WO2001090172A1 - Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2001090172A1 WO2001090172A1 PCT/CN2001/000823 CN0100823W WO0190172A1 WO 2001090172 A1 WO2001090172 A1 WO 2001090172A1 CN 0100823 W CN0100823 W CN 0100823W WO 0190172 A1 WO0190172 A1 WO 0190172A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- protein
- polynucleotide
- ribosomal
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide glycoside L39 protein 13 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
- the correct translation of proteins is very important for all bacteria and higher organisms.
- the research on the regulation mechanism of protein translation is obtained from E. coli.
- the protein translation process is mainly completed by various aminoacyl-tRM synthetases, various tRNAs, and ribosomes.
- the ribosome and other cofactors together provide the entire enzymatic activity of the translation process. These enzyme activities are only in the ribose Only when the overall structure of the body is complete. Therefore, the ribosome and its constituent subunits act synergistically in the body and play an important physiological function.
- Ribosomes are organelles that synthesize proteins. Their only function is to synthesize polypeptide chains from amino acids in accordance with the instructions of mRM. It is called ribosome, and is simply called ribosome or ribosome. Ribosomes are found in almost all cells, whether in prokaryotic or eukaryotic cells, there are a large number of ribosomes. The ribosome is a granular structure without a membrane. Its diameter is 25nm. The main components are protein and RNA. The ribosome RM is called rRM, and the protein content is about 40% and RM is about 60%.
- Protein molecules are mainly distributed on the surface of the ribosome, while rRNA is located inside, and the two are bound together by non-covalent bonds (Zi Zhonghe, Cell Biology, Higher Education Press, PP122-129). Functional studies of ribosomes have focused on ribosomal MA, and there are many rRNA domains that determine the different functions of ribosomes (Atmu Rev Biochem. 1991; 60: 191-227).
- ribosomes there are two basic types of ribosomes in biological organism cells: one is the ribosome with 70S as the Sverdberg sedimentation coefficient unit). The ribosomes of all prokaryotic cells are 70S eukaryotic cells. Mitochondria and ribosomes in chloroplasts are similar 70S. The other is 80S ribosomes, the ribosomes of eukaryotic cells (except for mitochondria and chloroplast ribose) are 80S. Ribosomes, whether 70S or 80S, are composed of two subunits of different sizes.
- the ribosome size subunits are often free in the cytoplasmic matrix within the cell. Only when the small subunits are combined with mRNA do the large subunits bind to the small subunits to form a complete ribosome. After the peptide synthesis is terminated, the large and small subunits dissociate and then exist freely in the cytoplasmic matrix.
- Ribosomal protein L39 is one of the ribosomal large subunit binding proteins. It is related to ribosomal L39 protein. Exist in most prokaryotic and eukaryotic cells.
- the C-terminus of all ribosomal proteins L39 contains a conserved region containing the following consistent sequence fragments: [KRA] -TX (3)-[LIVM]-[KRQF] -x- [NHS] -x ( 3) -R- [NHY] -WRR.
- This sequence fragment is contained in ribosomal protein L39 in many different organisms, and this fragment may play an important role in the action of ribosomes. This structural motif plays a very important role in the process of the protein's normal physiological function.
- Ribosomal protein L39 plays an important role in protein translation. If it is deleted or chemically modified, or the gene encoding it is mutated, it will affect the function of ribosomes and reduce the activity of peptide synthesis. Although the research on the function of ribosomal protein L39 is not thorough enough, according to various research results, it can be proved that the functions of ribosomal protein L39 include: (1) It is very important for rRM to fold into a functional three-dimensional structure; (2 ) In protein synthesis, the spatial conformation of the ribosome undergoes a series of changes, and the ribosomal protein may play a "fine-tuning" role in the conformation of the ribosome; (3) it may even play a catalytic role at the binding site of the ribosome, Ribosome proteins work together with rRNA.
- ribosomal L39 Based on the sequence similarity of ribosomal L39 protein, it is considered to belong to the ribosomal protein family. Deletion of this protein will slow down the cell growth rate [J. Stephen Gant t, Mi chae l D. Thompson, 1990, J. Bi o l. Chem., 265: 2763-2767] 0 Therefore, the ribosomal protein L39 is DM plays an extremely important role in the cell proliferation process of transcription and translation by DM. Its abnormal expression will cause the growth rate of the tissue to slow down, which will cause various developmental disorders, such as stunting.
- the ribosome L39 protein 13 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes. It has been necessary to identify more ribosomal L39 protein 13 proteins involved in these processes, especially the amino acid sequence of this protein. Isolation of the new ribosome L39 protein 13 protein-encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention
- An object of the present invention is to provide an isolated novel polypeptide monoribosomal L39 protein 13 and fragments, analogs and derivatives thereof.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a ribosome L39 protein 13.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a ribosome L39 protein 13.
- Another object of the present invention is to provide a method for producing ribosome L39 protein 13.
- Another object of the present invention is to provide an antibody against the polypeptide monoribosomal L39 protein 13 of the present invention.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide-monoribosomal L39 protein 13 of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of ribosomal L39 protein 13. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- ⁇ '(B) a polynucleotide complementary to the polynucleotide (a);
- sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of ribosomal L39 protein 13 protein, which comprises using the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of ribosomal L39 protein 13 protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample The amount or biological activity of a polypeptide of the invention.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for the treatment of cancer, developmental disease or immune disease or other diseases caused by abnormal expression of ribosomal L39 protein 13.
- FIG. 1 is a comparison diagram of gene chip expression profiles of ribosome L39 protein 13 and ribosome L39 protein according to the present invention.
- the upper graph is a graph of the ribosome L39 protein 13 expression profile
- the lower graph is the graph of the ribosome L39 protein expression profile.
- 1-bladder mucosa 2-PMA + Ecv304 cell line, 3-LPS + Ecv304 cell line thymus', 4-normal fibroblasts 1024NC, 5-Fibroblas t, growth factor stimulation, 1024NT, 6- scar growth into fc Factor stimulation, 1013HT, 7-scar scar into fc without stimulation with growth factor, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13- Placenta, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
- FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of an isolated ribosome L39 protein 13.
- FIG. 13kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with ribosomal L39 protein 13, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds to ribosomal L39 protein 13.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of ribosome L39 protein 13 when combined with ribosome L39 protein 13.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds to ribosomal L39 protein 13.
- ribosome L39 protein 13 refers to a change in the function of ribosome L39 protein 13, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of ribosome L39 protein 13.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Quality. Those skilled in the art can purify ribosomal L39 protein 13 using standard protein purification techniques. The substantially pure ribosomal L39 protein 13 produces a single main band on a non-reducing polyacrylamide gel. The purity of ribosomal L39 protein 13 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences based on different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzyraology 183: 625-645) 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of ribosomal L39 protein 13.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated ribosome L39 protein 13 means that ribosome L39 protein 13 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify ribosomal L39 protein 13 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of ribosomal L39 protein 1 3 peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide-ribosomal L39 protein 13, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
- polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
- the polypeptides of the invention may also include or not include the initial cysteine residues.
- the invention also includes fragments, derivatives and analogs of ribosomal L39 protein 13.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the ribosome L39 protein 13 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: U) a kind in which one or more amino acid residues are conserved or non-conserved Substitution of amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more of the amino acid residues A group is substituted by another group to include a substituent; or (III) one in which the mature polypeptide is fused with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a A polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a proteinogen sequence).
- amino acid residues preferably conservative amino acid residues
- the substituted amino acid may or may not be encoded by a genetic codon
- ⁇
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1091 bases, and its open reading frame 348-710 encodes 120 amino acids.
- this polypeptide has a similar expression profile to ribosomal L39 protein, and it can be deduced that the ribosome L39 protein 13 has similar functions to ribosomal L39 protein.
- the polynucleotide of the present invention may be in the form of DM or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the present invention also relates to a polynucleotide that hybridizes to a sequence described above 50% less, preferably 70% identity).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or ( 2 ) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi col l, etc .; or (3) only the identity between the two sequences Crosses occur at least 95% and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding ribosomal L39 protein 13.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the ribosome L39 protein 13 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice.
- the more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua 1, Cold Spoon Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of ribosomal L39 protein 13 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 Nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of ribosomal L39 protein 13 gene expression.
- ELISA enzyme-linked immunosorbent assay
- a method (Saiki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-rapid amplification of cDNA ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the ribosome L39 protein 13 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology. .
- a polynucleotide sequence encoding a ribosome L39 protein 13 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- DM sequence encoding ribosomal L39 protein 13 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DM technology, DM synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manua 1, Cold Spice Harbor Labora tory. New York, 1989).
- the D sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for MA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding ribosomal L39 protein 1 3 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote, such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method.
- the steps used are well known in the art.
- the alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant ribosomal L39 protein 13 (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Ribosomal protein L39 is one of the proteins in the large ribosomal subunit.
- the L39 protein can select the correct tRNA to bind to small ribosomal subunits to avoid mismatches, which is directly related to the stability of the passage of the organism. And the loss of ribosomal protein will slow down the growth of cells.
- abnormal expression of the specific L39 family protein mot if will cause the dysfunction of the polypeptide containing the L39 family protein mot if of the present invention, resulting in mistranslation of mRNA, and related diseases such as tumor and embryo development disorders. , Growth and development disorders.
- abnormal expression of the ribosome L39 protein 9 of the present invention will produce various diseases, especially embryonic developmental disorders, growth and development disorders, various tumors, and inflammations. These diseases include, but are not limited to:
- Embryonic disorders congenital abortion, cleft palate, facial cleft lip, lack of limbs, limb differentiation disorder, obstruction or stenosis of the digestive tract, hyaline membrane disease, atelectasis, polyphrenic kidney, ectopic kidney, double ureter, cryptorchidism Testis, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, open ductus arteriosus, neural tube defect, congenital hydrocephalus, iris defect, congenital Cataract, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, malignant histiocytosis, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymic tumor, nasal cavity and sinus cancer, nasopharyngeal cancer, larynx Cancer, tracheal tumor, pleural mesothelioma, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma
- Abnormal expression of the ribosome L39 protein 13 of the present invention will also produce certain hereditary, hematological and immune system diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) ribosomal L39 protein 1 3.
- Agonists increase ribosomal L39 protein 13 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing ribosomal L39 protein 13 can be cultured with labeled ribosome L39 protein 13 in the presence of drugs. The ability of the drug to increase or block this interaction is then measured.
- Antagonists of ribosomal L39 protein 13 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of ribosomal L39 protein 13 can bind to ribosome L39 protein 13 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- ribosomal L39 protein 13 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between ribosomal L39 protein 13 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to ribosomal L39 protein 13 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. Sieve In selection, the ribosome L39 protein 13 molecule should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against the ribosome L39 protein 13 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting ribosomal L39 protein 13 directly into immunized animals (such as rabbits, mice, rats, etc.).
- Various adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant .
- Techniques for preparing monoclonal antibodies to ribosomal L39 protein 13 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc.
- Embedding antibodies that bind human constant regions to non-human variable regions can be produced using known techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against ribosomal L39 protein 13.
- Antibodies against ribosome L39 protein 13 can be used in immunohistochemistry to detect ribosome L39 protein 13 in biopsy specimens.
- Monoclonal antibodies that bind to ribosomal L39 protein 13 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- ribosomal L39 protein 13 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill ribosome L39 protein 13 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to ribosomal L39 protein 13.
- Administration of an appropriate dose of antibody can stimulate or block the production or activity of ribosomal L39 protein 13.
- the invention also relates to a diagnostic test method for quantitative and localized detection of ribosomal U9 protein 13 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of ribosome L39 protein 13 detected in the test can be used to explain the importance of ribosome U9 protein 13 in various diseases and to diagnose diseases in which ribosome L39 protein 13 plays a role.
- the polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding ribosomal L39 protein 13 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of ribosomal L39 protein 13.
- Recombinant gene therapy vectors can be designed to express mutant ribosome L39 protein 13 to inhibit endogenous ribosome L39 protein 13 activity.
- a variant ribosome L39 protein 13 may be a shortened ribosome L39 protein 13 that lacks a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of ribosomal L39 protein 13.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding ribosomal L39 protein 13 into a cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a ribosome L39 protein 13 can be found in the existing literature (Sambrook, et al.).
- the recombinant polynucleotide encoding ribosomal L39 protein 13 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DM
- ribozymes that inhibit ribosomal L39 protein 13 raRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RM molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DM, and ribozymes can be obtained using any existing RNA or DM synthesis techniques, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding ribosomal L39 protein 13 can be used for the diagnosis of diseases related to ribosomal L39 protein 13.
- Polynucleotides encoding ribosomal L39 protein 1 3 can be used to detect the expression of ribosome L39 protein 13 or abnormal expression of ribosome L39 protein 13 in disease states.
- the DNA sequence encoding ribosomal L39 protein 13 can be used to hybridize biopsy specimens to determine the expression of ribosomal L39 protein 13.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip
- Ribosome L39 protein 13 specific primers can also be used to detect the transcription products of ribosome L39 protein 13 by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
- RT-PCR RNA-polymerase chain reaction
- Ribosome L39 protein 13 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type ribosome L39 protein 13 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the cD or genomic sequence differences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for staining Structural changes in the body, such as deletions or translocations that are visible from the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Ribosome L39 protein 13 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of ribosomal L39 protein 13 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRM was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragments into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library.
- Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and one of the clones was found.
- the cDNA sequence of 0379d06 is new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Pr imer 1 5'- CATTATAGGTTGCATAACAATCTA -3 '(SEQ ID NO: 3)
- Pr imer2 5,-ATGAGAAACAGTTTTATTGGAAAT -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Amplification reaction conditions containing 50mmol / L KCl in a reaction volume of 50 ⁇ 1, 10i io l / L Tr i s-HCl pH8 5, 1. 5mmol / L MgCl 2, 20 ( ⁇ mol / L dNTP,. lOpmol primer, 1U of Taq DNA polymerase (product of Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. Set ⁇ -act in as a positive control and template blank as a negative control at the same time during RT-PCR.
- Amplification products were purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invi trogen).
- DM sequence analysis results show that the DM sequence of the PCR product is exactly the same as 1-1091bp shown in SEQ ID NO: 1.
- Example 3 Analysis of ribosomal L39 protein 13 gene expression by Northern blot
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- 32P-labeled probes (approximately 2 x 10 6 cpm / ml) were hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7. 4) -5 x SSC-5 x Denhardt's solution and 20 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1 ° / SDS at 55 ° C for 30 minutes. Then, analysis was performed using a Phosphor Imager And quantification.
- Example 4 In vitro expression, isolation and purification of recombinant ribosomal L39 protein 13
- Primer 3 5'-CCCCATATGATGACACAGACACAGGAGCTTCAG-3 '(Seq ID No: 5)
- Pr iraer4 5'-CCCGAATTCTTAACAGCCAAAGCTATATGCAGA-3' (Seq ID No: 6)
- the 5 'ends of these two primers contain Ndel and EcoRI digestion sites, respectively Points, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
- the Ndel and EcoRI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
- PCR reaction was performed using pBS-0379d06 plasmid containing the full-length target gene as a template.
- PCR reaction conditions were: 1 in a total volume of 50 ⁇ containing pBS - 0379d06 plasmid 10pg, primers Pr imer-3 and Pr imer-4 were lOpmol Advantage polymerase Mix (Clontech Products) 1 ⁇ 1.
- Cycle parameters 94 C 20s, 60 ° C 30s, 68 C 2 min, a total of 25 cycles.
- Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligated product was transformed into coliform bacteria DH5 CC using the calcium chloride method, and cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were selected by colony PCR method and sequenced.
- a positive clone with the correct sequence (pET-0379d06) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
- peptides specific to ribosomal L39 protein 13 were synthesized using a peptide synthesizer (product of PE company): NH2-Met- Thr-Gln-Thr- Gln-Glu- Leu-Gin-Pro- Trp-Glu- Gln-Glu- Arg-Thr- C00H (SEQ ID NO: 7).
- the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
- the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
- the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- GC content is 30% -70%, if it exceeds, non-specific hybridization increases; 3. There should be no complementary regions inside the probe;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- the 32 P-Probe (the second peak is free ⁇ 32 P-dATP) is prepared.
- the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt> s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
- prehybridization solution 10xDenhardt> s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target D for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature, for example, refer to the literature DeRi s i, J. L., Lyer, V. & Brown, P. O.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA) The distance between them is 280 ⁇ m. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DM on the glass slide to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Ol igotex mRNA Midi Ki t (purchased from QiaGen). Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5--triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargy) was used.
- the probes from the above two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar-like fc growth factor stimulation 1013HT, scar into fc not stimulated with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardia cancer. Based on these 17 Cy3 / Cy5 ratios, a histogram is drawn (Figure 1). It can be seen from the figure that the expression profiles of ribosomal L39 protein 13 and ribosomal L39 protein according to the present invention are very similar.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Gastroenterology & Hepatology (AREA)
- General Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU78353/01A AU7835301A (en) | 2000-05-24 | 2001-05-21 | A novel polypeptide-human ribosomal l39 protein 13 and the polynucleotide encoding said polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00115811.2 | 2000-05-24 | ||
CN00115811A CN1324807A (zh) | 2000-05-24 | 2000-05-24 | 一种新的多肽——核糖体l39蛋白13和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001090172A1 true WO2001090172A1 (fr) | 2001-11-29 |
Family
ID=4585253
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000823 WO2001090172A1 (fr) | 2000-05-24 | 2001-05-21 | Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1324807A (fr) |
AU (1) | AU7835301A (fr) |
WO (1) | WO2001090172A1 (fr) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994001570A1 (fr) * | 1992-07-08 | 1994-01-20 | Rhone-Poulenc Rorer S.A. | Promoteur du gene de la proteine ribosomique rp28 de k. lactis et son utilisation |
WO1999029341A2 (fr) * | 1997-12-12 | 1999-06-17 | Corixa Corporation | PROCEDES PERMETTANT DE RENFORCER DES REPONSES IMMUNITAIRES DE PROTECTION AU MOYEN DE POLYPEPTIDES $i(LEISHMANIA) |
WO2000028079A2 (fr) * | 1998-11-09 | 2000-05-18 | Gemini Genomics Ab | Variation genetique associee a l'anemie aplasique, et applications diagnostiques et therapeutiques basees sur cette variation |
-
2000
- 2000-05-24 CN CN00115811A patent/CN1324807A/zh active Pending
-
2001
- 2001-05-21 AU AU78353/01A patent/AU7835301A/en not_active Abandoned
- 2001-05-21 WO PCT/CN2001/000823 patent/WO2001090172A1/fr active Application Filing
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994001570A1 (fr) * | 1992-07-08 | 1994-01-20 | Rhone-Poulenc Rorer S.A. | Promoteur du gene de la proteine ribosomique rp28 de k. lactis et son utilisation |
WO1999029341A2 (fr) * | 1997-12-12 | 1999-06-17 | Corixa Corporation | PROCEDES PERMETTANT DE RENFORCER DES REPONSES IMMUNITAIRES DE PROTECTION AU MOYEN DE POLYPEPTIDES $i(LEISHMANIA) |
WO2000028079A2 (fr) * | 1998-11-09 | 2000-05-18 | Gemini Genomics Ab | Variation genetique associee a l'anemie aplasique, et applications diagnostiques et therapeutiques basees sur cette variation |
Also Published As
Publication number | Publication date |
---|---|
AU7835301A (en) | 2001-12-03 |
CN1324807A (zh) | 2001-12-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002014510A1 (fr) | Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide | |
WO2001092319A1 (fr) | NOUVEAU POLYPEPTIDE, RECEPTEUR HUMAIN 19.68 DE L'INTERFERON α, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE | |
WO2001090172A1 (fr) | Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide | |
WO2001090177A1 (fr) | Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide | |
WO2001092329A1 (fr) | Nouveau polypeptide, sous-unite $g(a) d'atp-synthetase 9.9, et polynucleotide codant ce polypeptide | |
WO2001075101A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide | |
WO2001070965A1 (fr) | Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide | |
WO2001075048A2 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide | |
WO2001092515A1 (fr) | Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide | |
WO2001092518A1 (fr) | Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide | |
WO2001079432A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001090352A1 (fr) | Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide | |
WO2001070956A1 (fr) | Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001096387A1 (fr) | Nouveau polypeptide, proteine 9.13 associee au recepteur oestrogene, et polynucleotide codant ce polypeptide | |
WO2001068873A1 (fr) | Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide | |
WO2001094534A2 (fr) | Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide | |
WO2001087963A1 (fr) | Proteine s18-12 ribosomale, polypeptide humain, et polynucleotide la codant | |
WO2001090131A1 (fr) | Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide | |
WO2001094538A2 (fr) | Nouveau polypeptide, adn ligase 21, et polynucleotide codant ce polypeptide | |
WO2001090379A1 (fr) | Nouveau polypeptide, nucleoproteine basophile humaine 22.55, et polynucleotide codant ce polypeptide | |
WO2001092324A1 (fr) | Nouveau polypeptide, nucleoproteine humaine 10.78 basophile, et polynucleotide codant ce polypeptide | |
WO2001074881A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s18-10, et polynucleotide codant pour ce polypeptide | |
WO2001090173A1 (fr) | Nouveau polypeptide, chaperonine humaine cpn60 10, et polynucleotide codant pour ce polypeptide | |
WO2001083678A2 (fr) | Nouveau polypeptide, uridylate kinase humaine 13, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |