WO2002014510A1 - Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2002014510A1 WO2002014510A1 PCT/CN2001/001132 CN0101132W WO0214510A1 WO 2002014510 A1 WO2002014510 A1 WO 2002014510A1 CN 0101132 W CN0101132 W CN 0101132W WO 0214510 A1 WO0214510 A1 WO 0214510A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- protein
- human
- polynucleotide
- cbp20
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human CBP20 protein 47.74, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
- CBC Human cap-binding protein complex
- MA is transcribed into various precursor mRMs catalyzed by RNA polymerase. These precursor mRMs all contain a 5 'end cap structure.
- the precursor mRM is related to intracellular related cap-binding protein complexes, and under the action of these protein complexes, it shears to form biologically active mature mRNA molecules. It is then translated into related protein products under the action of various translational regulatory proteins. It can be seen that, in fact, at the beginning of the expression of various proteins in the organism, mutations or abnormal expressions will cause abnormal expression and action of related proteins in the body, and then cause various related diseases.
- cap-binding proteins have been cloned from nuclear and cytoplasmic components, and the structure and function of these proteins have been studied.
- CBP80 cap-binding protein complex
- This protein has similar structural and functional characteristics to various known cap-binding proteins. It is also translated in vivo [El i sa Izaurra lde, Joe Lewis et al., 1994, Cel l, 78: 657-668]. Mutation or abnormal expression of this protein will cause abnormal expression of related genetic information in vivo, and then affect the expression and role of related protein in vivo. It is usually closely related to the development of various tissues and the occurrence of metabolic disorders in the body. It can also be used to diagnose and treat the various related diseases mentioned above.
- the human CBP20 protein 47.74 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes.
- the human CBP20 protein 47. 74 protein, especially the amino acid sequence of this protein is identified.
- Newcomer CBP20 protein 47. The isolation of the 74 protein-coding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding the human CBP20 protein 47.74.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human CBP20 protein 47.74.
- Another object of the present invention is to provide a method for producing human CBP20 protein 47.7.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human CBP20 protein 47.74.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human CBP20 protein 47.74.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human CBP20 protein 47.74.
- the present invention relates to an isolated polypeptide.
- the polypeptide is of human origin and comprises: SEQ ID No. 2 Amino acid sequence of a polypeptide, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 85-1389 in SEQ ID NO: 1; and (b) having a SBQ ID NO: 1 in 1-2807 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human CBP20 protein 47.74 protein activity, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a human CBP20 protein 47.7 protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating ⁇ cancer, developmental disease or immune disease ⁇ or other diseases caused by abnormal expression of human CBP20 protein 47.74.
- Nucleic acid sequence means an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also be Refers to the genomic or synthetic DM or RNA, which can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with human 08-20 protein 47.74, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human CBP20 protein 47.74.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human CBP20 protein 47. 74 when combined with human 08-20 protein 47. 74.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human CBP20 protein 47.74.
- “Regulation” refers to a change in the function of human CBP20 protein 47. 74, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human CBP20 protein 47. 74.
- “Substantially pure” means substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human CBP20 protein 47.74 using standard protein purification techniques. The substantially pure human CBP20 protein 47. 74 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human CBP20 protein 47. 74 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
- the MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0
- the Cluster method divides each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by Clus ter method or using methods known in the art such as Jotun Hein. J "(1990) Methods” in emzumology 183: 625-645) "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human CBP20 protein 47.74.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated means that the substance is separated from its original environment (if it is a natural substance, the original environment is the natural environment).
- the polynucleotide and the polynucleotide in its natural state in a living cell are Polypeptides are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if they are separated from other substances in their natural state.
- isolated human CBP20 protein 47. 74 means that human CBP20 protein 47. 74 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human CBP20 protein 47.74 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Purity of human CBP20 protein 47. 74 polypeptide Analysis by amino acid sequence. ⁇
- the present invention provides a new polypeptide-human CBP20 protein 47.74, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of the human CBP20 protein 47.74.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human CBP20 protein 47.74 of the present invention.
- a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
- such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- Polynucleotides of the invention are found from a cMA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2807 bases, and its open reading frame 85-1389 encodes 434 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with human CBP20 protein, and it can be deduced that the human CBP20 protein 47.7 has similar functions to human CBP20 protein.
- the polynucleotide of the present invention may be in the form of MA or MA.
- MA forms include cDNA, genomic DNA or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1
- degenerate variants refers to a nucleic acid sequence encoding a protein or polypeptide having SBQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fico ll, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human CBP20 protein 47.74.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human CBP20 protein 47.74 of the present invention can be obtained by various methods. Got.
- polynucleotides are isolated using hybridization techniques well known in the art. These technologies include, but are not limited to:
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
- genomic MA is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the separation of cMA sequences.
- the standard method for isolating the cMA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a granule or phage cDNA library.
- the construction of cDNA library is also a common method (Sambrook, et al.,
- cDM libraries are also available, such as different cMA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be screened from these cMA libraries by conventional methods. These methods include (but are not limited to): (1) DM-DNA or DM-RM hybridization; (2) the appearance or loss of marker gene function; (3) measuring the level of transcript of human CBP20 protein 47. 74; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of the 47.74 gene expression of human CBP20 protein can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- the RACE method RACE-rapid amplification of cDNA ends
- the primers can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by conventional methods.
- the amplified MA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the human CBP20 protein 47.74 coding sequence, and a recombinant technology for producing the polypeptide of the present invention. method.
- a polynucleotide sequence encoding the human CBP20 protein 47.74 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human CBP20 protein 47.74 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Mol ecular Cloning, a Laboratory Manua 1, cold Harbor Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mMA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation and Transcription terminator and so on. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for MA expression, usually about 10 to 300 base pairs, which act on the promoter to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human CBP20 protein 47.74 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human CBP20 protein 47. 74 (Scence, 1984; 224: 1431). Generally there are the following steps: (1). Use the polynucleotide (or variant) encoding the human-human CBP20 protein 47.74 of the present invention, or transform or transduce a suitable expression vector with a recombinant expression vector containing the polynucleotide.
- step (3) Isolate and purify protein from culture medium or cells.
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- FIG. 1 is a comparison diagram of gene chip expression profiles of the present inventor's CBP20 protein 47. 74 and human 08-20 protein.
- the upper graph is a graph of the expression profile of human CBP20 protein 47. 74, and the lower graph is the graph of the expression profile of human CBP20 protein.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human CBP20 protein 47.74.
- OkDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Separation Quik mRNA Isolat ion Ki t (Qiegene Co.) total RNA from poly (A) mRNA 0 2ug poly (A) mRNA is formed by reverse transcription cDNA.
- the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragment into the pBSK (+) vector (Clontech), and then transformed into DH50. The bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 1176a07 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.
- PCR amplification was performed with the following primers:
- Pr imerl 5'- GGTAGTTAGCTGCATACTTGTGCG-3 '(SEQ ID NO: 3)
- Pr imer2 5 — TTATCCTGGTTTTATTCAGGAATA -3 '(SEQ ID NO: 4)
- Pr imerl is a forward sequence starting at the lbp end of SBQ ID NO: 1;
- Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 mmol / L KC1, 10 mmol / L Tris-CI, (pH 8. 5), 1.5 mmol / L MgCl 2 , 200 ⁇ ⁇ / L dNTP, lOpmol primers in a reaction volume of 50 ⁇ 1 , 1U of Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55. C 30sec; 72. C 2min.
- ⁇ -act in was set as a positive control and template blank was set as a negative control.
- Amplification products were purified using QIAGEN kits, using TA g Long kit is connected to the pCR vector (Invitrogen). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2807bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human CBP20 protein 47.74 gene expression:
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained MA precipitate was washed with 70% ethanol, dried and dissolved in water.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which MA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 SSC-5 Denhardt's solution and 20 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 minutes. Then, Phosphor Imager Analysis and quantification Example 4: In vitro expression, isolation and purification of recombinant human CBP20 protein 47.74
- Primer3 5 — CCCCATATGATGGGCAAGAAGGGCAAAGTTGGC- 3 '(Seq ID No: 5)
- Primer 4 5, — CATGGATCCTCAGTAAGTCGCATACTGGTGACC- 3, (Seq ID No: 6)
- the 5 ′ ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences of the 5 ′ and 3 ′ ends of the target gene, respectively.
- the Ndel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET- 2 8b (+) (Novagen, Cat. No. 69865.3).
- the PCR reaction was performed using pBS-1176a07 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: 10 pg of pBS-1176a07 plasmid, primers 1 ⁇ 11161: -3, and ⁇ in a total volume of 50 ⁇ 1:]: 11116]: 4 points and additional!] Is 10 01, Advantage polymerase Mix (Clontech product ) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 Loop. The amplified product and plasmid pET-28 (+) were double-digested with Mel and BamHI, respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into colibacillus DH5 ex by the calcium chloride method.
- a peptide synthesizer (product of PE company) was used to synthesize the following human CBP20 protein 47. 74 specific peptides:
- the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
- the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to Identifying whether it contains the polynucleotide sequence of the present invention and detecting a homologous polynucleotide sequence, further The probe is used to detect whether the expression of the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof in cells of normal tissues or pathological tissues is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method Acid sequence or a homologous polynucleotide sequence thereof.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes selected in this embodiment include two types: (1) one type of probe is an oligonucleotide fragment that is completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probe is partly related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe for subsequent experiments.
- the film is washed with high-strength conditions and strength conditions, respectively.
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
- Gene microarray or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; finding and screening new tissue-specific new genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the DNA was fixed on the glass slide to prepare a chip. The specific method steps are variously reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
- Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-tr iphate cou led to Cy3 f luorescent dye, purchased from Amersham Pamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5 -Amino- propargy 2'-deoxyur idine 5'-tr iphate cou led to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech Company, labeled mRNA of specific tissues (or stimulated cell lines) of the body, purified and prepared for detection needle.
- Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-tr iphate
- the probes from the above two tissues and the chips were respectively hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and the washing solution (1> ⁇ SSC, 0.2% SDS) was used at room temperature. ) After washing, scan with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images are analyzed by Imagene software (Biodiscovery, USA), and the Cy3 / Cy5 ratio of each point is calculated.
- the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line, thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar formation fc Growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer plant cells EL bladder cancer, bladder cancer, liver cancer, liver cancer cell lines, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma. Draw a chart based on these 18 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profile of human CBP20 protein 47. 74 and human CBP20 protein according to the present invention are very similar. Industrial applicability
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
- CBC Human cap binding protein complex
- CBP80 and CBP20 exist in various tissues such as the nucleus and cervical cancer cell lines. All play an important regulatory role in the process of mRNA precursor splicing to form mature RNA, which is mainly responsible for identifying various precursor mRMs and combining them to regulate the completion of splicing.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human CBP80 protein, and both have similar biological functions.
- the polypeptide of the present invention is involved in recognizing a variety of different precursor mRMs in vivo, and binds them to regulate mRNA splicing to form mature RNA, which is especially present in cervical cancer cell lines. Its abnormal expression is usually closely related to the occurrence of some related disorders of material metabolism, protein metabolism, and tumors of related tissues, and it also produces related diseases such as cervical cancer.
- the abnormal expression of the human CBP80 protein 9.79 of the present invention will produce various diseases, especially cervical cancer, other tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases. These diseases include But not limited to:
- Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma, embryonic developmental disorders Symptoms: Congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness, growth and development disorders: mental retardation, brain Developmental disorders, skin, fat and muscular dysplasia, bone and joint dysp
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- Abnormal expression of the human CBP80 protein 9.79 of the present invention will also produce certain hereditary, hematological diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially cervical cancer, other cancers, embryonic developmental disorders, and disorders of growth and development. , Inflammation, immune diseases, some hereditary, blood diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human CBP20 protein 47.74.
- Agonists enhance human CBP20 protein 47. 74 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human CBP20 protein 47.74 can be cultured with labeled human CBP20 protein 47.74 in the presence of drugs. The ability of the drug to increase or block this interaction is then measured.
- Antagonists of human CBP20 protein 47.74 include antibodies, compounds, receptor deletions, and the like that have been screened.
- the antagonist of human CBP20 protein 47. 74 can bind to human CBP20 protein 47. 74 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions. .
- human CBP20 protein 47. 74 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human CBP20 protein 47. 74 and its receptor. .
- Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human CBP20 protein 47.74 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the human CBP20 protein 47.74 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by direct injection of human CBP20 protein 47.74 into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
- Techniques for preparing monoclonal antibodies to human CBP20 protein 47.74 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human CBP20 protein 47.74.
- Antibodies against human CBP20 protein 47. 74 can be used in immunohistochemical techniques to detect human CBP20 protein 47. 74 in biopsy specimens.
- Monoclonal antibodies that bind to human CBP20 protein 47. 74 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human CBP2 G protein 47. 74 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human CBP20 protein 47.74 positive cells .
- the antibodies of the present invention can be used to treat or prevent diseases related to human CBP20 protein 47.74.
- Administration of an appropriate dose of antibody can stimulate or block the production or activity of human CBP20 protein 47.74.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human CBP20 protein 47.74.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human CBP20 protein 47. 74 detected in the test can be used to explain the importance of human CBP20 protein 47. 74 in various diseases and to diagnose diseases in which human CBP20 protein 47. 74 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human CBP20 protein 47.74 can also be used for a variety of therapeutic purposes. Gene therapy Surgery can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human CBP20 protein 47.74.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human CBP20 protein 47.74 to inhibit endogenous human CBP20 protein 47.74 activity.
- a mutant human CBP20 protein 47. 74 may be a shortened human CBP20 protein 47. 74 lacking a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity.
- the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human CBP20 protein 47.74.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human CBP20 protein 47.74 into a cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding the human CBP20 protein 47.74 can be found in the literature (Sambrook, et al.). 0
- Another recombinant polynucleotide encoding the human CBP20 protein 47.74 can be packaged into lipids. In vivo transfer into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense MA and MA
- ribozymes that inhibit human CBP20 protein 47.74 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
- Antisense RNA, DM, and ribozymes can be obtained by any MA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis, which is widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
- This DM sequence is integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length of the two hydrazones, and using phosphorothioate or peptide bonds instead of phosphodiester bonds for the linkage between ribonucleosides.
- the polynucleotide encoding human CBP20 protein 47. 74 can be used for the diagnosis of diseases related to human CBP20 protein 47. 74.
- the polynucleotide encoding human CBP20 protein 47. 74 can be used to detect the expression of human CBP20 protein 47. 74 or the abnormal expression of human CBP20 protein 47. 74 in a disease state.
- the DNA sequence encoding human CBP20 protein 47. 74 can be used to hybridize biopsy specimens to determine the expression of human CBP20 protein 47. 74.
- Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- 74 specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the human CBP20 protein 47.
- RT-PCR RNA-polymerase chain reaction
- 74 gene can also be used to diagnose human CBP20 protein 47. 74-related diseases. Human CBP2 0 protein 47. 74 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human CBP20 protein 47. 74 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.
- Fluorescent in situ hybridization F ISH
- F ISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be To correlate with genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian
- the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human CBP20 protein 47. 74 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human CBP20 protein 47.74 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2002210340A AU2002210340A1 (en) | 2000-07-07 | 2001-07-02 | A novel polypeptide- human cbp20 protein 47.74 and the polynucleotide encoding said polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00117082.1 | 2000-07-07 | ||
CN 00117082 CN1333270A (zh) | 2000-07-07 | 2000-07-07 | 一种新的多肽——人cbp20蛋白47.74和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2002014510A1 true WO2002014510A1 (fr) | 2002-02-21 |
Family
ID=4586479
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/001132 WO2002014510A1 (fr) | 2000-07-07 | 2001-07-02 | Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1333270A (fr) |
AU (1) | AU2002210340A1 (fr) |
WO (1) | WO2002014510A1 (fr) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR102077871B1 (ko) * | 2010-11-16 | 2020-02-14 | 유니버시티 오브 써던 캘리포니아 | 체세포 줄기 세포의 비대칭 분열을 향상시키기 위한 cbp/카테닌 길항제 |
EP3059591A1 (fr) * | 2015-02-23 | 2016-08-24 | Abivax | Procédés de criblage de composés pour traiter ou prévenir une infection virale ou un état associé à un virus |
-
2000
- 2000-07-07 CN CN 00117082 patent/CN1333270A/zh active Pending
-
2001
- 2001-07-02 WO PCT/CN2001/001132 patent/WO2002014510A1/fr active Application Filing
- 2001-07-02 AU AU2002210340A patent/AU2002210340A1/en not_active Abandoned
Non-Patent Citations (3)
Title |
---|
DATABASE PROTEIN [online] 14 July 1999 (1999-07-14), YANG X.J. ET AL., retrieved from GI:5468533 accession no. NCBI Database accession no. AAC50890 * |
DATABASE PROTEIN [online] 29 May 1998 (1998-05-29), RICKE D.O. ET AL., retrieved from GI:3168627 accession no. NCBI Database accession no. AAC17736 * |
LI YING, FENG JIAN-SHENG: "The cap structure and cap-binding protein of mRNA in eukaryotes", LIFE SCIENCE RESEARCH, vol. 3, no. 4, December 1999 (1999-12-01), pages 286 - 291 * |
Also Published As
Publication number | Publication date |
---|---|
AU2002210340A1 (en) | 2002-02-25 |
CN1333270A (zh) | 2002-01-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002014510A1 (fr) | Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide | |
WO2001092319A1 (fr) | NOUVEAU POLYPEPTIDE, RECEPTEUR HUMAIN 19.68 DE L'INTERFERON α, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE | |
WO2001075048A2 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide | |
WO2001079432A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide | |
WO2001090177A1 (fr) | Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide | |
WO2002006470A1 (fr) | Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide | |
WO2002006471A1 (fr) | Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide | |
WO2001072801A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide | |
WO2001075101A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide | |
WO2001081594A1 (fr) | Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide | |
WO2001092329A1 (fr) | Nouveau polypeptide, sous-unite $g(a) d'atp-synthetase 9.9, et polynucleotide codant ce polypeptide | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001087949A1 (fr) | Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001070965A1 (fr) | Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide | |
WO2001094534A2 (fr) | Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide | |
WO2001083683A2 (fr) | Nouveau polypeptide, proteine pax humaine 11.3, et polynucleotide codant pour ce polypeptide | |
WO2001092324A1 (fr) | Nouveau polypeptide, nucleoproteine humaine 10.78 basophile, et polynucleotide codant ce polypeptide | |
WO2001090172A1 (fr) | Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide | |
WO2002014365A1 (fr) | Nouvelle proteine 12 activatrice du polypeptide-ras gtp et le polynucleotide codant pour ladite proteine | |
WO2001087962A1 (fr) | Nouveau polypeptide, proteine pax humaine 11, et polynucleotide codant ce polypeptide | |
WO2002020595A1 (fr) | Nouveau polypeptide, proteine a doigt de zinc humaine 18.04, et polynucleotide codant ce polypeptide | |
WO2001087959A1 (fr) | Nouveau polypeptide, proteine pax humaine 11.9, et polynucleotide codant pour ce polypeptide | |
WO2002012486A1 (fr) | Nouveau polypeptide, recepteur humain de la serine kinase 10.34, et polynucleotide codant ce polypeptide | |
WO2001087963A1 (fr) | Proteine s18-12 ribosomale, polypeptide humain, et polynucleotide la codant | |
WO2001090173A1 (fr) | Nouveau polypeptide, chaperonine humaine cpn60 10, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |