of the present invention is to provide a method for producing tumor suppressor 63.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-tumor suppressor 63.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the tumor suppressor 63 of the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of tumor suppressor 63.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 A sequence of positions 341-2062; and (b) a sequence of positions 1-2444 in SEQ ID NO: 1.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of tumor suppressor 63 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a tumor suppressor 63 protein, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a mutation in a biological sample.
- a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a tumor suppressor 63 protein which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a mutation in a biological sample.
- the amount or biological activity of a polypeptide of the invention comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the polypeptides and / or polynucleotides of the present invention prepared for the treatment of breast cancer, Wilms tumors, other tumors, developmental disorders, inflammation, immune diseases, blood diseases, HIV infection or other tumor suppressor factors. 63 Use of a medicine for diseases caused by abnormal expression.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DM or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the absence of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. Missed.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with tumor suppressor 63, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to tumor suppressor 63.
- Antagonist refers to a molecule that, when combined with tumor suppressor 63, blocks or regulates the biological or immunological activity of tumor suppressor 63.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to tumor suppressor 63.
- Regular refers to a change in the function of tumor suppressor 63, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immunological changes in tumor suppressor 63.
- Substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify tumor suppressor 63 using standard protein purification techniques. Essentially pure Tumor suppressor 63 can generate a single main band on a non-reducing polyacrylamide gel. The purity of tumor suppressor 63 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of a completely homologous sequence to a target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences interact with each other specifically or selectively.
- Percent identity means the sequence is identical or identical in the comparison of two or more amino acid or nucleic acid sequences Similar percentage. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Cluster method arranges each group of sequences by checking the distance between all pairs. Into clusters. The clusters are then assigned in pairs or groups.
- the percent identity between two amino acid sequences is calculated by the following formula: Number of residues matching between sequence A and sequence X 100 Number of residues in sequence A-number of interval residues in sequence A
- the number of spacer residues in a sequence B can also be determined by the Cluster method or by a method known in the art such as Jotun He in.
- the percent identity between nucleic acid sequences (Hein J., (1990) Methods in emzumology 183: 625-645) .
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the antigenic determinant of tumor suppressor 63.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not it Components of the natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated tumor suppressor 63 means that tumor suppressor 63 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify tumor suppressor 63 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the tumor suppressor 63 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, tumor suppressor 63, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant technology from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of tumor suppressor 63.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the tumor suppressor 63 of the present invention.
- the fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
- such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 2444 bases in length and its open reading frames 341-2062 encode 573 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile with tumor suppressor factors. It can be concluded that the tumor suppressor 63 has a similar function to the tumor suppressor.
- the polynucleotide of the present invention may be in the form of DM or RNA.
- DM forms include cDNA, genomic DNA or synthetic DNA.
- DM can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the present invention also relates to a polynucleotide that hybridizes to the sequence described above (there is at least 50 »/, and preferably 70% identity between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fico ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs when the identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2 .
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 More than nucleotides.
- Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding tumor suppressor 63.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the tumor suppressor 63 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating cDNA of interest is to isolate niRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very few expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or loss of marker gene function; (3) determination of the level of tumour suppressor 63 transcripts; (4) by Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of tumor suppressor 63 gene expression.
- the RACE method RACE-rapid cDNA end rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the CDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, a host cell genetically engineered using the vector of the present invention or directly using a tumor suppressor 63 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
- the polynucleotide sequence encoding the tumor suppressor 63 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- DM sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis.
- promoters are: the l ac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP Fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a tumor suppressor 63 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CHO, COS or Bowes s melanoma cells, etc. .
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce a recombinant tumor suppressor 63 (Scence, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
- FIG. 1 is a comparison diagram of gene chip expression profiles of tumor suppressor 63 and tumor suppressor of the present invention.
- the upper graph is a graph of the tumor suppressor 63 expression profile
- the lower graph is the graph of the tumor suppressor expression profile.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated tumor suppressor 63.
- 63KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Fetal brain cells using total RNA as a template and primers oli g o_dT of the cDNA synthesized was subjected to a reverse transcription reaction, after purification kit using Qiagene amplified by PCR using the following primers:
- Primerl 5'- GGAAGGCCAGGGGGCTTGGATGTG -3 '(SEQ ID NO: 3)
- Pr imerl is a forward sequence located at the 5th end of bp in SEQ ID NO: 1;
- Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 mmol / L KC1, 10 mmol / L in a 50 ⁇ l reaction volume
- Tris s-Cl (pH 8. 5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, 1 Opmol primer, 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Eltner) for 25 cycles under the following conditions: 94 ° C 30 sec; 55 ° C 30 sec; 72 ° C 2min.
- ⁇ -act in was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2444bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of tumor suppressor 63 gene expression:
- RNA extraction in one step [Ana l. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate ( ⁇ 4.0 ⁇ ), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) Centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained A precipitate was washed with 70% ethanol, dried and dissolved in water.
- RNA probe was the PCR-amplified tumor suppressor 63 coding region sequence (341bp to
- a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7. 4) -5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, place the filter at 1 x SSC-0.1 ° /. Wash in SDS for 30 min at 55 ° C. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant tumor suppressor 63
- Pr imer 3 5'- CCCCATATGATGACTCCTGAATCAAGGGATACT -3 '(Seq ID No: 5)
- Pr imer4 5'- CATGGATCCTTAATGTGATGGGTGTGCTTGTCT -3, (Seq ID No: 6)
- These two primers contain Ndel and BamHI digestion respectively Locus, followed by the 5 'end and
- the 3 'end coding sequence, Ndel and BamHI restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3).
- the pBS-0726c09 plasmid was used as a template for the PCR reaction.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ , containing 10 pg of pBS-0726c09 plasmid, Primer-3 and Primer-4, respectively, Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
- Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR method and sequenced. A positive clone (pET-0726c09) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- a peptide synthesizer (product of PE company) was used to synthesize the following tumor suppressor 63-specific peptides:
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6:43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this example is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps to hybridize the fixed polynucleotide sample to the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher intensity membrane washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the spot imprint method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- the selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
- Those that meet the above requirements can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment: 5 '-TGACTCCTGAATCAAGGGATCCTACAGATTTGTCTCCAGGG -3' (SEQ ID NO: 9)
- probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment: 5 '-TGACTCCTGAATCAAGGGATCCTACAGATTTGTCTCCAGGG -3' (SEQ ID NO: 9)
- SEQ ID NO: 9 for other commonly used reagents and their preparation methods not related to the following specific experimental procedures, please refer to the literature: DM PROBES GH Keller; M.. Manak; Stockton Press, 1989 (USA) and more commonly used molecular cloning laboratory manual books such as the "Molecular Cloning Experiment Guide” (Second Edition 1998) [US] Sambrook et al.
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- Example 7 DM Microarray
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ : ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to prepare DNA on a glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
- Photo reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissues, and the fluorescent reagent Cy5dUTP (5- Ammo-propargyl- 2'-deoxyuri (iine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification.
- Photo reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and the washing solution (1 ⁇ SSC, 0.2% SDS) After washing, scan with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images are analyzed and processed with Imagene software (Biodi scovery, USA) to calculate the Cy3 of each point. / Cy5 ratio.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Plot a graph based on these 13 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the tumor suppressor 63 and the tumor suppressor expression profile according to the present invention are very similar. Industrial applicability
- polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- the function of the sina gene is related to the tyrosine kinase receptor sevenles s and Ra s-1 signal transduction. This gene is associated with programmed cell death, just like p21, and its expression is activated by p53-dependent and p53-independent pathways.
- HUMSIAH gene Humans have a homologue of the s ina gene, the HUMSIAH gene, which is associated with tumor suppressor functions. Studies have found that a region of the HUMSIAH gene is thought to be a tumor suppressor region for various cancers, including breast cancer and Wilms tumors.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human HUMS IAH gene protein, and both have similar biological functions. It regulates cell proliferation and division in the body and has a tumor suppressing function. Its abnormal expression involves developmental disorders of the embryo, tumorigenesis and related diseases.
- the abnormal expression of the tumor suppressor 63 of the present invention will produce various diseases, especially breast cancer, Wilms tumor, other tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases. These diseases including but not limited to:
- Tumors of various tissues breast cancer, Wilms tumor gastric cancer, liver cancer, lung cancer, esophageal cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, ependymoma, glioma, colon cancer, endometrial cancer Colon cancer thymoma
- Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, brain development disorders, skin, fat and muscle dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, sexual retardation
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- Abnormal expression of the tumor suppressor 63 of the present invention will also cause certain hereditary, hematological diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially breast cancer, Wilms tumor, other tumors, embryonic developmental disorders, growth and development disorders. Sexual diseases, inflammation, immune diseases, some hereditary, blood diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) tumor suppressor 63.
- Agonists increase tumor suppressor 63 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or a membrane preparation expressing tumor suppressor factor '63 can be cultured together with a labeled tumor suppressor factor 63 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of tumor suppressor 63 include antibodies, compounds, receptor deletions, and the like that have been screened.
- An antagonist of tumor suppressor 63 can bind to tumor suppressor 63 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- tumor suppressor 63 When screening compounds as antagonists, tumor suppressor 63 can be added to the bioanalytical assay, and the effect of the compound on the interaction between tumor suppressor 63 and its receptor can be determined to determine whether the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to tumor suppressor 63 can be obtained by selecting a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the tumor suppressor 63 molecule should generally be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against a tumor suppressor 63 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting tumor suppressor 63 directly into immunized animals (such as rabbits, mice, Rats, etc.), a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies against tumor suppressor 63 include, but are not limited to, hybridoma technology (Kohl er and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the unique technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against tumor suppressor 63.
- Anti-tumor suppressor 63 antibodies can be used in immunohistochemical techniques to detect tumor suppressor 63 in biopsy specimens.
- Monoclonal antibodies that bind to tumor suppressor 63 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- Such as tumor suppressor 63 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill tumor suppressor 63 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to tumor suppressor 63.
- Administration of an appropriate dose of antibody can stimulate or block the production or activity of tumor suppressor 63.
- the invention also relates to a diagnostic test method for quantitative and localized detection of tumor suppressor 63 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of tumor suppressor 63 detected in the test can be used to explain the importance of tumor suppressor 63 in various diseases and to diagnose diseases in which tumor suppressor 63 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
- Polynucleotides encoding tumor suppressor 63 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of tumor suppressor 63.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant tumor suppressor 63 to inhibit endogenous tumor suppressor 63 activity.
- a variant tumor suppressor 63 may be a shortened tumor suppressor 63 that lacks a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of tumor suppressor 63.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to encode tumor suppressor factors
- the polynucleotide of the daughter 63 is transferred into the cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a tumor suppressor 63 can be found in existing literature (Sambrook, eta l.).
- a recombinant polynucleotide encoding tumor suppressor 63 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit tumor suppressor 63 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RM molecule that specifically decomposes a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RM, DM and ribozymes can be obtained by any existing RM or DM synthesis technology, such as solid-phase phosphate amide chemical synthesis technology for oligonucleotide synthesis has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding tumor suppressor 63 is useful for the diagnosis of diseases related to tumor suppressor 63.
- the polynucleotide encoding tumor suppressor 63 can be used to detect the expression of tumor suppressor 63 or the abnormal expression of tumor suppressor 63 in a disease state.
- the DM sequence encoding tumor suppressor 63 can be used to hybridize biopsy specimens to determine the expression of tumor suppressor 63.
- Hybridization techniques include Sou thern blotting, Nor thern blotting, in situ hybridization, and the like. These techniques and methods are publicly known and mature, and related kits are commercially available.
- a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a micro array (Mi croar ray) or a DM chip (also known as a "gene chip"), and used for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
- Tumor suppressor 63 specific primers for RNA-polymerase chain reaction (RT-PCR) amplification in vitro can also detect the transcription of tumor suppressor 63. Detection of mutations in tumor suppressor 63 gene can also be used to diagnose tumor suppressor 63 related Disease.
- Tumor suppressor 63 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type tumor suppressor 63 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- Only few chromosome markers based on actual sequence data (repeat polymorphisms) are available For marking chromosome positions.
- an important first step is to locate these DM sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- these containers there may be instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceuticals or biological products, which instructions reflect production, use, or sales Of the government's regulatory agency permits its administration on humans.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Tumor suppressor 63 is administered in an amount effective to treat and / or prevent a particular indication.
- the amount and dose range of tumor suppressor 63 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Chemical & Material Sciences (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
L'invention concerne un nouveau polypeptide, un facteur d'inhibition tumorale 63, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment du cancer du sein, de la tumeur de Wilms, d'autres tumeurs, des troubles du développement, des inflammations, des maladies immunitaires, de l'hémopathie et de l'infection par VIH. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour le facteur d'inhibition tumorale 63.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU87270/01A AU8727001A (en) | 2000-03-17 | 2001-03-16 | A novel polypeptide-tumor suppressor protein 63 and the polynucleotide encoding said polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00114977.6 | 2000-03-17 | ||
CN00114977A CN1314359A (zh) | 2000-03-17 | 2000-03-17 | 一种新的多肽——肿瘤抑制因子63和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001072786A1 true WO2001072786A1 (fr) | 2001-10-04 |
Family
ID=4584448
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000331 WO2001072786A1 (fr) | 2000-03-17 | 2001-03-16 | Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1314359A (fr) |
AU (1) | AU8727001A (fr) |
WO (1) | WO2001072786A1 (fr) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7323181B2 (en) | 1998-09-30 | 2008-01-29 | Corixa Corporation | Compositions and methods for WT1 specific immunotherapy |
US7329410B1 (en) | 1998-09-30 | 2008-02-12 | Corixa Corporation | Compositions and method for WT1 specific immunotherapy |
US7368119B2 (en) | 1998-09-30 | 2008-05-06 | Corixa Corporation | Compositions and methods for WT1 specific immunotherapy |
US7553494B2 (en) | 2001-08-24 | 2009-06-30 | Corixa Corporation | WT1 fusion proteins |
US7901693B2 (en) | 1998-09-30 | 2011-03-08 | Corixa Corporation | Compositions and methods for WT1 specific immunotherapy |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997022695A2 (fr) * | 1995-12-20 | 1997-06-26 | Fondation Jean Dausset-Ceph | Sequences nucleotidiques, proteines, medicaments et agents diagnostiques utiles dans le traitement du cancer |
-
2000
- 2000-03-17 CN CN00114977A patent/CN1314359A/zh active Pending
-
2001
- 2001-03-16 AU AU87270/01A patent/AU8727001A/en not_active Abandoned
- 2001-03-16 WO PCT/CN2001/000331 patent/WO2001072786A1/fr active Application Filing
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997022695A2 (fr) * | 1995-12-20 | 1997-06-26 | Fondation Jean Dausset-Ceph | Sequences nucleotidiques, proteines, medicaments et agents diagnostiques utiles dans le traitement du cancer |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7323181B2 (en) | 1998-09-30 | 2008-01-29 | Corixa Corporation | Compositions and methods for WT1 specific immunotherapy |
US7329410B1 (en) | 1998-09-30 | 2008-02-12 | Corixa Corporation | Compositions and method for WT1 specific immunotherapy |
US7368119B2 (en) | 1998-09-30 | 2008-05-06 | Corixa Corporation | Compositions and methods for WT1 specific immunotherapy |
US7655249B2 (en) | 1998-09-30 | 2010-02-02 | Corixa Corporation | Compositions and methods for WT1 specific immunotherapy |
US7662386B2 (en) | 1998-09-30 | 2010-02-16 | Corixa Corporation | Compositions and methods for WT1 specific immunotherapy |
US7901693B2 (en) | 1998-09-30 | 2011-03-08 | Corixa Corporation | Compositions and methods for WT1 specific immunotherapy |
US7553494B2 (en) | 2001-08-24 | 2009-06-30 | Corixa Corporation | WT1 fusion proteins |
US7915393B2 (en) | 2001-08-24 | 2011-03-29 | Corixa Corporation | Compositions and methods for WT1 specific immunotherapy |
Also Published As
Publication number | Publication date |
---|---|
AU8727001A (en) | 2001-10-08 |
CN1314359A (zh) | 2001-09-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001072786A1 (fr) | Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide | |
WO2001074869A1 (fr) | Nouveau polypeptide, proteine humaine de choc thermique 15, et polynucleotide codant pour ce polypeptide | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001088084A2 (fr) | Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide | |
WO2001079423A2 (fr) | Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001092541A1 (fr) | Nouveau polypeptide, catalase 12, et polynucleotide codant ce polypeptide | |
WO2001072801A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide | |
WO2001074870A1 (fr) | Nouveau polypeptide, alpha-galactosidase humaine a-11, et polynucleotide codant pour ce polypeptide | |
WO2001075016A2 (fr) | Nouveau polypeptide, tyrosinase humaine 16, et polynucleotide codant pour ce polypeptide | |
WO2001087972A1 (fr) | Nouveau polypeptide, proteine dpc4 humaine 9 du facteur d'inhibition de la croissance tumorale, et polynucleotide codant ce polypeptide | |
WO2001079432A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide | |
WO2002012297A1 (fr) | Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide | |
WO2001075059A2 (fr) | Nouveau polypeptide, proteine humaine 11 de regulation de gtp, et polynucleotide codant pour ce polypeptide | |
WO2001072789A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 10, et polynucleotide codant pour ce polypeptide | |
WO2001081572A1 (fr) | Nouveau polypeptide, antigene humain rage4 25 du cancer du rein, et polynucleotide codant pour ce polypeptide | |
WO2001073061A1 (fr) | Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide | |
WO2001070983A1 (fr) | Nouveau polypeptide, proteine antigene prostatique specifique membranaire 9, et polynucleotide codant pour ce polypeptide | |
WO2001083760A1 (fr) | Nouveau polypeptide, sous-unite humaine 9 d'alpha-cetone acidohydrogenase ramifiee e1-beta, et polynucleotide codant pour ce polypeptide | |
WO2001072800A1 (fr) | Nouveau polypeptide, proteine humaine d'echange nucleotidique 13 contenant un domaine de liaison atp/gtp, et polynucleotide codant pour ce polypeptide | |
WO2001070792A1 (fr) | Nouveau polypeptide, tyrosinase humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001074995A2 (fr) | Nouveau polypeptide, protéine humaine de mutation 15 de l'ataxie telangiectasie, et de polynucléotide codant pour ce polypeptide | |
WO2001072795A1 (fr) | Nouveau polypeptide, quinine reductase humaine 16, et polynucleotide codant pour ce polypeptide | |
WO2001064918A1 (fr) | Nouveau polypeptide, proteine humaine de translocation nucleaire 12 contenant un domaine de liaison atp/gtp, et polynucleotide codant pour ce polypeptide | |
WO2001072792A1 (fr) | Nouveau polypeptide, proteine humaine 13 analogue a l'ubiquitine, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |