WO2001092518A1 - Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001092518A1
WO2001092518A1 PCT/CN2001/000842 CN0100842W WO0192518A1 WO 2001092518 A1 WO2001092518 A1 WO 2001092518A1 CN 0100842 W CN0100842 W CN 0100842W WO 0192518 A1 WO0192518 A1 WO 0192518A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
related protein
human ccr4
sequence
Prior art date
Application number
PCT/CN2001/000842
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU89490/01A priority Critical patent/AU8949001A/en
Publication of WO2001092518A1 publication Critical patent/WO2001092518A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7158—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for chemokines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide ⁇ ⁇ CCR4 related protein 9.5, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • Carbon metabolism by-product repressor protein is a transcription regulation protein commonly found in organisms. By forming a multi-subunit complex in the body, it can affect the expression of many genes.
  • CCR4 does not bind to DNA, it can stimulate the transcription process after binding to abnormal DM-binding domains.
  • CCR4 is glucose-regulated.
  • the two transcriptional regulatory domains one is glucose-related and contains a glutamate-proline-rich structural region, which is very similar to the structural regions contained in many transcription factors found in eukaryotes. similar.
  • Studies have found that if CCR4 lacks a leucine repeat structure and a C-terminus, its two transcriptional regulatory domains cannot form a functional CCR4. Therefore, the leucine repeat structure and C-terminus are critical for linking two transcriptional regulatory domains to form a complete CCR4 (Mol Cel l Biol 1994 Jul; 14 (7): 4522-31).
  • the yeast CCR4 protein is an indispensable protein in the expression of some non-fermentative growth regulating genes (such as glucose-suppressing alcohol dehydrogenase ADH2, etc.), and it is also a correction gene for the SPT6 and SPT10 mutant genes, and SPT6 and SPT10 are It is useful to maintain the stability of chromatin (Mol Cel l Biol 1994 Jul; 14 (7): 4522-31).
  • CCR4 related protein-CAF1 (P0P2) is a component protein of the CCR4 complex. Its human CCR4 related protein has been found in many organisms, such as humans, nematodes, xenopus, mice, yeast, and so on. The main function of CCR4-related protein (CAF1) in organisms is to regulate the transcription process.
  • CAF1 CCR4-related protein
  • CCR4 can affect the expression of genes in many yeasts by forming multi-subunit complexes.
  • DBF2 Cell cycle-regulated kinase
  • CCR4 forms a complex with CCR4 and CAF-1 / P0P2, and the gene expression in the cell cycle and the subsequent mitotic gene transcription process Plays an important role in it (EMBO J 1997 Sep 1; 16 (17): 5289-98).
  • Human B-cell translocation protein (BTG1) is a tumor suppressor because its overexpression inhibits the proliferation of NIH 3T3 cells.
  • the carbon metabolism byproduct repressor protein (CCR4) binding factor (hCAF-1) is homologous to murine CAF-1 and CAF-1 / P0P2 of Saccharomyces cerevisiae. In vitro, the formation of the hCAF-1 / BTG1 complex is dependent on the phosphorylation of the p34cdc2 kinase site of BTG1 (Ser-159).
  • the hCAF- 1 / BTG1 complex plays an important and obvious role in regulating cell division and cell proliferation (BiochemJ 1998 Dec 1; 336 (Pt 2): 471-81); (Wilcox, Scott, Subramanian, Ross, Adams-Burton, Stoltenborg and Cor jay (1995) Circulation 92, 134-135).
  • the polypeptide of the present invention was inferred and identified as human CCR4 related protein 31 (HCCR4RP31 or HCAF31), and its human CCR4 related protein was mouse CCR4 related protein (mCAFl), and its protein number was U21855.
  • the human CCR4-related protein 9.5 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes.
  • Human CCR4 related protein 9.5 protein especially the amino acid sequence of this protein is identified '.
  • the isolation of newcomer CCR4-related protein 9.5 protein-coding genes also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human CCR4-related protein 9.5.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human CCR4 related protein 9.5.
  • Another object of the present invention is to provide a method for producing human CCR4-related protein 9.5.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human CCR4-related protein 9.5.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human CCR4 related protein 9.5.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in the human CCR4-related protein 9.5. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 2108-2368 in SEQ ID NO: 1; and (b) a sequence having 1-2665 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human CCR4-related protein 9.5 protein, which comprises using the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of a human CCR4 related protein 9.5 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human CCR4-related protein 9.5.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of the inventor's CCR4-related protein 9.5 and human CCR4-related protein.
  • the upper graph is a histogram of the expression profile of human CCR4 related protein 9.5
  • the lower graph is the histogram of the expression profile of human CCR4 related protein.
  • 1-bladder mucosa 2-PMA + Ecv304 cell line, 3-LPS + Ecv304 cell line thymus, 4-normal fibroblasts 102.4NC, 5- Fibroblas t, growth factor stimulation, 1024NT, 6- scar growth into fc Factor stimulation, 1013HT, 7-scar scar into fc without stimulation with growth factor, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13- Placenta, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human CCR4-related protein 9.5. 9. 5kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genome or a synthesis DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule
  • polypeptide or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with a human CCR4-related protein 9.5, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human CCR4-related protein 9.5.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human CCR4-related protein 9.5 when combined with human CCR4-related protein 9.5.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human CCR4-related protein 9.5.
  • Regular refers to a change in the function of human CCR4 related protein 9.5, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human CCR4 related protein 9.5 change.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human CCR4-related protein 9.5 using standard protein purification techniques.
  • Substantially pure human CCR4-related protein 9.5 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human CCR4-related protein 9.5 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology A partially complementary sequence that at least partially inhibits the hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences based on different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art, such as Jotun Hein (Hein J., (1990) Methods in enzyraology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human CCR4-related protein 9.5.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, Natural environment).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human CCR4 related protein 9.5 refers to human CCR4 related protein 9.5 is substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human CCR4-related proteins 9.5 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human CCR4-related protein 9.5 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide ⁇ ACCR4-related protein 9. 5 which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of the human CCR4-related protein 9.5.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human CCR4-related protein 9.5 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a type in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a type in which the additional amino acid sequence is fused into the mature polypeptide and the polypeptide sequence is formed (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 2665 bases, and its open reading frame 2108-2368 encodes 86 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with human CCR4 related proteins, and it can be inferred that the human CCR4 related protein 9.5 has similar functions to human CCR4 related proteins.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DNA forms include cDM, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • the invention also relates to nucleic acid fragments that hybridize to the sequences described above.
  • “core The "acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides. Nucleic acid fragments It can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human CCR4-related protein 9.5.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human CCR4-related protein 9.5 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate oiRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDM libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of transcripts of human CCR4-related protein 9.5; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein products of the human CCR4-related protein 9.5 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method (Sa iki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DM / RNA is preferably used to obtain the gene of the present invention. Especially difficult to get from the library
  • the MCE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately selected according to the polynucleotide sequence information of the present invention disclosed herein, and conventional methods can be used.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 546 3- 5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human CCR4-related protein 9.5 coding sequence, and a recombinant technology to produce a polypeptide of the present invention. method.
  • a polynucleotide sequence encoding a human CCR4-related protein 9.5 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human CCR4-related protein 9.5 and suitable transcription / translation regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, in vivo recombination technology, and the like (Sambroook, et al. Molecular Cloning, a Labora tory Manua, Co. Harbor Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 Base pairs, acting on a promoter to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human CCR4 related protein 9.5 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the present invention is the use of polynucleotide sequences may be used to express or produce recombinant CCR4 protein associated 9. 5 (Science, 1984; 224 : 1431) 0 in general the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, or expressed on a cell membrane, or secreted Out of the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases, etc. .
  • the polypeptide (human CCR4 related protein 9. 5) of the present invention is an interaction protein of carbon metabolism by-product repressor protein (CCR4). Its main function is to regulate the transcription process of genes. According to existing research, the polypeptide of the present invention can play an important role in cell cycle gene expression and subsequent mitotic gene transcription process; the polypeptide of the present invention can interact with human The B-cell translocation protein BTG1 forms the hCAF-1 / BTG1 complex, which has important and obvious regulatory effects on cell division and cell proliferation; the polypeptide of the present invention can also regulate some non-fermentative growth through its interaction with CCR4 Regulating the expression process of genes (such as glucose-inhibiting alcohol dehydrogenase ADH2, etc.); The polypeptide of the present invention can also be used indirectly as a correction gene for SPT6 and SPT10 mutant genes, and therefore has the effect of maintaining the stability of chromatin.
  • CCR4 carbon metabolism by-product repressor protein
  • the polypeptide of the present invention can be used for the diagnosis and treatment of many diseases, such as malignant tumors, endocrine system diseases, neurological diseases, immune diseases, human acquired immune deficiency syndrome (AIDS), and the like.
  • diseases such as malignant tumors, endocrine system diseases, neurological diseases, immune diseases, human acquired immune deficiency syndrome (AIDS), and the like.
  • AIDS human acquired immune deficiency syndrome
  • -Developmental disorders that can be treated using the polypeptides of the present invention include: Sexual dwarfism, spinal epiphyseal dysplasia, pseudochondral dysplasia, Langer-Giedion syndrome, funnel chest, gonad hypoplasia, 'congenital adrenal hyperplasia, upper urethra, cryptorchidism, short stature syndrome (Such as Conradi syndrome and Danbol t_Closs syndrome), congenital glaucoma or cataract, congenital lens position abnormality, congenital blepharoplasia, retinal dysplasia, congenital optic nerve atrophy, congenital sensorineural hearing loss, split hand cleft Podiatry, Teratology, Williams Syndrome, Alagi lle Syndrome, Behweiler Syndrome, etc.
  • Various tumors that can be treated using the polypeptide of the present invention include: epithelial tissues (such as basal epithelium, squamous epithelium, mucus cells, etc.), soft tissues (such as fibrous tissue, adipose tissue, cartilage tissue, smooth muscle tissue, blood vessels and lymphatic vessels) Skin tissue, etc.), hematopoietic tissue (such as B cells, T cells, tissue cells, etc.), tumors of central nervous tissue, peripheral nerve tissue, endocrine tissue, gonadal tissue, special tissue (such as dental tissue, etc.), such as Gastric cancer, liver cancer, colorectal cancer, breast cancer, lung cancer, Prostate cancer, cervical cancer, pancreatic cancer, esophageal cancer, etc.
  • epithelial tissues such as basal epithelium, squamous epithelium, mucus cells, etc.
  • soft tissues such as fibrous tissue, adipose tissue, cartilage tissue, smooth muscle tissue, blood vessels and lymphatic vessels
  • the polypeptide of the present invention is also an immunomodulatory agent and has an immune promoting or immunosuppressing effect.
  • the polypeptides of the present invention are useful in the treatment of a number of diseases, including non-response to the immune response, or abnormal immune response, or ineffective host defense.
  • the polypeptides and antibodies of the present invention also have effects on damage, defects or disorders of immune tissues, especially for diseases of the hematopoietic system (such as malignant anemia), skin diseases (such as psoriasis), and autoimmune diseases (such as rheumatoid arthritis). ), Radiation diseases and the production and regulation of immune lymphocytes are extremely closely related.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human CCR4-related protein 9.5.
  • Agonists enhance human CCR4-related proteins 9.5 stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing human CCR4-related protein 9.5 and a labeled human CCR4-related protein 9.5 can be cultured together in the presence of a drug. The ability of the drug to increase or suppress this interaction is then determined.
  • Antagonists of human CCR4-related protein 9.5 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human CCR4-related protein 9.5 can bind to human CCR4-related protein 9.5 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide such that the polypeptide cannot exert its biology Features.
  • human CCR4 related protein 9.5 can be added to the bioanalytical assay, by measuring the effect of the compound on the interaction between human CCR4 related protein 9.5 and its receptor To determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Peptide molecules capable of binding to human CCR4 related protein 9.5 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, 9.5 molecules of human CCR4-related protein should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human CCR4 related protein 9.5 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced using human CCR4-related proteins. 9. Directly injected into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait. Techniques for preparing monoclonal antibodies to human CCR4-related protein 9.5 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta- Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that combine human constant regions with non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851) and existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human CCR4-related protein 9.5.
  • Antibodies against human CCR4-related protein 9.5 can be used in immunohistochemical techniques to detect human CCR4-related protein 9.5 in biopsy specimens. .
  • Monoclonal antibodies that bind to human CCR4-related protein 9.5 can also be labeled with radioisotopes, and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • 5 High affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human CCR4-related protein 9.5 positive cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to the human CCR4-related protein 9.5. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human CCR4-related protein 9.5.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human CCR4-related protein 9.5.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human CCR4 related protein 9.5 detected in the test can be used to explain the importance of human CCR4 related protein 9.5 in various diseases and to diagnose diseases in which human CCR4 related protein 9.5 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human CCR4-related protein 9.5 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human CCR4-related protein 9.5.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human CCR4-related protein 9.5 to inhibit endogenous human CCR4-related protein 9.5 activity.
  • a mutated human CCR4 related protein 9.5 may be a shortened human CCR4 related protein 9.5 lacking a signaling functional domain, and although it can bind to downstream substrates, it lacks signaling activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human CCR4-related protein 9.5.
  • Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfect a polynucleotide encoding human CCR4 related protein 9.5 Move into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human CCR4-related protein 9.5 can be found in existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human CCR4-related protein 9.5 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RM and DNA
  • ribozymes that inhibit the human CCR4-related protein 9.5 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with the complementary target UNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM. This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding the human CCR4-related protein 9.5 can be used for the diagnosis of diseases related to the human CCR4-related protein 9.5.
  • the polynucleotide encoding human CCR4-related protein 9.5 can be used to detect the expression of human CCR4-related protein 9.5 or the abnormal expression of human CCR4-related protein 9.5 in a disease state.
  • the DM sequence encoding human CCR4 related protein 9.5 can be used to hybridize biopsy specimens to determine the expression of human CCR4 related protein 9.5.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These technical methods are all mature technologies that are publicly available, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DM chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human CCR4-related protein 9.5 specific primers for RM-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human CCR4-related protein 9.5 transcription products.
  • Detection of mutations in the human CCR4 related protein 9.5 gene can also be used to diagnose human CCR4 related protein 9.5 related diseases.
  • the human CCR4 related protein 9. 5 mutant forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild type human CCR4 related protein 9. 5 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will be specific to someone The chromosome is in a specific location and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used in PCR to select somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers, the containers containing one or more An ingredient of the pharmaceutical composition of the present invention.
  • the containers containing one or more An ingredient of the pharmaceutical composition of the present invention.
  • there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human CCR4-related protein 9.5 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human CCR4-related protein 9.5 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cMA cloning kit purchased from Clontech
  • Clontech was used to insert the 00 fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5a.
  • the bacteria formed a cDNA library.
  • Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0675h03 was new DNA.
  • a series of primers were synthesized to perform bidirectional determination of the inserted cDM fragments contained in this clone.
  • the 0675h03 clone contains a full-length cDNA of 2665bp (as shown in Seq ID NO: l), and has a 261bp open reading frame (0RF) from 2108bp to 2368bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • This clone pBS-0675h03 and the encoded protein was named human CCR4-related protein 9.5.
  • Example 2 Cloning of a gene encoding human CCR4-related protein 9.5 by RT-PCR
  • CDNA was synthesized by using the total RM of fetal brain cells as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, PCR was performed using the following primers: Pr imer 1: 5,-GGGACCAGGGATAGGACTCCAGTT —3, (SEQ ID NO: 3)
  • Pr imer2 5'- GCAGAGGAACATGTGCATGCTAGG -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50 mmol / L KCl, 10 mmol / L Tris-HCl pH 8.50, 1.5 mmol / L MgCl 2 , 2 (mol / L dNTP, 1 Opmol primer, 1U Taq DNA polymerase (C 1 on tech company).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perk i n E 1 mer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. Set ⁇ -act in as a positive control and template blank as a negative control at the same time during RT-PCR.
  • the amplification products were purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invi trogen). Product). D sequence analysis results show that the DM sequence of the PCR product is exactly the same as 1 to 2665bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human CCR4 related protein 9.5 gene expression
  • RNA extraction in one step [Anal. Biochera 1987, 162, 156-159].
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49 : 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) and a nitrocellulose membrane to which A was transferred were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM H 2 PO 4 (pH 7.4)-5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter membrane was at 1 x SSC-0.1% SDS was washed at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human CCR4 related protein 9.5
  • Pr imer 3 5'-CATGCTAGCATGTCTTTTATATATATTTCAAAA-3 '(Seq ID No: 5)
  • Pr iraer4 5'-CCCGAGCTCTTAGAGGAAAGAGTAAAAAGGACT-3' (Seq ID No: 6)
  • the two ends of these two primers contain Nhel and Sacl digestion respectively Locus, followed by the target gene 5, respectively And the 3 'end coding sequence, the Nhel and Sacl restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3).
  • the pBS-0675h03 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions are: pBS-0675h03 plasmid containing 10pg, primers in a total volume of 50 ⁇ 1] ⁇ 1116]: -3 and? 1 1116]: —4 points and another!]
  • 10 11101 Advantage polymerase Mix
  • Cycle parameters 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
  • Nhel and Sacl were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into Ca. bacillus DH5a by the calcium chloride method.
  • a peptide specific to human CCR4-related protein 9.5 was synthesized using a peptide synthesizer (product of PE company): NH2-Met-Ser-Phe-I le-Tyr-I le-Ser-Lys-Pro-I le-Met -Leu-Ser-Gln-Gln-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • oligonucleotide fragments from the polynucleotides of the present invention for use as hybridization probes. Uses: if the probe can be used to hybridize to the genomic or cDNA library of normal tissue or pathological tissue from different sources to identify whether it contains the polynucleotide sequence of the present invention and detect a homologous polynucleotide sequence, it can further be used The probe detects whether the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof is abnormally expressed in cells of normal tissue or pathological tissue.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt): 5-TGTCTTTTATAATATATTTCAAAACCAATCATGCTTTCCCAA-3 '(SEQ ID NO: 8)
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (right) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose
  • Two NC 'membranes are required for each probe, so that it can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the sample film was placed in a plastic bag pre-hybridization solution was added 3-10m g (10xDenhardt- s; 6xSSC, 0. lmg / ml CT DNA ( calf thymus DNA)). After closing the bag, 68. C water bath for 2 hours.
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer components to achieve the purpose of analyzing biological information quickly, efficiently, and in a high throughput.
  • the polynucleotide of the present invention can be used as Targeting D for gene chip technology for high-throughput research on new gene functions; finding and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases.
  • the specific method steps have been reported in the literature. For example, see the documents DeRis i, JL, Lyer, V. & Brown, PO (1997) Science 278, 680-686. And the documents Helle, RA, Schema, M. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRM was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5> -tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino —Propargyl-2'-deoxyuridine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled mRM specific body tissues (or stimulated cell lines), and prepared probes after purification.
  • Cy3dUTP 5-Amino-propargyl-2'-deoxyuridine 5> -tr iphate coupled to Cy3
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar-like fc growth factor Stimulation, 1013HT, scar into fc without stimulation with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Based on these 17 Cy3 / Cy5 ratios, a histogram is drawn (Figure 1). It can be seen from the figure that the expression profile of human CCR4 related protein 9.5 and human CCR4 related protein according to the present invention are very similar.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine 9.5 associée à la CCR4, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine humaine 9.5 associée à la CCR4.
PCT/CN2001/000842 2000-05-24 2001-05-21 Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide WO2001092518A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU89490/01A AU8949001A (en) 2000-05-24 2001-05-21 A novel polypeptide, a human ccr4 relative protein 9.5 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115846.5 2000-05-24
CN 00115846 CN1324862A (zh) 2000-05-24 2000-05-24 一种新的多肽——人ccr4相关蛋白9.5和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001092518A1 true WO2001092518A1 (fr) 2001-12-06

Family

ID=4585288

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000842 WO2001092518A1 (fr) 2000-05-24 2001-05-21 Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1324862A (fr)
AU (1) AU8949001A (fr)
WO (1) WO2001092518A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105462929B (zh) * 2014-06-13 2019-11-22 中国人民解放军军事医学科学院毒物药物研究所 一种筛选ccr4拮抗剂的细胞模型及筛选方法

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 23 November 1999 (1999-11-23), XP002905543, accession no. EMBL Database accession no. Z82975.1 *
DATABASE GENBANK [online] 23 November 1999 (1999-11-23), XP002905544, accession no. EMBL Database accession no. AL023877.1 *
DATABASE GENBANK [online] 23 November 1999 (1999-11-23), XP002905545, accession no. EMBL Database accession no. AL034408.2 *
DATABASE GENBANK [online] 23 November 1999 (1999-11-23), XP002905546, accession no. EMBL Database accession no. Z98052.1 *
DATABASE GENBANK [online] 23 November 1999 (1999-11-23), XP002905547, accession no. EMBL Database accession no. Z95126.1 *

Also Published As

Publication number Publication date
CN1324862A (zh) 2001-12-05
AU8949001A (en) 2001-12-11

Similar Documents

Publication Publication Date Title
WO2001090176A1 (fr) Nouveau polypeptide, keratine humaine 45.87, et polynucleotide codant ce polypeptide
WO2001092518A1 (fr) Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide
WO2001092319A1 (fr) NOUVEAU POLYPEPTIDE, RECEPTEUR HUMAIN 19.68 DE L'INTERFERON α, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2002014510A1 (fr) Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide
WO2001066730A1 (fr) Nouveau polypeptide, proteine humaine rs3 12, et polynucleotide codant pour ce polypeptide
WO2001090133A1 (fr) Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide
WO2001092515A1 (fr) Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide
WO2002040525A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 18.92, et polynucleotide codant ce polypeptide
WO2002006470A1 (fr) Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide
WO2002012297A1 (fr) Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide
WO2001092315A1 (fr) Nouveau polypeptide, proteine humaine d'epissage 10.56, et polynucleotide codant ce polypeptide
WO2001090352A1 (fr) Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide
WO2001094537A2 (fr) Nouveau polypeptide, nadh-ubiquinone oxydoreductase humaine 21.89, et polynucleotide codant ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001094534A2 (fr) Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide
WO2001092516A1 (fr) Nouveau polypeptide, proteine ribosomale s19e 13, et polynucleotide codant ce polypeptide
WO2002026971A1 (fr) Nouveau polypeptide, facteur de transcription humain lcr-f112.1, et polynucleotide codant ce polypeptide
WO2002000835A2 (fr) Nouveau polypeptide, proteine de transcription humaine 23, et polynucleotide codant ce polypeptide
WO2001090172A1 (fr) Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide
WO2001094533A2 (fr) Nouveau polypeptide, proteine humaine 13 de regulation de la proteine phosphorylase, et polynucleotide codant ce polypeptide
WO2001092324A1 (fr) Nouveau polypeptide, nucleoproteine humaine 10.78 basophile, et polynucleotide codant ce polypeptide
WO2001090379A1 (fr) Nouveau polypeptide, nucleoproteine basophile humaine 22.55, et polynucleotide codant ce polypeptide
WO2001090351A1 (fr) Nouveau polypeptide, facteur humain 13.31 de liaison d'interleukine, et polynucleotide codant ce polypeptide
WO2001094536A2 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 10.89, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP