WO2001092315A1 - Nouveau polypeptide, proteine humaine d'epissage 10.56, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine d'epissage 10.56, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001092315A1
WO2001092315A1 PCT/CN2001/000828 CN0100828W WO0192315A1 WO 2001092315 A1 WO2001092315 A1 WO 2001092315A1 CN 0100828 W CN0100828 W CN 0100828W WO 0192315 A1 WO0192315 A1 WO 0192315A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
protein
human
sequence
Prior art date
Application number
PCT/CN2001/000828
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU89483/01A priority Critical patent/AU8948301A/en
Publication of WO2001092315A1 publication Critical patent/WO2001092315A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide-human cleavage protein 1 0.56, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide. Control technique background
  • the gene transcription precursor raRNA product generally lacks biological activity and needs to be sheared before it becomes an active RM.
  • the structural genes of most eukaryotic genes contain intervening sequences, so-called gene discontinuities, so the transcription products need to go through the intron sequence through cutting and other processes.
  • the shearing process is the process of removing introns from the precursor mRNA. This process is accomplished through a two-step phosphoryl transfer reaction. In the first step, 5, the exon is cut open to form a lasso-like intermediate. In the second step, 3, the cleavage site is cut, the exons are joined together, and the intron is released. This process is catalyzed by a class of multi-component enzymes called shearers.
  • the human PRP17 protein of PRP17 has also been found in humans, and is 36% similar to yeast PRP17. At the same time, I found three other PRP17 proteins. This shows that the second step of the shearing process is a fairly conservative process [EMB0 J '1998 Apr 1; 17 (7): 2095-106].
  • bladder mucosa PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblast 1024NC, Fibrobla st, growth factor stimulation, 1024NT, scar into fc growth factor stimulation, 101 3HT, scar Not stimulated by growth factors, 1013HC, bladder cancer cell line EJ, bladder cancer parasite, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardia cancer, polypeptide of the present invention Is very similar to the expression profile of human PRP17 protein, so the functions of the two may also be similar.
  • the present invention is named human shear protein 10.56.
  • the human shear protein 10.56 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these The process of human shear protein 10.56 protein, especially to identify this The amino acid sequence of the protein.
  • the isolation of the new human splicing protein 10.56 protein coding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of disease diagnosis and / or therapeutic drugs, so it is very important to isolate the DNA encoding it. Purpose of the invention
  • An object of the present invention is to provide an isolated new polypeptide-human cleavage protein 10.56 and fragments, analogs and derivatives thereof.
  • Another object of the present invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human cleavage protein 10.56.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human splicing protein 10.56.
  • Another object of the present invention is to provide a method for producing human cleaved protein 10.56.
  • Another object of the present invention is to provide an antibody against human splicing protein 10.56 of the polypeptide of the present invention.
  • Another object of the present invention is to provide analog compounds, antagonists, agonists, and inhibitors for the human cleavage protein 10.56 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to the abnormality of human splicing protein 10.56. Summary of the invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant thereof, a biologically active fragment or derivative.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide, which comprises a nucleotide sequence selected from the group or a variant thereof:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) the sequence of positions 445-735 in SEQ ID NO: 1; and (b) the sequence of 1-1379 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector containing the polynucleotide of the invention, especially an expression vector;
  • Host cells genetically engineered with the vector include transformed, transduced or transfected host cells; a method for preparing the polypeptide of the present invention including culturing the host cell and recovering the expression product.
  • the invention also relates to an antibody which can specifically bind to the polypeptide of the invention.
  • the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human spliced protein 10.56 protein, which includes using the polypeptide of the present invention.
  • the invention also relates to the compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of diseases or disease susceptibility associated with abnormal expression of human spliced protein 10.56 protein, including detection of mutations in the polypeptide or its encoding polynucleotide sequence in a biological sample, or detection The amount or biological activity of the polypeptide of the invention in a biological sample.
  • the present invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising the polypeptide of the present invention or its mimetics, activator, antagonist or inhibitor, and a pharmaceutically acceptable carrier.
  • the invention also relates to the use of the polypeptides and / or polynucleotides of the invention in the preparation of a medicament for the treatment of cancer, developmental diseases or immune diseases or other diseases caused by abnormal expression of human spliced protein 10.56.
  • Fig. 1 is a comparison diagram of gene chip expression profiles of human shear protein 10.56 and human PRP17 protein of the present invention.
  • the upper figure is the expression profile of human shear protein 10.56, and the lower figure is the expression profile of human PRP17 protein.
  • 1-bladder mucosa 2-PMA + Ecv304 cell line, 3-LPS + Ecv304 cell line thymus, 4-normal fibroblast 1024NC, 5-Fibroblas t, growth factor stimulation, 1024NT, 6-scar into fc growth factor Stimulation, 1013HT, 7-scar into fc without growth factor stimulation, 1013HC, 8-bladder cancer cell line EJ, 9- bladder cancer parasite, 10-bladder cancer, 1.1-liver cancer, 12-liver cancer cell line, 13-fetal Skin, 14-spleen, 15-prostate cancer, 16-jejunal adenocarcinoma, 17 cardia cancer.
  • Figure 2 is a polyacrylamide gel electrophoresis diagram (SDS-PAGE) of the isolated human shear protein 10.56.
  • l lkDa is the molecular weight of the protein.
  • the arrows indicate the separated protein bands.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense chain.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence with one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, where the amino acids replaced have structural or chemical properties similar to the original amino acids, such as the replacement of isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to a change in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a molecule that occurs naturally.
  • Replacement refers to the replacement of one or more amino acids or nucleotides by different amino acids or nucleotides.
  • Bioactivity refers to proteins that have the structure, regulation, or biochemical functions of natural molecules.
  • immunological activity refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce specific immune responses and bind to specific antibodies in suitable animals or cells.
  • Agonist refers to a molecule that, when combined with human cleavage protein 10.56, can cause the protein to change and thereby regulate the activity of the protein. Agonists may include proteins, nucleic acids, carbohydrates, or any other molecules that can bind human cleavage protein 10.56.
  • Antagonist refers to a molecule that can block or regulate the biological activity or immunological activity of human cleaved protein 10.56 when it binds to human cleaved protein 10.56.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecules that can bind human cleavage protein 10.56.
  • Regular refers to changes in the function of human shear protein 10.56, including an increase or decrease in protein activity, changes in binding properties, and any other biological, functional, or immunological properties of human shear protein 10.56 change.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances naturally associated with it.
  • Those skilled in the art can use standard protein purification techniques to purify human shear protein 10.56.
  • the substantially pure human shear protein 10.56 can produce a single main band on a non-reducing polyacrylamide gel.
  • Man shear The purity of the 10.56 polypeptide of cleaved protein can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base pairing under allowed salt concentration and temperature conditions.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant impact on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity, and may be partially or completely homologous.
  • "Partial homology” refers to a partially complementary sequence that at least partially inhibits the hybridization of a completely complementary sequence and a target nucleic acid. The inhibition of such hybridization can be detected by hybridization (Southern blot or Northern blot, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the reduced stringency conditions allow non-specific binding, because the reduced stringency conditions require that the two sequences bind to each other in a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madison Wi s.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi ggins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method compares each sequence by checking the distance between all pairs Group sequences are arranged in clusters. Then the clusters are allocated in pairs or groups. The percentage of identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues that match between sequences
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods well known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions when the amino acid sequences are aligned.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; uncharged head groups have Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence complementary to a specific DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand complementary to “sense strand”.
  • Derivative refers to HFP or a chemical modification encoding its nucleic acid. This chemical modification may be replaced by an alkyl group, an acyl group, or an amino group. Nucleic acid derivatives can encode major organisms that retain natural molecules Peptides with scientific properties.
  • Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b ') 2 and F V, which specifically binds to human protein antigens 10.56 shear determinant.
  • Humanized antibody refers to an antibody whose amino acid sequence in a non-antigen binding region has been replaced to become more similar to a human antibody, but still retain the original binding activity.
  • the term "separated” refers to the removal of matter from its original environment (for example, if it occurs naturally, it refers to its natural environment).
  • a naturally-occurring polynucleotide or peptide exists in a living thing but it is not isolated, but the same polynucleotide or peptide is separated from some or all substances that coexist with it in a natural system.
  • Such a polynucleotide may be part of a certain vector, or such polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated means that the substance is separated from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in the natural state in living cells are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human shear protein 10.56 means that human shear protein 10.56 is substantially free of other proteins, lipids, sugars, or other substances that are naturally associated with it. Those skilled in the art can use standard protein purification techniques to purify human shear protein 10.56. A substantially pure polypeptide can produce a single main band on a non-reduced polyacrylamide gel. Human cleaved protein 10. 56 The purity of the peptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide-human cleavage protein 10. 56, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, preferably a recombinant polypeptide.
  • the polypeptide of the present invention may be a naturally purified product, or a chemically synthesized product, or produced from a prokaryotic or eukaryotic host (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technology. Depending on the host used in the recombinant production protocol, the polypeptide of the present invention may be glycosylated or may be non-glycosylated.
  • the polypeptide of the present invention may or may not include the starting methionine residue.
  • the invention also includes fragments, derivatives and analogs of human cleaved protein 10.56.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human cleavage protein 10.56 of the present invention.
  • Fragments, derivatives or analogues of the polypeptides of the present invention may be: (I) one in which one or more amino acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution Of amino acids may or may not be encoded by the genetic code; or (II) such a, in which one or more amino acid residues A group is substituted with another group containing a substituent; or (in) such a kind, in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or
  • the present invention provides an isolated nucleic acid (polynucleotide) consisting essentially of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention was found from the cDM library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1379 bases, and its open reading frames 445-735 encode 96 amino acids. According to the comparison of gene chip expression profiles, it is found that this polypeptide has a similar expression profile to human PRP17 protein, and it can be concluded that the human spliced protein 10.56 has similar functions to human PRP17 protein.
  • the polynucleotide of the present invention may be in DM form or RM form.
  • DNA forms include cDM, genomic DM or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be a coding strand or a non-coding strand.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • "degenerate variant" in the present invention refers to a nucleic acid sequence that encodes a protein or polypeptide having SEQ ID NO: 2 but differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the mature polypeptide coding sequence; the mature polypeptide coding sequence and various additional coding sequences; the mature polypeptide coding sequence (and optional additional coding sequence) and non- Coding sequence.
  • polynucleotide encoding a polypeptide refers to polynucleotides that include the polypeptide and polynucleotides that include additional coding and / or non-coding sequences.
  • the present invention also relates to the variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of the same amino acid sequence as the present invention.
  • This polynucleotide variant may be an naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants and insertion variants.
  • an allelic variant is a form of substitution of a polynucleotide. It may be a substitution, deletion, or insertion of one or more nucleotides, but it will not substantially change the function of the encoded polypeptide. .
  • the invention also relates to polynucleotides that hybridize to the sequences described above (at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • stringent conditions means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Hybridization Add denaturant, such as 50 ° /.
  • the invention also relates to nucleic acid fragments that hybridize to the sequences described above.
  • the length of the "nucleic acid fragment” contains at least 10 nucleotides, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleuses Above glucuronide.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to determine and / or isolate polynucleotides encoding human cleavage protein 10.56.
  • polypeptide and polynucleotide in the present invention are preferably provided in an isolated form, and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding human cleavage protein 10.56 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) Isolation of double-stranded DNA sequence from genomic DNA; 2) Chemical synthesis of DM sequence to obtain double-stranded DNA of the polypeptide.
  • the genomic DM is the least commonly used.
  • Direct chemical synthesis of DM sequences is a frequently used method.
  • the more frequently used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that highly express the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • There are many mature techniques for extracting mRNA, and kits are also available from commercial sources (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very few expression products can be cloned.
  • genes of the present invention can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RNA hybridization; (2) the presence or loss of marker gene function; (3) measuring the level of human shear protein 10.56 transcripts; ( 4) Detection of gene expressed protein products by immunological techniques or measurement of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and is at least 10 nucleotides in length, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the gene or fragment of the invention can of course be Used as a probe.
  • DM probes can be labeled with radioisotopes, luciferin or enzymes (such as alkaline phosphatase).
  • the protein product expressed by the 10.56 gene of the human cleaved protein can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA), etc.
  • a method of amplifying DNA / RNA using PCR technology is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR may be appropriate based on the polynucleotide sequence information of the present invention disclosed herein Local selection and can be synthesized by conventional methods.
  • the amplified DM / RNA fragments can be separated and purified by conventional methods such as gel electrophoresis.
  • the gene of the present invention obtained as described above, or the polynucleotide sequence of various DNA fragments and the like can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequence determination can also use commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the human cleavage protein 10.56 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.
  • the polynucleotide sequence encoding human cleavage protein 10.56 can be inserted into the vector to construct a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to a bacterial plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus such as adenovirus, retrovirus, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • pMSXND expression vectors expressed in mammalian cells Lee and Nathans, J Bio Chem. 263: 3521, 1988
  • baculovirus-derived vectors expressed in insect cells In short, as long as it can replicate and stabilize in the host, any plasmid and vector can be used to construct recombinant expression vectors.
  • An important feature of expression vectors is that they usually contain the origin of replication, promoters, marker genes and translational regulatory elements.
  • coli PL promoter of ⁇ phage
  • eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and Late SV40 promoters, retroviral LTRs and other known promoters that control gene expression in prokaryotic or eukaryotic cells or their viruses.
  • Expression vectors also include ribosome binding sites for translation initiation and transcription terminators. Inserting enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
  • An enhancer is a cis-acting factor for DNA expression, usually about 10 to 300 base pairs, acting on a promoter to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the replication start point, polyoma enhancers on the late side of the replication start point, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli, etc.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli, etc.
  • the polynucleotide encoding human splicing protein 10.56 or the recombinant vector containing the polynucleotide can be transformed or transferred into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • the transformation of host cells with the DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • competent cells that can absorb DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method.
  • the procedures used are well known in the art.
  • the alternative is MgCl 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human spliced protein 10.56 (Science, 1984; 224: 1431). Generally speaking, there are the following steps:
  • the medium used in the culture can be selected from various conventional mediums according to the host cells used.
  • the cultivation is carried out under conditions suitable for the growth of host cells.
  • the selected promoter is induced by an appropriate method (such as temperature conversion or chemical induction), and the cells are cultured for another period of time.
  • the recombinant polypeptide can be coated in the cell, expressed on the cell membrane, or secreted out of the cell.
  • the physical, chemical and other characteristics can be used to separate and purify the recombinant protein through various separation methods. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitation agent treatment (salting out method), centrifugation, osmotic bacteria, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, can treat malignant tumors, adrenal deficiencies, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • the structural genes of most eukaryotic genes contain insertion sequences, and the transcribed precursor mRM products generally lack biological activity and need to be sheared before they become active RNA.
  • the shearing process is the process of removing introns from the precursor mRM. This process is catalyzed by a class of multicomponent enzymes called shearers, and these enzymes are conservative during evolution. Such as human protein homologous to yeast PRP17 cleavage protein.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human PRP17 cleavage protein, and both have similar biological functions.
  • the polypeptide of the present invention participates in the cleavage of the precursor mRM product in the cell, making it an active RM product, and its abnormal expression is usually associated with some substance metabolic disorders, protein metabolic disorders and tumors of related tissues and The occurrence of diseases such as cancer are closely related and produce related diseases.
  • human shear protein 10.56 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, growth and development disorders, inflammations, and immune diseases, including but not Limited to:
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioma, nerve Fibroids, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumors, nasopharyngeal cancer, larynx cancer, tracheal tumors, fibroids, fibrosarcoma, lipoma, liposarcoma
  • Embryo Developmental Disorders Congenital Abortion, Cleft Palate, Limb Absence, Limb Differentiation Disorder, Atrial Septal Defect, Neural Tube Defect, Congenital Hydrocephalus, Congenital Glaucoma or Cataract, Congenital Deafness
  • Growth and developmental disorders mental retardation, brain developmental disorders, skin, fat and muscle dysplasias, bone and joint dysplasias, various metabolic deficiencies, acromegaly, dwarfism, Cushing's syndrome, sexual retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebral spinal cord multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infectious myocarditis, scleroderma, myasthenia gravis, Guillain-Barré syndrome, common variable immunodeficiency disease , Primary B lymphocyte immunodeficiency disease, acquired immunodeficiency syndrome
  • human shear protein 1 0.56 of the present invention will also produce certain hereditary and hematological diseases.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used for disease treatment, for example, can treat various diseases, especially various tumors, embryonic developmental disorders, growth and developmental disorders, inflammation, immunity Sexual diseases, certain hereditary, blood diseases, etc.
  • the present invention also provides methods for screening compounds to identify agents that increase (agonist) or repress (antagonist) human shear protein 1.05.56.
  • Agonists enhance human shear protein 1 0.56 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation such as various cancers.
  • mammalian cells or membrane preparations expressing human shear protein 1 0.56 can be cultured with labeled human shear protein 1 0.56. The ability of the drug to increase or suppress this interaction is then determined.
  • Antagonists of human spliced protein 1 0.56 include selected antibodies, compounds, receptor deletions, and the like.
  • the antagonist of human splicing protein 1 0.56 can bind to human splicing protein 10.56 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function Learning function.
  • human shear protein 10.56 can be added to the bioanalytical assay to determine whether the compound is a compound by measuring the effect of the compound on the interaction between human shear protein 10.56 and its receptor Is an antagonist. Using the same method as above for screening compounds, receptor deletions and analogs that act as antagonists can be screened out.
  • Polypeptide molecules that can bind to human cleavage protein 1 0.56 can be obtained by screening a random peptide library consisting of various possible combinations of amino acids bound to a solid phase. When screening, the human cleaved protein 1 0.56 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies by using polypeptides, fragments, derivatives, analogs, or their cells as antigens. These antibodies may be polyclonal antibodies or monoclonal antibodies.
  • the invention also provides antibodies against human cleavage protein 1 0.56 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated by Fab expression libraries.
  • the production of polyclonal antibodies can be obtained by direct injection of human shear protein 10.56 into immunized animals (such as rabbits, mice, rats, etc.).
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant Agent.
  • Techniques for preparing monoclonal antibodies to human cleaved protein 10.56 include, but are not limited to, hybridoma technology (Kohler and Mi ls te in. Nature, 1975, 256: 495-497), trioma technology, human B-cell hybridoma Technology, BBV-hybridoma technology, etc. Chimeric antibodies that combine human constant regions with variable regions of non-human origin can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single-chain antibodies against human cleavage protein 10.56.
  • Anti-human shear protein 10 56 antibodies can be used in immunohistochemistry to detect human shear protein 1 0.56 in biopsy specimens.
  • Monoclonal antibodies that bind to human shear protein 10.56 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method for tumor cell localization and determination of metastasis.
  • Antibodies can also be used to design immunotoxins against a specific part of the body.
  • human shear protein 10.56 High-affinity monoclonal antibodies can be covalently bound to bacterial or phytotoxins (such as diphtheria toxin, ricin, erythrine, etc.).
  • a common method is to attack the amino group of the antibody with a mercapto cross-linking agent such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human shear protein 10.56 positive cell.
  • the antibodies of the present invention can be used to treat or prevent diseases associated with human spliced protein 10.56.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human cleaved protein 10.56.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human shear protein 10.56.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human spliced protein 10.56 detected in the test can be used to explain the importance of human spliced protein 10.56 in various diseases and to diagnose diseases where human spliced protein 10.56 works.
  • the polypeptide of the present invention can also be used for peptide mapping analysis, for example, the polypeptide can be specifically cleaved by physical, chemical or enzyme, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, preferably mass spectrometry code
  • the polynucleotide of human cleavage protein 10.56 can also be used for various therapeutic purposes. Gene therapy techniques can be used to treat abnormalities in cell proliferation, development, or metabolism due to no expression or abnormal / inactive expression of human spliced protein 10.56. Recombinant gene therapy vectors (such as viral vectors) can be designed to express the mutated human splicing protein 10.56 to inhibit the endogenous human splicing protein 10.56 activity.
  • a mutant human splicing protein 10.56 may be a shortened human splicing protein that lacks the signaling domain 10. 56. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human spliced protein 10.56.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-related viruses, herpes simplex viruses, parvoviruses, etc. can be used to transfer polynucleotides encoding human cleavage protein 10.56 into cells.
  • Methods for constructing recombinant viral vectors carrying polynucleotides encoding human cleavage protein 10.56 can be found in existing literature (Sambrook, et al.).
  • the recombinant polynucleotide encoding human cleavage protein 10.56 can be packaged into liposomes and transferred into cells.
  • Methods for introducing polynucleotides into tissues or cells include: injecting polynucleotides directly into tissues in vivo; or in vitro introducing polynucleotides into cells through carriers (such as viruses, bacteriophages, or plasmids), and then transplanting cells To the body.
  • carriers such as viruses, bacteriophages, or plasmids
  • Oligonucleotides that inhibit human shear protein 10.56 mRM (including antisense RM and DNA) and ribozymes are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with complementary target RNA for endonuclease action.
  • Antisense RNA and DM and ribozymes can be obtained using any existing RNA or DM synthesis technology. For example, the technology of solid phase phosphoramide synthesis of oligonucleotides has been widely used.
  • Antisense RNA molecules can be obtained by transcription of the DNA sequence encoding the RM in vitro or in vivo. This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified by various methods, such as increasing the sequence length on both sides, and the connection between ribonucleosides should use a phosphorothioate bond or peptide bond instead of a phosphodiester bond.
  • the polynucleotide encoding human splicing protein 10.56 can be used for diagnosis of diseases related to human splicing protein 10.56.
  • the polynucleotide encoding human splicing protein 10.56 can be used to detect the expression of human splicing protein 10.56 or the abnormal expression of human splicing protein 10.56 in a disease state.
  • the DNA sequence encoding human shear protein 10.56 can be used to hybridize biopsy specimens to determine the expression status of human shear protein 10.56.
  • Hybridization techniques include Southern blotting, Nor thern blotting, in situ hybridization, etc. These technical methods are all published and mature technologies, and related kits are all commercially available.
  • a part or all of the polynucleotide of the present invention can be fixed as a probe on a microarray (Mi croarray) or a DNA chip (also called a "gene chip"), which is used to analyze differential expression analysis of genes in tissues and gene diagnosis.
  • RNA-polymerase chain reaction (RT-PCR) amplification using human shear protein 10.56 specific primers can also detect human shear protein 10.56 transcripts.
  • Detection of mutations in the human splicing protein 10.56 gene can also be used to diagnose diseases related to human splicing protein 10.56.
  • the forms of human splicing protein 10.56 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human splicing protein 10.56 DNA sequence.
  • Available technologies such as Southern blotting, DM sequence analysis, PCR and in situ hybridization detect mutations.
  • mutations may affect protein expression, so Nor thern blotting and Western blotting can be used to indirectly determine whether a gene has a mutation.
  • the sequence of the present invention is also valuable for chromosome identification.
  • This sequence will be specific to a specific location of a human chromosome and can hybridize with it. At present, it is necessary to identify the specific loci of each gene on the chromosome. At present, only a few chromosomal markers based on actual sequence data (repeated polymorphisms) can be used to mark chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, the important first step is to locate these DNA sequences on the chromosome.
  • PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequence can be located on the chromosome. Then, these primers were used for PCR screening of somatic heterozygous cells containing each human chromosome. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • Somatic cell hybridization PCR is a quick way to locate DNA to specific chromosomes.
  • oligonucleotide primer of the present invention by a similar method, a group of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosome mapping include in situ hybridization, chromosome pre-screening with marker flow sorting, and hybrid pre-selection to construct a chromosome-specific cDNA library.
  • Fluorescence in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosome positioning in one step.
  • FISH Fluorescence in situ hybridization
  • cDM or genomic sequence differences between affected and unaffected individuals need to be determined. If a mutation is observed in some or all of the affected individuals, and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing diseased and non-diseased individuals usually involves first looking for structural changes in the chromosome, such as defects or translocations that are visible from the chromosome level or detectable by PCR based on cMA sequences. According to the current physical mapping and the resolving power of gene mapping technology, the cDM that is precisely located to the chromosomal region related to the disease can be one of 50 to 500 potential disease genes (assuming 1 megabase mapping resolution Capacity and every 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be combined with Suitable pharmaceutical carriers are used in combination. These carriers may be water, glucose, ethanol, salts, buffer, glycerin, and combinations thereof.
  • the composition contains a safe and effective amount of a polypeptide or antagonist and a carrier and excipient that does not affect the effect of the drug. These compositions can be used as medicines for disease treatment.
  • the present invention also provides a kit or kit containing one or more containers containing one or more components of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more components of the pharmaceutical composition of the present invention.
  • these containers there may be an instructional prompt given by a government regulatory agency that manufactures, uses, or sells drugs or biological products, which reflects that the government regulatory agency that manufactures, uses, or markets permits its administration on the human body.
  • the polypeptide of the present invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal, or intradermal routes of administration.
  • Human shear protein 10.56 is administered in an amount effective to treat and / or prevent specific indications.
  • the amount of human shear protein administered to the patient 10.56 The amount and dosage range will depend on many factors, such as the mode of administration, the health condition of the person to be treated and the judgment of the diagnosing doctor. Examples
  • the total RM of human fetal brain was extracted with guanidine isothiocyanate / phenol / chloroform one-step method.
  • Poly (A) mRNA was isolated from total RM using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDM. Using a Smart cDNA cloning kit (purchased from Clontech), the cDM fragment was directionally inserted into the multiple cloning site of pBSK (+) vector (product of Clontech), transformed into DH5a, and the bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDM sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one clone 0513G10 was new DNA.
  • the insert cDNA fragment contained in this clone was bidirectionally determined by synthesizing a series of primers.
  • ol igo-dT as a primer for reverse transcription reaction to synthesize cDNA, after purification with Qiagene kit, PCR amplification with the following primers:
  • Primer 1 5'- TATGTGTAGGAATTACATGAGATA -3 '(SEQ ID NO: 3)
  • Primer2 5'- CTTTTGAGACAGGGTCTCTCTGTC -3 '(SEQ ID NO: 4)
  • Primerl is the forward sequence starting at the 5th bp of SEQ ID NO: 1;
  • Pr imer2 is the 3 in SEQ ID NO: 1, the reverse sequence at the end.
  • the amplified product was purified using QIAGEN's kit, and connected to pCR vector (Invi trogen company's product) with TA cloning kit. DM sequence analysis The results show that the DNA sequence of the PCR product is exactly the same as the l-1379bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of the expression of human cleaved protein 10.56 gene
  • the method includes acid guanidinium thiocyanate-chloroform extraction. That is to use 4M guanidinium isothiocyanate-25raM sodium citrate, 0.2M sodium acetate (pH4.0) to homogenize the tissue, add 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 volume) and centrifuge the mixture to obtain an RNA precipitate. The obtained RNA was precipitated at 70 ° /. Wash with ethanol, dry and dissolve in water.
  • the 32P-labeled probe (approximately 2 ⁇ 10 6 cpm / ml) was hybridized with RNA-transferred nitrocellulose membrane in a solution at 42 ° C overnight, the solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC-5 Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then , Phosphor Imager for analysis and quantification.
  • Example 4 Recombinant human shear protein 10.56 in vitro expression, isolation and purification
  • a PCR reaction was carried out using the pBS-0513G10 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were: the total volume of 50 ⁇ 1 contained 10 pg of pBS-0513G10 plasmid, primers Primer-3 and Primer-4 were 10 ⁇ mol, and Advantage polymerase Mix (product of Clontech) 1 ⁇ 1, respectively.
  • Cycle parameters 94. C 20s, 60 ° C 30s, 68 ° C 2 min, 25 cycles in total.
  • the amplified product and plasmid P ET-28 (+) were double-digested with Ndel and BamHI, respectively, and large fragments were recovered respectively, and ligated with T4 ligase.
  • the ligation product was transformed with Escherichia coli DH5a by calcium chloride method, and after culturing overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive clones were screened by colony PCR and sequenced. correct sequence of positive clones (PET-0513G10) the recombinant plasmid by the calcium chloride method to transform E. coli BL21 (DE3) plySs (Novagen Co.).
  • the host strain BL21 (pET-0513G10) was cultured at 37 ° C to the logarithmic growth phase, IPTG was added to a final concentration of 1IMIO1 / L, and the cultivation was continued for 5 hours.
  • the cells were collected by centrifugation, the bacteria were broken by ultrasound, and the supernatant was collected by centrifuge The affinity chromatography column His.
  • Bind Quick Cartr idge (product of Novagen) capable of binding to 6 histidines (6His-Tag) was used for chromatography to obtain the purified target protein human shear protein 10.56.
  • a peptide synthesizer (product of PE) was used to synthesize the following human cleaved protein 10.56 specific peptides: NH2-Met-Val-Ser-Pro-Leu-Gly-Gly-Glu-Gly-Cys-Gln-Arg- Phe-Ser-Ser-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, see: Avrameas, et al. Immunochemistry, 1969; 6: 43.
  • the probe can be used to hybridize with genomes or cDM libraries of normal tissues or pathological tissues from different sources Identify whether it contains the polynucleotide sequence of the present invention and the detected homologous polynucleotide sequence, and the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or pathology Whether the expression in tissue cells is abnormal.
  • the purpose of this example is to select a suitable oligonucleotide fragment from the polynucleotide of the present invention SEQ ID NO: 1 for use as a hybridization probe, and use a filter hybridization method to identify whether some tissues contain the polynucleotide of the present invention Acid sequence or its homologous polynucleotide sequence.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with probe-free hybridization buffer so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthesized polymer.
  • the prehybridization solution is then replaced with a hybridization buffer containing labeled probes, and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probe is removed by a series of membrane washing steps.
  • higher-intensity membrane washing conditions (such as lower salt concentration and higher temperature) are used to reduce the hybridization background and only retain a signal with strong specificity.
  • the probes selected in this embodiment include two types: the first type of probe is an oligonucleotide fragment that is completely the same as or complementary to the polynucleotide of the present invention SEQ ID NO: 1; the second type of probe is partly related to the present invention
  • the polynucleotide of SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane, and under the condition of high-strength membrane washing, the hybridization specificity of the first type probe and the sample is the strongest and can be retained.
  • oligonucleotide fragments from the polynucleotide of the present invention SEQ ID NO: 1 for use as a hybridization probe should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%. If it exceeds, the non-specific hybridization will increase;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mraol / L NaCl; 25 mmol / L MgCl 2 ).
  • step 8-13 are only used when the contamination must be removed, otherwise step 14 can be directly performed.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are needed for each probe, so as to be used in the subsequent experiment Wash the membrane with high-strength conditions and strength conditions, respectively.
  • the collected liquid of the first peak is the 32 P-Pn) be to be prepared (the second peak is free ⁇ - 32 P-dATP).
  • the sample film was placed in a plastic bag pre-hybridization solution was added 3-10m g (10xDenhardt 's; 6xSSC, 0. lmg / ml CT DM ( calf thymus DM)). After sealing the bag, shake at 68 ° C for 2 hours.
  • the radioactivity of the hybridization spots of the above two probes was not significantly different; whereas in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactivity intensity of the hybridization spots of Probe 1 was significantly stronger The radioactive intensity of the hybridization spot on another probe. Therefore, the probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Example 7 DNA Microarray
  • Gene chip or gene microarray is a new technology that many national laboratories and major pharmaceutical companies are currently working on. It refers to the orderly and high density of a large number of target gene fragments. Arranged on glass, silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze data to achieve the purpose of rapid, efficient and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; searching for and screening tissue-specific new genes, especially tumor-related new genes; disease diagnosis, such as genetic diseases .
  • the specific method steps have been reported in the literature, for example, you can refer to the literature DeRis i, LL., Lyer, V. & Brown, PO (1997) Science 278, 680-686. And the literature Helle, R, A., Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. Amplify them separately by PCR. After purifying the amplified products, adjust the concentration to about 500 ng / ul. Use Cartes ian 7500 spotter (purchased from Cartes ian, USA) on the glass medium. The distance between them is 280 ⁇ m. The spotted slides were hydrated, dried and placed in an ultraviolet cross-linking instrument for cross-linking. After elution and drying, the DM was fixed on the glass slide to prepare a chip. The specific method steps have been reported in the literature. The post-sampling processing steps in this embodiment are:
  • One-step method was used to extract total mRNA from human mixed tissues and specific tissues (or stimulated cell lines), and Ol igotex mRNA Midi Kit (purchased from QiaGen) was used to purify the mRNA, and the fluorescent reagents were separated by reverse transcription.
  • Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5 '-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) labeling mRM of human mixed tissue, using fluorescent reagent Cy5dUTP (5-Amino-propargyl- 2' -Deoxyuridine 5'-tr iphate coupled, to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech Co., Ltd. to label mRNA of specific tissues (or stimulated cell lines) of the organism, and then prepare probes after purification.
  • fluorescent reagent Cy5dUTP (5-Amino-propargyl- 2' -Deoxyuridine 5'-tr iphate coupled, to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech Co., Ltd.
  • Probes from the above two tissues and the chip were hybridized in the UniHyb TM Hybridization Solution (purchased from TeleChem) for 16 hours, washed with a washing solution (lx SSC, 0.2% SDS) at room temperature, and scanned with ScanArray 3000
  • the instrument purchased from General Scanning, USA
  • the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblast 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar into fc growth factor stimulation , 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer cell line EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardia cancer. Based on these 17 Cy3 / Cy5 ratios, draw a histogram ( Figure 1). It can be seen from the figure that the expression profiles of human spliced protein 10.56 and human PRP17 protein in the present invention are very similar.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine d'épissage 10.56, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, des troubles du développement, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine humaine d'épissage 10.56.
PCT/CN2001/000828 2000-05-24 2001-05-21 Nouveau polypeptide, proteine humaine d'epissage 10.56, et polynucleotide codant ce polypeptide WO2001092315A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU89483/01A AU8948301A (en) 2000-05-24 2001-05-21 A novel polypeptide, a human splicing protein 10.56 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115832.5 2000-05-24
CN 00115832 CN1324854A (zh) 2000-05-24 2000-05-24 一种新的多肽——人剪切蛋白10.56和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001092315A1 true WO2001092315A1 (fr) 2001-12-06

Family

ID=4585274

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000828 WO2001092315A1 (fr) 2000-05-24 2001-05-21 Nouveau polypeptide, proteine humaine d'epissage 10.56, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1324854A (fr)
AU (1) AU8948301A (fr)
WO (1) WO2001092315A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110559440A (zh) * 2019-09-02 2019-12-13 广州中医药大学(广州中医药研究院) 靶向cdc40基因核苷酸序列的活性物质在制备治疗肝病药物中的用途

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 1 February 2000 (2000-02-01), PEARCE A., XP002905522, accession no. EMBL Database accession no. Z98884 *
HOROWITZ D.S. ET AL., GENES DEV., vol. 11, no. 1, 1 January 1997 (1997-01-01), pages 139 - 151, XP002905529 *
LINDSEY L.A. ET AL., J. BIOL. CHEM., vol. 273, no. 49, 4 December 1998 (1998-12-04), pages 32771 - 32775, XP002905524 *
ZHOU Z. ET AL., EMBO J., vol. 17, no. 7, 1 April 1998 (1998-04-01), pages 2095 - 2106, XP002905523 *

Also Published As

Publication number Publication date
CN1324854A (zh) 2001-12-05
AU8948301A (en) 2001-12-11

Similar Documents

Publication Publication Date Title
WO2001092315A1 (fr) Nouveau polypeptide, proteine humaine d'epissage 10.56, et polynucleotide codant ce polypeptide
WO2001092319A1 (fr) NOUVEAU POLYPEPTIDE, RECEPTEUR HUMAIN 19.68 DE L'INTERFERON α, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001092515A1 (fr) Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide
WO2001092518A1 (fr) Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001087949A1 (fr) Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide
WO2002006471A1 (fr) Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide
WO2001090352A1 (fr) Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001092329A1 (fr) Nouveau polypeptide, sous-unite $g(a) d'atp-synthetase 9.9, et polynucleotide codant ce polypeptide
WO2002012315A1 (fr) Nouveau polypeptide, proteine mid1 10.56 du gene de type « ring finger », et polynucleotide codant ce polypeptide
WO2002012314A1 (fr) Nouveau polypeptide, proteine-1 humaine associee a la dihydropyrimidinase (drp-1) 9.68, et polynucleotide codant ce polypeptide
WO2002040525A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 18.92, et polynucleotide codant ce polypeptide
WO2001090348A1 (fr) Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide
WO2001090133A1 (fr) Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide
WO2001094407A1 (fr) Nouveau polypeptide, enzyme de conjugaison de l'ubiquitine humaine 10.01, et polynucleotide codant ce polypeptide
WO2001094534A2 (fr) Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide
WO2002012486A1 (fr) Nouveau polypeptide, recepteur humain de la serine kinase 10.34, et polynucleotide codant ce polypeptide
WO2001083682A2 (fr) Nouveau polypeptide, proteine pax humaine 11.6, et polynucleotide codant pour ce polypeptide
WO2001092324A1 (fr) Nouveau polypeptide, nucleoproteine humaine 10.78 basophile, et polynucleotide codant ce polypeptide
WO2001090380A1 (fr) Nouveau polypeptide, proteine humaine 11.99 du gene transducteur-2-beta, et polynucleotide codant ce polypeptide
WO2001092516A1 (fr) Nouveau polypeptide, proteine ribosomale s19e 13, et polynucleotide codant ce polypeptide
WO2001090381A1 (fr) Nouveau polypeptide, recepteur humain $g(a)-interferon 115.62, et polynucleotide codant ce polypeptide
WO2002026971A1 (fr) Nouveau polypeptide, facteur de transcription humain lcr-f112.1, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP