WO2001090381A1 - Nouveau polypeptide, recepteur humain $g(a)-interferon 115.62, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, recepteur humain $g(a)-interferon 115.62, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001090381A1
WO2001090381A1 PCT/CN2001/000867 CN0100867W WO0190381A1 WO 2001090381 A1 WO2001090381 A1 WO 2001090381A1 CN 0100867 W CN0100867 W CN 0100867W WO 0190381 A1 WO0190381 A1 WO 0190381A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human interferon
interferon alpha
sequence
Prior art date
Application number
PCT/CN2001/000867
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU81687/01A priority Critical patent/AU8168701A/en
Publication of WO2001090381A1 publication Critical patent/WO2001090381A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7156—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interferons [IFN]

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, interferon c (receptor 115.62), and a polynucleotide sequence encoding the polypeptide. The invention also relates to the polynucleoside Preparation method and application of acid and polypeptide.Technical background
  • Interferon is a type of cytoplasmic factor that has pleiotropic effects in a variety of cell types in the body. In addition to common antiviral activities, interferon proteins also have a variety of important biological activities such as antibacterial, antiprotozoal, immune regulation, and cell growth regulation. Type I interferons include interferon c (INF- ⁇ ), interferon P (INF- ⁇ ), and interferon ⁇ (INF- ⁇ ). Members of the human interferon a protein family contain at least 23 different protein polypeptides, and only one interferon P protein polypeptide.
  • Interferon cc protein and interferon beta protein bind to common species-specific receptors in the body to regulate various related signaling pathways in the body.
  • the human interferon a receptor 1 gene encodes a receptor protein of about 63 KDa; the interferon alpha receptor 1 gene encodes a receptor protein of about 115 KDa.
  • the receptor protein is tightly bound to type I interferon and is associated with the receptor protein 1 Synergistic effects to form biologically active signal complexes and regulate the occurrence and function of many important biological signal pathways in the body [Domanski P., M. Witte et al., 1995, J Biol Chem , 270: 21606].
  • the receptor protein consists of an extracellular domain, a transmembrane domain, and an intracellular domain.
  • the extracellular domain is composed of two functional domains-a domain 1 and a domain 2, the two domains are separated by a structural motif composed of three proline residues. These two domains have 19% identity and 50% similarity, and each domain can be divided into two similar subdomains consisting of about 100 amino acid residues. These two domains are respectively responsible for binding to the corresponding interferon protein in the body to regulate the interferon's action activity in the body.
  • Mutations or abnormal expression of this domain will directly affect the corresponding in vivo Cell signal pathways and the regulation of immune response have led to a variety of related metabolic and developmental disorders.
  • the protein is usually closely related to the development of some related developmental and metabolic disorders, immune system diseases, diseases related to abnormal signal pathways, and related tissue tumors and cancers. It can also be used to diagnose and treat the above-mentioned various related diseases.
  • the human interferon alpha receptor 115.62 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art
  • the human interferon alpha receptor 115.62 protein involved in these processes, especially the amino acid sequence of this protein is identified.
  • the new human interferon alpha receptor 115. 62 The isolation of the protein-coding gene also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its code for DM.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human interferon alpha receptor 115.62.
  • Another object of the present invention is to provide an antibody against the polypeptide-human interferon c receptor 115. 62 of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, a human interferon-o receptor 115.62.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human interferon alpha receptor 115.62. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin, and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 320-748 in SEQ ID NO: 1; and (b) a sequence having positions 1-1792 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human interferon alpha receptor 115.62 protein activity, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human interferon alpha receptor 115.62 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the invention also relates to the polypeptides and / or polynucleotides of the invention in the preparation for the treatment of cancer, developmental Use of diseases or immune diseases or other diseases caused by abnormal expression of human interferon alpha receptor 115.62.
  • Fig. 1 is a comparison chart of gene chip expression profiles of human interferon-a receptor 115. 62 and human interferon-a receptor 1 of the present invention.
  • the upper graph is a graph of the expression profile of human interferon a receptor 115. 62
  • the lower graph is the graph of the expression profile of human interferon a receptor 1.
  • 1-bladder mucosa 2-PMA + Ecv304 cell line, 3- LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5-fibroblas t, growth factor stimulation, 1024NT, 6- scar fc growth factor Stimulation, 1013HT, 7-scar into fc without stimulation with growth factor, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetus Skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human interferon alpha receptor 115.62.
  • 16kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DM or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” means the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. Is missing.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when bound to the human interferon alpha receptor 115.62, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind the human interferon-o receptor 115.62.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human interferon alpha receptor 115.62 when combined with human interferon alpha receptor 115.62.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human interferon alpha receptor 115.62.
  • Regular refers to a change in the function of human interferon alpha receptor 115. 62, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties and functions of human interferon alpha receptor 115. 62. Or changes in immune properties.
  • substantially pure ' 1 means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can use standard protein purification techniques to purify human interferon c receptor 115. 62
  • the substantially pure human interferon alpha receptor 115. 62 can generate a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human interferon alpha receptor 115. 62 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzymology 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 13 ') 2 and? ⁇ It can specifically bind to the epitope of human interferon alpha receptor 115. 62.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated means that the substance is separated from its original environment (if it is natural Natural material, the original environment is the natural environment).
  • natural Natural material the original environment is the natural environment.
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human interferon alpha receptor 115. 62 refers to human interferon alpha receptor 115. 62 which is substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. 62. Those skilled in the art can purify human interferon alpha receptor 115.62 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human interferon alpha receptor 115. 62 The purity of the polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human interferon alpha receptor 115. 62, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human interferon alpha receptor 115.62.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human interferon alpha receptor 115.62 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1792 bases, and its open reading frame 320-748 encodes 142 amino acids.
  • the polynucleotide of the present invention may be in the form of DM or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50% between the two sequences, preferably 70% identity).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F ico ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2 .
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human interferon-a receptor 115.62.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human interferon ct receptor 115.62 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These technologies include but are not Limitations are: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleotide fragments with common structural characteristics.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDM library.
  • mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene;).
  • construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) the level of transcripts of human interferon alpha receptor 115.62 (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • the MA probe can be labeled with a radioisotope, luciferin, or an enzyme (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein products expressed by the human interferon alpha receptor 115.62 gene.
  • a method for amplifying DM / RNA by PCR is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-cDM terminal rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. For full-length CDM Sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the CDM sequence of multiple clones in order to splice into a full-length CDM sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the human interferon alpha receptor 115.62 coding sequence, and the recombinant technology to produce the present invention Polypeptide method.
  • a polynucleotide sequence encoding the human interferon alpha receptor 115. 62 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements. '
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human interferon alpha receptor 115.62 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spice Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide niRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP Fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human interferon alpha receptor 115. 62 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human interferon alpha receptor 115. 62 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases Therapy, for example, can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • Type I interferon is a type of cytoplasmic factor that has pleiotropic effects in a variety of cell types in the body. In addition to common antiviral activities, interferon proteins also have a variety of important biological activities such as antibacterial, antiprotozoal, immune regulation, and cell growth regulation. Type I interferons include interferon a (INF- oc), interferon beta (INF- ⁇ ), and interferon ⁇ (INF- ⁇ ). Members of the human interferon alpha protein family contain at least 23 different protein polypeptides, and only one interferon beta protein polypeptide. However, interferon alpha protein and interferon p protein bind to common species-specific receptors in the body to regulate various related signaling pathways in the body.
  • interferon alpha receptor 1 protein is necessary for all type I interferons, and it mediates the occurrence of various type I interferon alpha-related signaling pathways in the body.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human interferon oc receptor 1 protein, and both have similar biological functions.
  • the polypeptide of the present invention can be biologically combined with interferon ct protein or interferon beta protein in vivo to form a biologically active signal complex, and regulate the occurrence and function of a variety of important biological signal pathways in the body, such as A variety of important biological activities such as immune regulation, inflammatory response, antibacterial, antiprotozoal and cell growth regulation. Its abnormal expression will cause abnormal reactions in the above-mentioned tissue cells and pathological processes, and cause related diseases.
  • the abnormal expression of the human interferon oc receptor 115. 62 of the present invention will produce various diseases, especially immune diseases, inflammation, various tumors, embryonic development disorders, and growth disorders. These diseases include But not limited to:
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, Nasopharyngeal Cancer, Laryngeal Cancer, Tracheal Tumors, Fibroids, Fibrosarcoma, Lipoma, Liposarcoma Embryonic Disorders: Congenital Abortion, Cleft Palate, Limb Absence, Limb Dysfunction, Atrial Septal Defect, Neural Tube Defect, Congenital Hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, Sexual retardation
  • the abnormal expression of the human interferon ct receptor 115. 62 of the present invention will also produce certain hereditary, hematological diseases, etc. '.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially immune diseases, inflammation, various tumors, embryonic developmental disorders, growth and development disorders. Sexual diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human interferon alpha receptor 115.62.
  • Agonists enhance human interferon alpha receptor 115.62 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing human interferon alpha receptor 115. 62 can be cultured with a labeled human interferon alpha receptor 115. 62 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human interferon alpha receptor 115. 62 include antibodies, compounds, receptor deletions and analogs that have been screened. Antagonist of human interferon c receptor 115. 62 can bind to human interferon oc receptor 115. 62 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.
  • human interferon alpha receptor 115. 62 When screening compounds as antagonists, human interferon alpha receptor 115. 62 can be added to the bioanalytical assay by determining the effect of the compound on the interaction between human interferon alpha receptor 115. 62 and its receptors. Determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human interferon alpha receptor 115.62 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human interferon cc receptor 115. 62 molecules should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human interferon alpha receptor 115.62 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human interferon alpha receptor 115.62 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • Various adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
  • Techniques for preparing monoclonal antibodies against human interferon cc receptor 115.62 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc. Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against human interferon alpha receptor ⁇ 5.62.
  • Antibodies against human interferon alpha receptor 115.62 can be used in immunohistochemistry to detect human interferon alpha receptor 115.62 in biopsy specimens.
  • Monoclonal antibodies that bind to human interferon alpha receptor 115.62 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins against a specific bead site in the body.
  • human interferon cc receptor 115.62 monoclonal antibodies with high affinity can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human interferon alpha receptor 115.62 cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human interferon alpha receptor 115.62. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human interferon ' ⁇ receptor 115.62.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human interferon alpha receptor 115.62.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human interferon alpha receptor 115.62 detected in the test can be used to explain the importance of human interferon alpha receptor 115.62 in various diseases and to diagnose diseases in which human interferon alpha receptor 115.62 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human interferon alpha receptor 115.62 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human interferon alpha receptor 115.62.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human interferon alpha receptor 115.62 to inhibit endogenous human interferon alpha receptor 115.62 activity.
  • a mutated human interferon-a receptor 115.62 may be shortened and missing signals
  • the human interferon-a receptor 115. 62 in the conduction domain although it can bind to downstream substrates, lacks signaling activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human interferon alpha receptor 115.62.
  • Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human interferon alpha receptor 115.62 into a cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding the human interferon alpha receptor 115.62 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human interferon oc receptor 115.62 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RM and DNA
  • ribozymes that inhibit human interferon alpha receptor 115.62 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes a specific MA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DNA synthesis technology. For example, solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides has been widely used.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM. This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human interferon-a receptor 115. 62 can be used for the diagnosis of diseases related to human interferon-a receptor 115. 62.
  • the polynucleotide encoding human interferon alpha receptor 115. 62 can be used to detect the expression of human interferon alpha receptor 115. 62 or the abnormal expression of human interferon alpha receptor 115. 62 in a disease state.
  • the DM sequence encoding human interferon alpha receptor 115. 62 can be used to hybridize biopsy specimens to determine the expression of human interferon alpha receptor 115. 62.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization.
  • kits are commercially available.
  • Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human interferon-a receptor 11 5.62 specific primers for MA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the human interferon- ⁇ receptor 115. 62 transcription products.
  • Detection of mutations in the human interferon alpha receptor 115.62 gene can also be used to diagnose human interferon alpha receptor 115.62-related diseases.
  • Human Interferon Alpha Receptor 115. 62 Mutated forms include those with normal wild-type humans Interferon alpha receptor 115.62 DNA sequence compared to point mutations, translocations, deletions, recombination and any other abnormalities. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35b P ) is prepared based on the cDNA, and the sequence can be mapped on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human interferon alpha receptor 115. 62 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human interferon-o receptor 115.62 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik raRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRM forms cDNA by reverse transcription.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the 00 fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ , and the bacteria formed a cDNA library.
  • Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • cDNA sequence Comparing the determined cDNA sequence with the existing public DNA sequence database (Genebank), it was found that the CDM sequence of one of the clones 0 924 B10 was new DNA.
  • a series of primers were synthesized to perform bidirectional determination of the inserted CDM fragments contained in this clone.
  • CDNA was synthesized using fetal brain cell total MA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- CACGTTATGAAGATATTTTCCTTT -3, (SEQ ID NO: 3)
  • Primer2 5'- CCGGGTGTGATGGTTCGCGGCTGT -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l reaction volume containing 50 mniol / L KCl, 10 mmol / L Tr is-HCl pH 8.5, 1.5. Let ol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, l Opmol primer 1U of Taq DNA polymerase (product of Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elraer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72. C 2min. During RT-PCR, ⁇ -act in was set as the positive control and template blank was used as the negative control.
  • the amplified products were purified using QIAGEN's kit, and TA cloning kit was used to connect to the pCR vector (Irivi trogen's product).
  • DM Sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1792 bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human interferon alpha receptor 115. 62 gene expression.
  • One step extraction of total MA [ Anal. Biochem 1987, 162, 156 159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, 4M guanidinium isothiocyanate-25 mM sodium citrate, 0.2 M sodium acetate (pH 4.0).
  • the tissue was homogenized, and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, After mixing, centrifuge. Aspirate the aqueous layer, add isopropyl alcohol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. Wash the obtained RNA with 70% ethanol, dry and dissolve in water. Jf 20 ⁇ 5 RNA, Perform electrophoresis on a 1.2% agarose gel containing 20raM 3- (N-morpholino) propanesulfonic acid (H7. 0)-5mM sodium acetate-lrnM BDTA-2. 2M formaldehyde. Then transfer to nitrocellulose On the membrane.
  • a 32 P dATP was used to prepare 32 P-labeled DNA probes by random primers.
  • the DNA probe used was the PCR amplified human interferon o receptor 115. 62 coding region shown in FIG. 1. Sequence (320bp to 748bp).
  • 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formazan Amide-25mM KH 2 P0 4 (pH7. 4)-5 ⁇ SSC-5 ⁇ Denhardt's solution and 20 ⁇ g / ml salmon sperm DM.
  • Example 4 In vitro expression, isolation and purification of recombinant human interferon alpha receptor 115.62
  • Primer 3 5 '-CCCCATATG ATGAAGGTTCTGAAATGTGGGGAA- 3' (Seq ID No: 5)
  • Pr imer4 5'-CATGGATCCTCAGACTCCTTTCTGGTAACAGTT-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI respectively. Site, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the restriction sites for Mel and BamHI correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • a PCR reaction was performed using the PBS-0924B10 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0924B10 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pBT-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into the colibacillus DH5 ct using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0924B10) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. The host strain BL21 (pET-0924B10) was 37 in LB liquid medium containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1). C.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human interferon alpha receptor 115.
  • 62-specific peptides NH2-Met-Lys-Val-Leu-Lys-Cys-Gly-Glu-I le-Gln-His -Leu-Pro-His-Asp-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemi stry, 1969; 6: 43.
  • the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences Compare its homology with its complementary region. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1 :
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies.
  • the data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. , M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification.
  • the spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ .
  • the spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DM on the glass slide to prepare chips.
  • the specific method steps have been reported in the literature.
  • the sample post-processing steps in this embodiment are:
  • Total mRM was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen), and another 1 J was separated by reverse transcription.
  • Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5--triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech), a fluorescent reagent, was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino- propargyl -2'- deoxyuridine 5'-tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech The company) labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare the probe.
  • Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5--triphat
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar-like fc growth factor Stimulation, 1013HT, scar into fc without stimulation with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Based on these Cy3 / Cy5 ratios, a bar graph is drawn ( Figure 1). It can be seen from the figure that the expression profile of human interferon alpha receptor 115. 62 and human interferon alpha receptor 1 according to the present invention are very similar.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, un récepteur humain α-interféron 115.62, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des maladies immunitaires, des inflammations, de toutes sortes de tumeurs, des troubles du développement de l'embryon et des troubles du développement et de la croissance. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant le récepteur humain α-interféron 115.62.
PCT/CN2001/000867 2000-05-26 2001-05-28 Nouveau polypeptide, recepteur humain $g(a)-interferon 115.62, et polynucleotide codant ce polypeptide WO2001090381A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU81687/01A AU8168701A (en) 2000-05-26 2001-05-28 Novel polypeptide - a human alpha interferon receptor 115.62 and polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00115869 CN1325878A (zh) 2000-05-26 2000-05-26 一种新的多肽——人干扰素α受体115.62和编码这种多肽的多核苷酸
CN00115869.4 2000-05-26

Publications (1)

Publication Number Publication Date
WO2001090381A1 true WO2001090381A1 (fr) 2001-11-29

Family

ID=4585311

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000867 WO2001090381A1 (fr) 2000-05-26 2001-05-28 Nouveau polypeptide, recepteur humain $g(a)-interferon 115.62, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1325878A (fr)
AU (1) AU8168701A (fr)
WO (1) WO2001090381A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0475907A2 (fr) * 1990-09-14 1992-03-18 Ciba-Geigy Ag Procédé pour la fabrication d'objets moulés de bonne qualité
US5731169A (en) * 1989-10-20 1998-03-24 Societe Leb-Tech cDNA fragment coding the alpha interferon receptor gene and process for the preparation of a corresponding protein

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5731169A (en) * 1989-10-20 1998-03-24 Societe Leb-Tech cDNA fragment coding the alpha interferon receptor gene and process for the preparation of a corresponding protein
EP0475907A2 (fr) * 1990-09-14 1992-03-18 Ciba-Geigy Ag Procédé pour la fabrication d'objets moulés de bonne qualité

Also Published As

Publication number Publication date
AU8168701A (en) 2001-12-03
CN1325878A (zh) 2001-12-12

Similar Documents

Publication Publication Date Title
WO2001074879A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s3-12, et polynucleotide codant pour ce polypeptide
WO2002000822A2 (fr) Nouveau polypeptide, sous-unite humaine 2 $g(b) 16.5 du facteur d'initiation necessaire a la synthese proteique, et polynucleotide codant ce polypeptide
WO2001092319A1 (fr) NOUVEAU POLYPEPTIDE, RECEPTEUR HUMAIN 19.68 DE L'INTERFERON α, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2001096560A1 (fr) Nouveau polypeptide, proteine humaine stat2, et polynucleotide codant ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001090381A1 (fr) Nouveau polypeptide, recepteur humain $g(a)-interferon 115.62, et polynucleotide codant ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001090133A1 (fr) Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide
WO2001092515A1 (fr) Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide
WO2002006471A1 (fr) Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001090352A1 (fr) Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide
WO2001092329A1 (fr) Nouveau polypeptide, sous-unite $g(a) d'atp-synthetase 9.9, et polynucleotide codant ce polypeptide
WO2001087972A1 (fr) Nouveau polypeptide, proteine dpc4 humaine 9 du facteur d'inhibition de la croissance tumorale, et polynucleotide codant ce polypeptide
WO2002012297A1 (fr) Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide
WO2001092517A1 (fr) Nouveau polypeptide, proteine humaine 29.15 du gene transducteur-2-beta, et polynucleotide codant ce polypeptide
WO2001092315A1 (fr) Nouveau polypeptide, proteine humaine d'epissage 10.56, et polynucleotide codant ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2002012314A1 (fr) Nouveau polypeptide, proteine-1 humaine associee a la dihydropyrimidinase (drp-1) 9.68, et polynucleotide codant ce polypeptide
WO2002000824A2 (fr) Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide
WO2001092518A1 (fr) Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide
WO2001094534A2 (fr) Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide
WO2001094407A1 (fr) Nouveau polypeptide, enzyme de conjugaison de l'ubiquitine humaine 10.01, et polynucleotide codant ce polypeptide
WO2001094533A2 (fr) Nouveau polypeptide, proteine humaine 13 de regulation de la proteine phosphorylase, et polynucleotide codant ce polypeptide
WO2001090131A1 (fr) Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP