WO2002012297A1 - Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2002012297A1 WO2002012297A1 PCT/CN2001/001015 CN0101015W WO0212297A1 WO 2002012297 A1 WO2002012297 A1 WO 2002012297A1 CN 0101015 W CN0101015 W CN 0101015W WO 0212297 A1 WO0212297 A1 WO 0212297A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- human
- sequence
- binding protein
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, namely human promyosin binding protein 9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
- the tropomyosin-binding protein (TR0P0M0DULIN) was first found in human red blood cells. It can bind tropomyosin but is different from actin. (FOWLER VM, 1990) It has now been found that genes encoding tropomyosin-binding proteins are expressed in important human tissues, but at different levels. According to the location of the tissue, it can be roughly divided into two types: muscle cells and non-muscle cells. The length of actin filaments in these two types of cells depends on the regulatory activity of capsid proteins at both ends.
- the tropomyosin-binding protein is the capping protein of the N-terminus of actin filaments, which can block the extension and disaggregation of actin filaments and achieve the function of participating in the composition and regulating the length of actin filaments.
- Promyosin binding protein can form a complex with tropomyosin and then bind to actin, but the binding force is greater than the binding force of tropomyosin alone to actin. Drop a lot.
- the gene encoding the tropomyosin binding protein has an open reading frame of 1077BP, which encodes a 359 amino acid polypeptide, and its molecular weight is estimated to be 40.6KD, and the? 1 value is 4.8.
- the secondary structure prediction of the peptide shows that the tropomyosin-binding protein may consist of a series of 7 or 8 short A-helix fragments and fold into a slightly compact form. This gene was genetically mapped and found to exist on human chromosomes 9Q22. 2-Q22.3. (SUNGLA ET.
- tropomyosin-binding protein A detailed understanding of the location and function of tropomyosin-binding protein has revealed its broad application prospects. For example, mutations in the gene encoding the myocardial tropomyosin binding protein will cause some serious cardiac muscle disorders such as cardiac hypertrophy and so on. (ANDERSON PAC, 1995) Therefore, the CDNAS, oligonucleotides, peptides, and antibodies of the human tropomyosin-binding protein provided by the present invention are useful for studying the formation of sarcomere in different tissues and cells, diagnosing related diseases, and screening inhibition. Agents or drugs have important value in treating these diseases.
- the human tropomyosin 9 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so the identification of more involved in these Process of human tropomyosin-binding protein 9 protein, especially the amino acid sequence of this protein is identified.
- the isolation of the new human tropomyosin-binding protein 9 gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human tropomyosin-binding protein 9.
- Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding human tropomyosin-binding protein 9.
- Another object of the present invention is to provide a method for producing human tropomyosin-9.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human tropomyosin-binding protein 9.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human tropomyosin-binding protein 9.
- Another object of the present invention is to provide a method for diagnosing and treating a disease associated with an abnormality of human tropomyosin-9.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 72-320 in SEQ ID NO: 1; and (b) a sequence having 1-512 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human tropomyosin 9 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of human tropomyosin 9 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human tropomyosin 9 protein.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, which The amino acid substituted in the amino acid has a structural or chemical property similar to that of the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acid ⁇ nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable substance or cell.
- ⁇ refers to a molecule that, when combined with human tropomyosin 9, causes the protein to change and thereby regulates the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human tropomyosin-binding protein 9.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human tropomyosin 9 when bound to human tropomyosin 9.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human tropomyosin-binding protein 9.
- Regular refers to a change in the function of human tropomyosin-binding protein 9, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human tropomyosin-binding protein 9. change.
- substantially pure ' means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
- Those skilled in the art can purify human tropomyosin-binding protein 9 using standard protein purification techniques. Basic The pure human myosin binding protein 9 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human myosin binding protein 9 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and suppress Binding of a homologous sequence to a target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
- the MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method checks the distance between all pairs. The groups of sequences are arranged into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the number of residues matching between sequence A and sequence X 100
- the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Clus ter method or by methods known in the art For example, Jotun He in determines the percent identity between nucleic acid sequences (He in J., (1990) Methods in erazumo logy 183: 625-645). 0 "Similarity" refers to the amino acid residues in the corresponding positions when the amino acid sequences are aligned. The degree of identical or conservative substitution of the radical.
- Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human tropomyosin-binding protein 9.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide exists in a living animal. It is not isolated, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated. '
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human tropomyosin-binding protein 9 means that human tropomyosin-binding protein 9 is essentially free of other proteins, lipids, sugars, or other substances that are naturally associated with it. Those skilled in the art can purify human tropomyosin 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human tropomyosin 9 polypeptide can be analyzed by amino acid sequence analysis.
- the present invention provides a new polypeptide, human tropomyosin-binding protein 9, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human tropomyosin-binding protein 9.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human tropomyosin 9 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such One, wherein the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
- an additional amino acid sequence is fused into the mature polypeptide
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of an amino acid encoding SEQ ID NO: 2 Polynucleotide composition of a polypeptide of the amino acid sequence.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 512 bases, and its open reading frames 72-320 encode 82 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to human tropomyosin-binding protein. It can be deduced that the human tropomyosin-binding protein 9 has a similar function to the human tropomyosin-binding protein.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be encoded or non-encoded.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50 ° /.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, preferably at least 100 nucleotides or more.
- Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human tropomyosin-binding protein 9.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human tropomyosin-binding protein 9 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDM of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene;).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecule ar Clinging, A Labora tory Manua l, Cold Harbor Labora tory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human tropomyosin-binding protein 9 transcripts; 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2,000 nucleotides, and preferably within 1,000 nucleotides.
- the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein products of human tropomyosin-binding protein 9 gene expression.
- ELISA enzyme-linked immunosorbent assay
- the RACE method RACE-rapid amplification of cDNA ends
- the primers can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by conventional methods.
- the amplified DM / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDM sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human tropomyosin 9 coding sequence, and a recombinant technology for producing the polypeptide of the present invention. method.
- a polynucleotide sequence encoding human tropomyosin-binding protein 9 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human tropomyosin-binding protein 9 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenopathy Toxic enhancer and so on.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human tropomyosin-binding protein 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the ( 12 method, the steps used are well known in the art.
- MgC 12 If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DM transfection methods can be selected: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipid Body packaging, etc.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human tropomyosin-binding protein 9 (Scence, 1984; 224: 1431). Generally, the following steps are taken:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include but Not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmosis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmosis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High performance liquid chromatography (HPLC
- FIG. 1 is a comparison diagram of gene chip expression profiles of human tropomyosin-binding protein 9 and human tropomyosin-binding protein of the present invention.
- the upper graph is a graph of the expression profile of human tropomyosin-binding protein 9, and the lower graph is the graph of the expression profile of human tropomyosin-binding protein.
- Figure 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of human tropomyosin-bound protein 9 isolated.
- 9kDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- CDM was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, PCR was performed using the following primers for PCR amplification:
- Primerl 5,-GAGTTGTTTTGGTTTTTCTTGTTT -3 '(SEQ ID NO: 3)
- Primer 2 5'- ATAAAGTGCAGTTTAAAGAGAATA -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp at the 5 'end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions 50 ⁇ l of KC1, 10 ⁇ l / L of Tris-CI, (pH8.5), 1.5mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
- PE9600 type DM Perkin-Elmer Co.
- the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-512bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human tropomyosin 9 gene expression:
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ), Mix and centrifuge. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH 7.4) -5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, place the filter in 1 x SSC-0.1% SDS Wash at 55 ° C for 30rain. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human tropomyosin-binding protein 9
- Primer3 5,-CCCCATATGATGACAAGTAAGGGTGACACCACT- 3, (Seq ID No: 5)
- Primer4 5'-CATGGATCCTTAAATGAAAAAGAAGTCAGTGGA-3 '(Seq ID No: 6)
- the two ends of the two primers have Ndel and BamHI restriction sites , followeded by the coding sequences of the 5 ,, and 3 'ends of the gene of interest, respectively, and the Ndel and BamHI restriction sites correspond to the selectivity on the expression vector plasmid pET-28b (+) (Novagei's product, Cat. No. 69865.3) Endonuclease site.
- the PCR reaction was performed using pBS-0042g03 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions are: pBS-0042g0 in a total volume of 50 ⁇ 1: plasmid 10 pg, primer Primer-3 and Primer-4 l0 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1.
- Cycle parameters 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
- Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into the colibacillus DH5 ⁇ by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0042g03) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- the host strain BL21 (pET-0042g03) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L. Continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidines (6His-Tag). Purified human tropomyosin 9 was purified.
- a peptide synthesizer (product of PE company) was used to synthesize the following human tropomyosin 9-specific peptides: NH2-Met-Thr-Ser-Lys-Gly-Asp-Thr-Thr-Phe-Leu-Lys-Asn- Asn-Lys-Ser- C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
- the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method Acid sequence or a homologous polynucleotide sequence thereof.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- IxSSC 0.1% SDS
- Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature, for example, refer to the documents DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And the documents Helle, RA, Schema, M. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-21
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
- Total raRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) by one-step method, and mRNA was purified by Oligotex mRNA Midi Kit (purchased from QiaGen), and the pod light reagent Cy3dUTP was separately reverse-transcribed (5— Amino— propargy 2 2— deoxyuridine 5'— triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) labeled mRNA of human mixed tissues, using a fluorescent reagent Cy5dUTP (5- Amino-propargyl-2'-deoxyur idine 5'-tr iphate coupled to Cy5 f luorescent dye, purchased Probes were prepared from Amersham Phamacia Biotech company) labeled with specific tissue (or stimulated cell line) mRNA. For specific steps and methods, see:
- Solut ion (purchased from TeleChem) was used for hybridization for 16 hours, and then washed with a washing solution (lx SSC, 0.2% SDS) at room temperature, and then scanned with a ScanArray 3000 scanner (purchased from General Scanning, USA). Images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are fetal brain, bladder mucosa, and PMA +
- Ecv304 cell line LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar into fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1 G13HC, bladder cancer Strains of cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell lines, placenta, spleen, prostate cancer, jejunum adenocarcinoma, cardiac cancer. Draw a graph based on these 18 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profiles of human tropomyosin 9 and human tropomyosin in the present invention are very similar. Industrial applicability
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human tropomyosin-9.
- Agonists enhance biological functions such as human tropomyosin-binding protein 9 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation such as various cancers.
- mammalian cells or a membrane preparation expressing human tropomyosin 9 can be cultured with labeled human tropomyosin 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human tropomyosin 9 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human tropomyosin 9 can bind to human tropomyosin 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
- human tropomyosin 9 When screening compounds as antagonists, human tropomyosin 9 can be added to the bioanalytical assay to determine whether the compound is Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as the above-mentioned decorated compounds. Polypeptide molecules capable of binding to human tropomyosin 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, 9 molecules of human tropomyosin should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against human tropomyosin-binding protein 9 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human tropomyosin 9 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
- Techniques for preparing monoclonal antibodies to human tropomyosin 9 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc.
- Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morr et al, PNAS, 1985, 81: 6851). 0
- Existing techniques for producing single-chain antibodies US Pa t No. 4946778) can also be used to produce single chain antibodies against human tropomyosin-binding protein
- Antibodies against human tropomyosin 9 can be used in immunohistochemistry to detect human tropomyosin 9 in biopsy specimens.
- Monoclonal antibodies that bind to human tropomyosin 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human tropomyosin 9 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human tropomyosin Binding protein 9 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to human tropomyosin-9. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human tropomyosin 9.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human tropomyosin 9 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the levels of human tropomyosin 9 detected in the test can be used to explain the importance of human tropomyosin 9 in various diseases and to diagnose diseases in which human tropomyosin 9 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human tropomyosin-binding protein 9 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human tropomyosin-9.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express the variant human tropomyosin-binding protein 9 to inhibit endogenous human tropomyosin-binding protein 9 activity.
- a mutated human tropomyosin-binding protein 9 may be a shortened human tropomyosin-binding protein 9 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity.
- the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human tropomyosin-9.
- Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human tropomyosin-binding protein 9 into cells.
- Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human tropomyosin-binding protein 9 can be found in the existing literature (Sarabrook, et al.).
- a recombinant polynucleotide encoding human tropomyosin-binding protein 9 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human tropomyosin 9 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription by encoding the DM sequence.
- This DM sequence is integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in various ways, such as To increase the sequence length on both sides, the linkage between ribonucleosides uses phosphothioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human tropomyosin binding protein 9 can be used for the diagnosis of diseases related to human tropomyosin binding protein 9.
- the polynucleotide encoding human tropomyosin-binding protein 9 can be used to detect the expression of human tropomyosin-binding protein 9 or abnormal expression of human tropomyosin-binding protein 9 in a disease state. Such as the expression status of the encoding human original white 9.
- Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a micro array or a chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue.
- Human plasmin-binding protein 9 specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) amplification in vitro to detect the human plasmin-binding protein 9 transcript.
- Detection of mutations in the human tropomyosin 9 gene can also be used to diagnose human tropomyosin 9 related diseases.
- the human tropomyosin binding protein 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human tropomyosin binding protein 9 DNA sequence. Mutations can be detected using well-known techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct a chromosome-specific c-leg bank.
- Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes can be refined in one step Perform chromosomal mapping accurately.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found, for example, in V. Mckusick, Mendel i an Inher i tance in Man (available online with Johns Hopk ins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceutical or biological products, which prompts permission for administration on the human body by government agencies that manufacture, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human tropomyosin 9 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of human tropomyosin 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Gastroenterology & Hepatology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU93641/01A AU9364101A (en) | 2000-06-21 | 2001-06-19 | A novel polypeptide- human tropodulin 9 and the polynucleotide encoding said polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00116683.2 | 2000-06-21 | ||
CN00116683A CN1329091A (zh) | 2000-06-21 | 2000-06-21 | 一种新的多肽——人原肌球结合蛋白9和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2002012297A1 true WO2002012297A1 (fr) | 2002-02-14 |
Family
ID=4586085
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/001015 WO2002012297A1 (fr) | 2000-06-21 | 2001-06-19 | Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1329091A (fr) |
AU (1) | AU9364101A (fr) |
WO (1) | WO2002012297A1 (fr) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108913655B (zh) * | 2018-07-16 | 2022-07-15 | 浙江大学 | 基于多能干细胞技术建立“人源性”心肌肥大模型的方法 |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999054491A1 (fr) * | 1998-04-20 | 1999-10-28 | Children's Hospital Medical Center | Utilisation de promoteurs a chaine lourde de la myosine murine en therapie genique et dans la production d'animaux transgeniques |
-
2000
- 2000-06-21 CN CN00116683A patent/CN1329091A/zh active Pending
-
2001
- 2001-06-19 WO PCT/CN2001/001015 patent/WO2002012297A1/fr active Application Filing
- 2001-06-19 AU AU93641/01A patent/AU9364101A/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999054491A1 (fr) * | 1998-04-20 | 1999-10-28 | Children's Hospital Medical Center | Utilisation de promoteurs a chaine lourde de la myosine murine en therapie genique et dans la production d'animaux transgeniques |
Also Published As
Publication number | Publication date |
---|---|
CN1329091A (zh) | 2002-01-02 |
AU9364101A (en) | 2002-02-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001072786A1 (fr) | Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide | |
WO2002012297A1 (fr) | Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001075048A2 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide | |
WO2002006470A1 (fr) | Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide | |
WO2002040525A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 18.92, et polynucleotide codant ce polypeptide | |
WO2001092518A1 (fr) | Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide | |
WO2001085752A1 (fr) | Polynucleotide codant un peptide de myosine | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001072785A1 (fr) | Nouveau polypeptide, proteine humaine helice-boucle-helice 17 (b-hlh), et polynucleotide codant pour ce polypeptide | |
WO2002020595A1 (fr) | Nouveau polypeptide, proteine a doigt de zinc humaine 18.04, et polynucleotide codant ce polypeptide | |
WO2002026971A1 (fr) | Nouveau polypeptide, facteur de transcription humain lcr-f112.1, et polynucleotide codant ce polypeptide | |
WO2002020575A1 (fr) | Nouveau polypeptide, proteine humaine 10 associee aux maladies auto-immunes, et polynucleotide codant ce polypeptide | |
WO2002000833A2 (fr) | Nouveau polypeptide, proteine 113.31 d'acide gamma carboxyglutamique riche en proline, et polynucleotide codant ce polypeptide | |
WO2001094534A2 (fr) | Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide | |
WO2002000825A2 (fr) | Nouveau polypeptide, antigene stromal proteique nucleaire 110.34, et polynucleotide codant ce polypeptide | |
WO2001072792A1 (fr) | Nouveau polypeptide, proteine humaine 13 analogue a l'ubiquitine, et polynucleotide codant pour ce polypeptide | |
WO2001092328A1 (fr) | Nouveau polypeptide, proteine humaine 10.78 du gene cancerigene tre, et polynucleotide codant ce polypeptide | |
WO2002006473A1 (fr) | Nouveau polypeptide, proteine humaine 10.01 associee au recepteur d'oestrogene, et polynucleotide codant ce polypeptide | |
WO2001072807A1 (fr) | Nouveau polypeptide, neuropeptide humain 11, et polynucleotide codant pour ce polypeptide | |
WO2001090131A1 (fr) | Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide | |
WO2002012486A1 (fr) | Nouveau polypeptide, recepteur humain de la serine kinase 10.34, et polynucleotide codant ce polypeptide | |
WO2001075020A2 (fr) | Nouveau polypeptide, neuroproteine humaine y 11, et polynucleotide codant pour ce polypeptide | |
WO2002020778A1 (fr) | Nouveau polypeptide, thyrocalcitonine 15.18, et polynucleotide codant ce polypeptide | |
WO2002048357A1 (fr) | Nouveau polypeptide, sous-unite du compose c0p9 humaine 37.62, et polynucleotide codant ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |