WO2001094407A1 - Nouveau polypeptide, enzyme de conjugaison de l'ubiquitine humaine 10.01, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, enzyme de conjugaison de l'ubiquitine humaine 10.01, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001094407A1
WO2001094407A1 PCT/CN2001/000901 CN0100901W WO0194407A1 WO 2001094407 A1 WO2001094407 A1 WO 2001094407A1 CN 0100901 W CN0100901 W CN 0100901W WO 0194407 A1 WO0194407 A1 WO 0194407A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human ubiquitin
binding enzyme
sequence
Prior art date
Application number
PCT/CN2001/000901
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU81694/01A priority Critical patent/AU8169401A/en
Publication of WO2001094407A1 publication Critical patent/WO2001094407A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide ⁇ ⁇ ubiquitin binding enzyme 10. 01, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • the cell cycle occurs in an orderly manner along the cycle period, and specific proteins appear at specific times and play a corresponding regulatory role.
  • cells usually solve it by: first, modifying existing proteins (such as phosphorylation and dephosphorylation); second, synthesizing new proteins (such as cycle-dependent synthesis of cycl in); Third, hydrolyze excess protein (such as cycle-dependent degradation of cyclin).
  • Cycle-dependent proteolytic pathways must be substrate-specific pathways. It has been found that the ubiquitin-protease hydrolysis system plays a very important regulatory role in the regulation of the cell cycle.
  • the ubiquitin system is an important regulatory pathway that exists widely in organisms, and it involves the selective degradation of various related proteins in the body.
  • the ubiquitination process of proteins mainly involves the interaction of three protease families: the ubiquitin activating enzyme E1 protease family, the ubiquitin binding enzyme E2 protease family, and the ubiquitin protein ligase 3 protease family.
  • E3 may be directly involved in the final transfer of ubiquitin and the ubiquitination process of the protein.
  • the C00H terminus of the ubiquitin protein is activated by forming a thioester bond with the ubiquitin-activating enzyme E1, and then transferred to E2 or a member of the ubiquitin-binding enzyme family.
  • the element transfers to the lysine residue of the target protein.
  • E3 is necessary for the formation of polyubiquitin chains on the substrate. This step facilitates the 26S-sized proteasome to efficiently recognize the substrate and promotes the ubiquitination and degradation of proteins.
  • B6-AP protein is an intracellular protein with a size of about 100 kDa. This protein interacts with human papilloma virus proto-oncogene E6 protein of type 16 and 18 in vivo, and the complex of the two interacts with p53 protein to mediate ubiquitin active enzyme E1 and ubiquitin-binding enzyme E2 The role of activity and ubiquitin process of p53 protein.
  • Members of various ubiquitin-binding enzyme families have been cloned from various animals, and the structure and function of these proteins have been studied in detail. In 1996, Ulrike et al. Cloned two new members of the ubiquitin-binding enzyme E2 protein family from humans. These two proteins are also similar to other members of the protein family.
  • ubiquitin-binding protein is an important component of the ubiquitin regulatory system in vivo, and it cooperates with other ubiquitin system enzymes to regulate the normal progress of related cell cycle processes. Mutations or abnormal expression of members of this protein family will cause abnormal expression of proteins in related metabolic pathways, and then cause various related diseases.
  • This protein is usually closely related to the occurrence of various metabolic and developmental disorders related to cell cycle abnormalities, tumors of related tissues, and cancer. It can also be used to diagnose and treat the various related diseases mentioned above.
  • the human ubiquitin-binding enzyme 10.01 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more participation in the field. These processes of the human ubiquitin-binding enzyme 10.01 protein, in particular, identify the amino acid sequence of this protein.
  • the isolation of the new human ubiquitin-binding enzyme 10.01 protein-encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding for DM.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human ubiquitin-binding enzyme 10. 01.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human ubiquitin-binding enzyme 10.01.
  • Another object of the present invention is to provide a method for producing human ubiquitin-binding enzyme 10. 01.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of human ubiquitin-binding enzyme 10.01. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1300-1575 in SEQ ID NO: 1; and (b) a sequence having 1-1811 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human ubiquitin-binding enzyme 10.01 protein activity, which comprises utilizing the polypeptide of the present invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a human ubiquitin-binding enzyme 10.01 protein, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptides and / or polynucleotides of the present invention in the preparation of a medicament for treating cancer, developmental or immune diseases or other diseases caused by abnormal expression of human ubiquitin-binding enzyme 10.01.
  • Fig. 1 is a comparison diagram of gene chip expression profiles of the human ubiquitin-binding enzyme 10.01 and human ubiquitin-binding enzyme of the present invention.
  • the upper graph is a graph of the expression profile of human ubiquitin binding enzyme 10. 01
  • the lower graph is the graph of the expression profile of human ubiquitin binding enzyme.
  • 1-bladder mucosa 2-PMA + Ecv304 cell line, 3- LPS + Ecv304 cell line thymus, 4- normal fibroblasts 1024NC, 5-Fibroblast, growth factor stimulation, 1024NT, 6-scar scar fc growth factor stimulation , 1013HT, 7-scar into fc without stimulation with growth factors, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetal skin , 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human ubiquitin-binding enzyme 10.01. OkDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to a sequence of amino acids having one or more amino acid or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to a different amino acid Or nucleotides replace one or more amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human ubiquitin-binding enzyme 10.01, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to a human ubiquitin-binding enzyme 10.01.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human ubiquitin-binding enzyme 10.01 when combined with human ubiquitin-binding enzyme 10.01.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human ubiquitin-binding enzyme 10.01.
  • Regular refers to a change in the function of human ubiquitin-binding enzyme 10.01, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of human ubiquitin-binding enzyme 10.01 Change of nature.
  • substantially pure refers to other proteins, lipids, carbohydrates, or other substances with which it is essentially free from nature.
  • Those skilled in the art can purify human ubiquitin-binding enzyme 10.01 using standard protein purification techniques. Basically pure human ubiquitin-binding enzyme 10. 01 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human ubiquitin-binding enzyme 10.01 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to target sequences under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). MEGALIGN The program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged into clusters. Each cluster is then allocated in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of residues matching between sequence ⁇ and sequence ⁇ Number ⁇ 100
  • the number of residues in the sequence-the number of spacer residues in the sequence ⁇ 4-the number of spacer residues in the sequence ⁇ X can also be determined by Clus ter method or using methods known in the art such as Jotun Hein. in L, (1990) Me thods in enzymology 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution such as negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having uncharged head groups are Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ,) 2 and? 01, It can specifically bind to the epitope of human ubiquitin-binding enzyme 10. 01.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides coexist in a natural state Separated in other materials, it is isolated and purified.
  • isolated human ubiquitin-binding enzyme 10. 01 refers to human ubiquitin synthase 10. 01 which is essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human ubiquitin-binding enzyme 10.01 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human ubiquitin-binding enzyme 10. 01 The purity of the peptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide-human ubiquitin-binding enzyme 10. 01, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human ubiquitin-binding enzyme 10.01.
  • fragment refers to a polypeptide that substantially supports the same biological function or activity of the human ubiquitin-binding enzyme 10.01 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a type, in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1811 bases in length and its open reading frame 1300-1575 encodes 91 amino acids.
  • this peptide has a similar expression profile to human ubiquitin-binding enzyme, and it can be inferred that the human ubiquitin-binding enzyme 10.01 has similar functions to human ubiquitin-binding enzyme.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DNA forms include cDNA, genomic DNA or artificially synthesized DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be encoded Chain or non-coding chain.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60'C; or (2) Add sex agents during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi col l, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human ubiquitin-binding enzyme 10. 01.
  • the polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human ubiquitin-binding enzyme 10.01 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from genomic DM; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDM of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDM library.
  • fflRNA extraction There are many mature techniques for fflRNA extraction, and kits are also commercially available (Qiagene).
  • construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of human ubiquitin-binding enzyme 10.01 transcripts; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human ubiquitin-binding enzyme 10.01 gene.
  • a method (Saiki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced using the vector of the present invention or directly using human ubiquitin-binding enzyme 10.01 coding sequence ⁇ 'genetic engineering, and the recombinant technology to produce the described Polypeptide method.
  • a polynucleotide sequence encoding a human ubiquitin-binding enzyme 10.01 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
  • promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human ubiquitin-binding enzyme 10.01 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. .
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • a prokaryotic cell such as a bacterial cell
  • a lower eukaryotic cell such as a yeast cell
  • a higher eukaryotic cell such as a mammalian cell.
  • Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM may be harvested after exponential growth phase, with (: Treatment 1 2, steps well known in the art used alternative is to use MgCl 2..
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human ubiquitin-binding enzyme 10. 01 (Science, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • the cell cycle occurs sequentially and sequentially along the cycle period, and specific proteins appear at specific times and play a corresponding regulatory role. Among them, the ubiquitin-protease hydrolysis system plays a very important role in regulating cell cycle.
  • the ubiquitin system is an important regulatory pathway that exists widely in organisms, and it involves the selective degradation of various related proteins in the body.
  • the ubiquitination process of proteins mainly involves the joint action of three protease families: the ubiquitin activating enzyme E 1 protease family, the ubiquitin binding enzyme E2 protease family, and the ubiquitin protein ligase 3 protease family.
  • E3 may be directly involved in the final transfer of ubiquitin and the ubiquitination process of the protein.
  • the C00H terminus of the ubiquitin protein is activated by forming a thioester bond with the ubiquitin activating enzyme E1, and then transferred to E2 or a member of the ubiquitin-binding enzyme family.
  • the ubiquitin-protein ligase E 3 Ubiquitin is transferred to the lysine residue of the target protein.
  • E3 is necessary for the formation of polyubiquitin chains on the substrate. This step facilitates the 26S-sized proteasome to efficiently recognize the substrate and promotes the ubiquitination and degradation of proteins.
  • E6-AP protein is an intracellular protein that interacts with the human papilloma virus proto-oncogene E6 protein of human types 16 and 18, and the complex of the two interacts with p53 protein.
  • E1 and ubiquitin-binding enzyme E2 and the ubiquitin process of p53 protein To mediate the ubiquitin active enzyme E1 and ubiquitin-binding enzyme E2 and the ubiquitin process of p53 protein. further. Many members of the ubiquitin-binding enzyme family have been cloned. Mutations or abnormal expression of such proteins will directly affect the abnormality of metabolic pathways, and then cause various related diseases.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human ubiquitin-binding enzyme, and both have similar biological functions.
  • the polypeptide of the present invention as a member of the ubiquitin-protease hydrolysis system in vivo, plays a very important regulatory role in the regulation of the cell cycle. For example, it participates in the regulation of tumor suppressor genes. Its abnormal expression is usually associated with some related substance metabolism disorders, proteins The occurrence of pathological processes such as dysfunction and related tissue tumors are closely related, and related diseases occur.
  • the abnormal expression of the human ubiquitin-binding enzyme 10.01 of the present invention will produce various diseases, especially various tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases. These diseases include but not limited to:
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Neurofibromas, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat and muscle hair Fertility disorders, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome, sexual retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • the abnormal expression of the human ubiquitin-binding enzyme 10.01 of the present invention will also produce certain hereditary, hematological diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human ubiquitin conjugate enzyme 10. 01.
  • Agonists enhance human ubiquitin-binding enzyme 10.01 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human ubiquitin-binding enzyme 10. 01 can be cultured together with labeled human ubiquitin-binding enzyme 10. 01 in the presence of a drug. The ability of the drug to increase or block this interaction is then measured.
  • Antagonists of human ubiquitin-binding enzyme 10. 01 include screened antibodies, compounds, receptor deletions, and the like.
  • An antagonist of human ubiquitin-binding enzyme 10.01 can bind to human ubiquitin-binding enzyme 10.01 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
  • human ubiquitin-binding enzyme 10.01 When screening compounds as antagonists, human ubiquitin-binding enzyme 10.01 can be added to the bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between human ubiquitin-binding enzyme 10.01 and its receptor. Whether it is an antagonist. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human ubiquitin-binding enzyme 10.01 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the molecule of human ubiquitin-binding enzyme 10. 01 should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human ubiquitin-binding enzyme 10.01 epitope. These antibodies include (but are not limited to): many Cloned antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human ubiquitin-binding enzyme 10.01 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to human ubiquitin-binding enzyme 10. 01 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma Technology, EBV-hybridoma technology, etc.
  • Embedding antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against human ubiquitin-binding enzyme 10. 01.
  • Antibodies against human ubiquitin-binding enzyme 10. 01 can be used in immunohistochemistry to detect human ubiquitin-binding enzyme 10. 01 in biopsy specimens.
  • Monoclonal antibodies that bind to human ubiquitin-binding enzyme 10. 01 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • Human ubiquitin binding enzyme Human ubiquitin binding enzyme
  • High-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through the disulfide exchange.
  • SPDP thiol cross-linking agent
  • This hybrid antibody can be used to kill human ubiquitin-binding enzyme 10. 01 positive Cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human ubiquitin-binding enzyme 10. 01. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human ubiquitin-binding enzyme 10.01.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human ubiquitin-binding enzyme 10. 01.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human ubiquitin-binding enzyme 10.01 detected in the test can be used to explain the importance of human ubiquitin-binding enzyme 10.01 in various diseases and to diagnose the role of human ubiquitin-binding enzyme 10.01. disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human ubiquitin-binding enzyme 10.01 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human ubiquitin-binding enzyme 10. 01. Recombinant gene therapy vectors (such as viral vectors) can be designed for expression 01 ⁇ ⁇ Mutated human ubiquitin-binding enzyme 10. 01 to inhibit endogenous human ubiquitin-binding enzyme 10. 01 activity.
  • a mutated human ubiquitin-binding enzyme 10.01 may be a shortened human ubiquitin-binding enzyme 10.01 that lacks a signaling domain, although it can bind to downstream substrates, but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human ubiquitin-binding enzyme 10. 01.
  • the expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a human ubiquitin-binding enzyme 10.01 into a cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human ubiquitin-binding enzyme 10.01 can be found in existing literature (Sambrook, eta l.).
  • a recombinant polynucleotide encoding human ubiquitin-binding enzyme 10.01 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RM and DNA
  • ribozymes that inhibit human ubiquitin-binding enzyme 10.01 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DNA synthesis technology, such as the solid-phase phosphoramidite synthesis method for oligonucleotide synthesis. Widely used.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human ubiquitin-binding enzyme 10. 01 can be used for the diagnosis of diseases related to human ubiquitin-binding enzyme 10. 01.
  • the polynucleotide encoding human ubiquitin-binding enzyme 10.01 can be used to detect the expression of human ubiquitin-binding enzyme 10.01 or the abnormal expression of human ubiquitin-binding enzyme 10.01 in a disease state.
  • a DNA sequence encoding human ubiquitin-binding enzyme 10. 01 can be used to hybridize biopsy specimens to determine the expression of human ubiquitin-binding enzyme 10. 01.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization.
  • a part or all of the polynucleotide of the present invention can be fixed as a probe on a microarray or a DM chip (also referred to as a "gene chip") for analysis of differential expression analysis of genes and genetic diagnosis in tissues.
  • Human ubiquitin-binding enzyme 10. 01 specific primers for RM-polymerase chain reaction (RT-PCR) amplification in vitro can also detect the transcripts of human ubiquitin-binding enzyme 10. 01.
  • Human gene ubiquitin-binding enzyme 10.01 mutation detection can also be used to diagnose human ubiquitin-binding enzyme 10. 01 ⁇ Related diseases.
  • Human ubiquitin-binding enzyme 10. 01 mutant forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human ubiquitin-binding enzyme 10. 01 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping capability and every 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human ubiquitin-binding enzyme 10. 01 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human ubiquitin-binding enzyme 10.01 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA forms CDM by reverse transcription.
  • a Smart cDNA cloning kit purchased from Clontech
  • Dye terminate cycle react ion sequencing ki t Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequences were compared with existing public DNA sequence databases (Genebank). By comparison, it was found that the cDNA sequence of one of the clones 0652B01 was a new DM.
  • a series of primers were synthesized to determine the inserted cDNA fragment of the clone in both directions.
  • CDM was synthesized by reverse transcription reaction using fetal brain cell total R as a template and ol igo-dT as a primer. After purification with Q i a gene kit, PCR was performed with the following primers:
  • Primer 1 5
  • ACAAAATTTTAAATAATTTCTAGC -3 5
  • SEQ ID NO: 3 5
  • Primer 2 5'- TTCTCACGAATACATTAGGAGTCT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l reaction volume contains 50 mmol / L KC1, 10 ⁇ l / L Tri s-HCl, pH 8. 5, 1. 5 mmol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, l Opmol Primer, 1U of Taq DM polymerase (product of Clontech). Reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min During RT-PCR, ⁇ -act in was used as a positive control and template blank was used as a negative control.
  • the amplified products were purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen). DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l-1811bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human ubiquitin-binding enzyme 10. 01 gene expression
  • Total RM was extracted in one step [Ana l. Biochem 1987, 162, 156-159].
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
  • 32P-labeled probes (approximately 2 x 10 6 cpm / ml) were hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7. 4)-5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DM. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 minutes. Then , Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation, and purification of recombinant human ubiquitin-binding enzyme 10.01 According to the sequence of the coding region shown in SEQ ID NO: 1 and FIG. 1, a pair of specific amplification primers were designed, the sequence is as follows:
  • Primer3 5'-CATGCTAGCATGCTACCTATCCAAAACAGGCAA-3 '(Seq ID No: 5)
  • Primer4 5'-CATGGATCCTCACTGAATGCCAGTTCCAGATTT-3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Nhel and BaraHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed respectively, and the Nhel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28M +) (Novagen, Cat. No. 69865. 3). Digestion site.
  • PCR was performed using the PBS-0652B01 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of PBS-0652B01 plasmid was contained in a total volume of 50 ⁇ 1, and Primer-3 and Primer-4 were 1 Opmol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into the colibacillus DH5 cx by the calcium chloride method. After being cultured on LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1) overnight, positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0652B01) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • a peptide specific to the following human ubiquitin-binding enzyme 10.01 was synthesized using a peptide synthesizer (product of PE company): NH2-Met-Leu-Pro-I le-Gln-Asn-Arg-Gln-Ser-Ser-Gly- Thr-Ser-Pro-Ser- COOH (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomes The sequence and its complementary region are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the sample membrane was placed in a plastic bag, and 3-1 Orag pre-hybridization solution (1 OxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • 3-1 Orag pre-hybridization solution (1 OxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)
  • probe 1 can be used for qualitative and quantitative analysis.
  • the presence and differential expression of the polynucleotide of the present invention in different tissues are analyzed.
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in an ultraviolet cross-linker. After elution, the slides were fixed on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Ki t (purchased from QiaGen).
  • Cy3dUTP (5-Amino-propargyl- 2'-deoxyuridine 5'- tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) MRNA of human mixed tissue, labeled with Cy5dUTP (5-Amino- propargyl-2'-deoxyuridine 5'-triphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech), a fluorescent reagent Cy5dUTP (purchased from Amersham Phamacia Biotech) ) MRNA, and probes were prepared after purification. For specific steps and methods, see:
  • the probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and then washed with a washing solution (lx SSC, 0.2 SDS) at room temperature before use.
  • ScanArray 3000 scanner purchased from General Scanning Company, USA was used for scanning. The scanned image was analyzed and processed with Imagene software (Biodicovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above body specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 3 ⁇ 41024NC, Fibroblas t, growth factor stimulation, 1024NT, scar into fc growth factor Stimulation, 1013HT, scar into fc without stimulation with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Draw a graph based on these 17 Cy3 / Cy5 ratios ( Figure 1). It can be seen from the figure that the expression profiles of human ubiquitin-binding enzyme 10.01 and human ubiquitin-binding enzyme according to the present invention are very similar.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une enzyme de conjugaison de l'ubiquitine humaine 10.01, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de troubles du développement, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant l'enzyme de conjugaison de l'ubiquitine humaine 10.01.
PCT/CN2001/000901 2000-06-07 2001-06-04 Nouveau polypeptide, enzyme de conjugaison de l'ubiquitine humaine 10.01, et polynucleotide codant ce polypeptide WO2001094407A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU81694/01A AU8169401A (en) 2000-06-07 2001-06-04 A novel polypeptide - human ubiquitin-conjugating enzyme 10.01 and a polynucleotide encoding the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00116373 CN1327056A (zh) 2000-06-07 2000-06-07 一种新的多肽——人泛素结合酶10.01和编码这种多肽的多核苷酸
CN00116373.6 2000-06-07

Publications (1)

Publication Number Publication Date
WO2001094407A1 true WO2001094407A1 (fr) 2001-12-13

Family

ID=4585777

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000901 WO2001094407A1 (fr) 2000-06-07 2001-06-04 Nouveau polypeptide, enzyme de conjugaison de l'ubiquitine humaine 10.01, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1327056A (fr)
AU (1) AU8169401A (fr)
WO (1) WO2001094407A1 (fr)

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
J. BIOL. CHEM., vol. 270, no. 51, 1995, pages 30408 - 30414 *
J. BIOL. CHEM., vol. 271, no. 5, 1996, pages 2795 - 2800 *
PROC. NATL. ACAD. SCI. USA, vol. 91, no. 19, 1994, pages 8797 - 8801 *

Also Published As

Publication number Publication date
CN1327056A (zh) 2001-12-19
AU8169401A (en) 2001-12-17

Similar Documents

Publication Publication Date Title
WO2001074879A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s3-12, et polynucleotide codant pour ce polypeptide
WO2001096560A1 (fr) Nouveau polypeptide, proteine humaine stat2, et polynucleotide codant ce polypeptide
WO2001092319A1 (fr) NOUVEAU POLYPEPTIDE, RECEPTEUR HUMAIN 19.68 DE L'INTERFERON α, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2002006337A1 (fr) Nouveau polypeptide, hydroxyindole-o-methyl transferase humaine 12.43, et polynucleotide codant ce polypeptide
WO2001094407A1 (fr) Nouveau polypeptide, enzyme de conjugaison de l'ubiquitine humaine 10.01, et polynucleotide codant ce polypeptide
WO2001092515A1 (fr) Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001092329A1 (fr) Nouveau polypeptide, sous-unite $g(a) d'atp-synthetase 9.9, et polynucleotide codant ce polypeptide
WO2001090133A1 (fr) Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide
WO2001090352A1 (fr) Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide
WO2001092315A1 (fr) Nouveau polypeptide, proteine humaine d'epissage 10.56, et polynucleotide codant ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001071003A1 (fr) Nouveau polypeptide, serine protease humaine 8, et polynucleotide codant pour ce polypeptide
WO2002006471A1 (fr) Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide
WO2001092517A1 (fr) Nouveau polypeptide, proteine humaine 29.15 du gene transducteur-2-beta, et polynucleotide codant ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001094371A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001094534A2 (fr) Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide
WO2001090131A1 (fr) Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide
WO2001090381A1 (fr) Nouveau polypeptide, recepteur humain $g(a)-interferon 115.62, et polynucleotide codant ce polypeptide
WO2002012486A1 (fr) Nouveau polypeptide, recepteur humain de la serine kinase 10.34, et polynucleotide codant ce polypeptide
WO2001092324A1 (fr) Nouveau polypeptide, nucleoproteine humaine 10.78 basophile, et polynucleotide codant ce polypeptide
WO2002020589A1 (fr) Nouveau polypeptide, proteine humaine associee aux tumeurs de la retine 19.91, et polynucleotide codant ce polypeptide
WO2001090379A1 (fr) Nouveau polypeptide, nucleoproteine basophile humaine 22.55, et polynucleotide codant ce polypeptide
WO2001090172A1 (fr) Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP