WO2002006470A1 - Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002006470A1
WO2002006470A1 PCT/CN2001/001070 CN0101070W WO0206470A1 WO 2002006470 A1 WO2002006470 A1 WO 2002006470A1 CN 0101070 W CN0101070 W CN 0101070W WO 0206470 A1 WO0206470 A1 WO 0206470A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human myosin
sequence
seq
Prior art date
Application number
PCT/CN2001/001070
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2001295404A priority Critical patent/AU2001295404A1/en
Publication of WO2002006470A1 publication Critical patent/WO2002006470A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/795Porphyrin- or corrin-ring-containing peptides
    • C07K14/805Haemoglobins; Myoglobins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/06Tripeptides
    • A61K38/066TRH, thyroliberin, thyrotropin releasing hormone

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, "" Myosin IXA11.88, "and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
  • myosin there are a large number of unconventional myosin in the body, these proteins are members of the myosin superfamily. Studies have found that the protein sequences of all of these proteins also contain conserved head, neck, and tail domains of conventional myosin. The head is the binding site of the protein to ATP and actin; the neck is the light chain binding domain of the calmodulin / EF hand protein family. Unconventional myosin in vivo can be divided into 11 different types. All these types of myosin have similar head and neck domains, but their tail structures are different.
  • the tail of myosin VI I also contains an ankle protein domain, which is an important active site for the protein to bind to and cooperate with the plasma membrane.
  • the tail does not contain a conserved helix-helix domain, but it does contain a GTP inactive protein domain, which enhances the GTPase activity of the protein in vivo. All different types of myosin bind to actin in the body, as a molecular power, regulate the progress of related biological processes in the body.
  • myosin IXA plays a very important role in all stages of embryonic development in vivo.
  • This protein has similar structural characteristics to various known unconventional myosin proteins, and its mutation or abnormal expression will cause abnormal development of relevant tissues in the body, and then cause various related diseases.
  • This protein is usually associated with some autosomal recessive genetic diseases (such as obesity, reproductive dysfunction, mental retardation, etc.), hearing loss, Usher syndrome, vestibular dysfunction, pigmented retinitis, and multi-toe or poly-toe diseases. The occurrence of the disease is closely related. It can also be used to diagnose and treat various diseases mentioned above.
  • human myosin IXA11. 88 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there is always a need to identify more involved in these Process of human myosin IXA11. 88 protein, especially the amino acid sequence of this protein is identified.
  • the isolation of the novel human myosin IXA11. 88 protein encoding gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human myosin IXA11.88.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human myosin IXA11.88.
  • Another object of the present invention is to provide a method for producing human myosin IXA11. 88.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human myosin IXA11. 88.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human myosin IXA11.88.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to human myosin IXA11.88 abnormalities. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1767-2093 in SEQ ID NO: 1; and (b) a sequence having 1-2816 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human myosin IXA11.88 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human myosin IXA11.88 protein, comprising detecting mutations in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human myosin IXA11.88.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human myosin IXA11. 88 and human myosin IXA according to the present invention.
  • the upper graph is a graph of the expression profile of human myosin IXA11. 88, and the lower graph is the graph of the expression profile of human myosin IXA.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human myosin IXA11.88.
  • 12kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • Antagonist means that when combined with human myosin IXA11. 88, a protein that causes the protein to change Molecules that modulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human myosin IXA11.88.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human myosin IXA11.88 when combined with human myosin IXA11.88.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human myosin IXA11.88.
  • Regular refers to a change in the function of human myosin IXA11. 88, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human myosin IXA11.88. change.
  • Substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human myosin IXA11. 88 using standard protein purification techniques. Basic The pure human myosin IXA11. 88 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human myosin ⁇ ⁇ 11. 88 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi ggins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Sequence ⁇ The number of residues that match the sequence ⁇ 100
  • the assay may be JTotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzymo logy 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? , It can specifically bind to the epitope of human myosin IXA11. 88.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human myosin IXA11. 88 means human myosin IXA11. 88 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human myosin IXA11. 88 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human Myosin IXA11. 88 Peptide Pure Degree can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human myosin IXA11.88, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human myosin IXA11.88.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of human myosin IXA11.88 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a total polynucleotide sequence of 2816 bases and its open reading frame of 1767-2093 encodes 108 amino acids.
  • the polynucleotide of the present invention may be in the DM form or the RM form.
  • DNA forms include cDM, genomic DM, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DM can be coded or non-coded.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; The coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence (and optional additional coding sequences) of the mature polypeptide and non-coding sequences.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to a polynucleotide that can hybridize to the polynucleoside hydrazone according to the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fico ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human myosin IXA11.88.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding human myosin IXA11.88 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the MA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate the mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid Or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene :).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RM hybridization; (2) the presence or loss of marker gene function; (3) determination of the level of human myosin IXA11. 88 transcripts; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of a probe is usually within 2,000 nucleotides, compared to 1000 nucleotides.
  • the probe used herein is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human myosin IXA11.88 gene expression.
  • a method for amplification of DM / RM using PCR technology is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-cDM terminal rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDM sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human myosin IXA11.88 coding sequence, and a recombinant technology for producing a polypeptide of the present invention. method.
  • a polynucleotide sequence encoding human myosin IXA11.88 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • carrier refers to a substance known in the art. Bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human myosin ⁇ . 88 and suitable transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cl oning, a Laboratory Manua 1, Cold Harbor Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human myosin IXA11.88 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be harvested after exponential growth phase, with (: Treatment 1 2, steps well known in the art used alternative is to use MgCl 2..
  • transformation can also be performed by electroporation.
  • the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant human myosin IXA11. 88 (Science, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • the body contains a large number of unconventional myosins, which are members of the myosin superfamily. Studies have found that myosin has binding sites for ATP and actin. All different types of myosin bind to actin in the body, as a molecular power, regulate the progress of relevant biological processes in the body.
  • the new myosin IXA has a variety of known unconventional myosins with similar structural characteristics, It plays a very important role in all stages of the body's embryonic development.
  • the protein is usually associated with the occurrence of a variety of autosomal recessive genetic diseases such as obesity, reproductive dysfunction, and mental retardation in vivo. Its mutation or abnormal expression will also cause closely related diseases such as hearing loss, pigmented retinitis, embryonic developmental stage toe, multi-toe and other diseases.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human myosin IXA, and both have similar biological functions.
  • the polypeptide of the present invention binds to actin in the body, and as a molecular power, regulates the progress of related biological processes in the body. It is usually associated with a variety of autosomal recessions such as obesity, reproductive dysfunction, and intelligence deficiency syndrome. Related to the occurrence of genetic diseases. Its mutation or abnormal expression will also cause closely related diseases such as hearing loss, pigmented retinitis, embryonic developmental stage toe, polydactyl and other diseases. And produce related diseases.
  • human myosin IXA11 88 of the present invention will produce various diseases, especially obesity, reproductive dysfunction, mental retardation syndrome, pigmented retinitis, parallel toes, polytoes, tumors, embryo development Disorders, growth disorders, inflammation, immune diseases, these diseases include but are not limited to:
  • Fetal developmental disorders limb differentiation disorders, congenital abortion, cleft palate, limb absence, atrial septal defect, neural tube defects, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroids, colon cancer, endometrial cancer, fibroids, fibrosarcoma, lipoma, liposarcoma inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebral spinal cord multiple sclerosis, kidney Globululonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially obesity, reproductive function, mental retardation syndrome, pigmented retinitis, and toes. , Polydactyly, tumors, embryonic developmental disorders, disorders of growth and development, inflammation, immune diseases, etc.
  • the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human myosin IXA11.88. Agonists enhance human myosin IXA11. 88 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing human myosin IXA11. 88 can be cultured together with labeled human myosin IXA11. 88 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human myosin IXA11. 88 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human myosin IXA11. 88 can bind to human myosin IXA11. 88 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
  • human myosin IXA11. 88 can be added to a bioanalytical assay to determine whether the compound is a compound by measuring the effect of the compound on the interaction between human myosin IXA11.88 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Polypeptide molecules capable of binding to human myosin IXA11.88 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human myosin IXA11. 88 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human myosin IXA11. 88 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human myosin IXA11. 88 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent. Techniques for preparing monoclonal antibodies to human myosin IXA11. 88 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
  • Embedding antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against human myosin IXA11.88.
  • Monoclonal antibodies that bind to human myosin IXA11. 88 can also be labeled with radioisotopes. Its location and distribution can be tracked into the body. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • Human myosin Human myosin
  • High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds.
  • SPDP thiol crosslinker
  • This hybrid antibody can be used to kill human myosin IXA11. 88 positive cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human myosin IXA11.88. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human myosin IXA11.88.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human myosin IXA11. 88 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human myosin IXA11.88 detected in the test can be used to explain the importance of human myosin IXA11.88 in various diseases and to diagnose diseases in which human myosin IXA11.88 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human myosin IXA11. 88 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human myosin IXA11.88.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human myosin IXA11.88 to inhibit endogenous human myosin IXA11.88 activity.
  • a variant human myosin IXA11. 88 may be a shortened human myosin IXA11. 88, which lacks a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human myosin IXA11.88.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human myosin IXA11.88 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human myosin IXA11.88 can be found in existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human myosin IXA11.88 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides (including antisense RNA and DNA) that inhibit human myosin IXA11.88 mRNA and nuclear Enzymes are also within the scope of the invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target to perform endonucleation.
  • Antisense RNA, DNA and ribozymes can be obtained by any existing MA or DNA synthesis technology. For example, the technology for the synthesis of oligonucleotides by solid-phase phosphate amide synthesis has been widely used.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human myosin IXA11. 88 can be used for the diagnosis of diseases related to human myosin IXA11. 88.
  • the polynucleotide encoding human myosin IXA11. 88 can be used to detect the expression of human myosin IXA11. 88 or the abnormal expression of human myosin IXA11. 88 in a disease state.
  • the DNA sequence encoding human myosin IXA11. 88 can be used to hybridize biopsy specimens to determine the expression of human myosin IXA1 L 88.
  • Hybridization techniques include Southern blotting, orthern blotting, in situ hybridization, and the like.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DM chip (also known as a "gene chip") for differential expression analysis and gene diagnosis of genes in tissues.
  • a microarray or a DM chip also known as a "gene chip”
  • 88 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human myosin IXA11. 88 transcription products.
  • Detection of mutations in the human myosin IXA11. 88 gene can also be used to diagnose human myosin IXA11. 88-related diseases.
  • the forms of human myosin IXA11.88 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human myosin IXA11.88 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • the PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments. PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific CDM libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human myosin IXA 11.88 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human myosin IXA11.88 administered to patients Circumstances will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnosing doctor ⁇ Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik raRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Smart cDNA cloning kit (purchased from Clontech l cDM fragment was inserted into the multicloning site of pBSK (+) vector (Clontech)) to transform DH5 a to form a cDNA library.
  • Dye terminate cycle react ion sequencing ki t Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • CDM was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, PCR was performed using the following primers:
  • Primer 1 5,-GGTGAAAGAAAATGAAGGCCTGAA -3, (SEQ ID NO: 3)
  • Primer2 5'- TATTTAATAAAAGCTTTATTAAAA -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • a reaction volume of 50 ⁇ 1 contains 50 mmol / L KCl, 10 mmol / L Tri s-HCl pH 8. 5, 1. 5 mmol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, 1 Opmol primer, 1U Taq DNA polymerase (Clontech).
  • PE9600 DNA Thermal Cycler Perkin-Blmer: 25 cycles of reaction: 94 ° C 30sec; 55. C 30sec; 72. C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen). DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l-2816bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human myosin IXA11. 88 gene expression
  • RNA extraction in one step [Anal. Biochera 1987, 162, 156-159] rempliThis method involves acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M Sodium acetate (pH 4.0) was used to homogenize the tissue, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, and the mixture was centrifuged. The aqueous phase layer was aspirated, and isopropyl alcohol ( 0.8 volume) and the mixture was centrifuged to obtain RM pellet. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • the 32P-labeled probe (about 2 ⁇ 10 6 cpm / ml) and transferred to a nitrocellulose membrane RM is hybridized overnight at 42 ° C in a solution, the solution comprising 50% formamide -25fflM KH 2 P0 4 (pH7 4 ) -. 5 SSC-5 ⁇ Denhardt's solution and 20 ⁇ g / ml salmon sperm DM. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C. for 30 min. Then, it was analyzed and quantified by Phosphor Imager Example 4 In vitro expression, isolation and purification of recombinant human myosin IXA11. 88
  • Pr imer 3 5'-CCCCATATGATGCCTTTTCCTTCCTTTTCTCAC-3 '(Seq ID No: 5)
  • Primer4 5'-CATGGATCCTTACATCACTTTATGATAATACAT-3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and BamHI digestion sites, respectively Points, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the restriction sites of Mel and BaniHI correspond to the expression vector plasmid pET- 2 8b (+) (Novagen, Cat. No. 69865. 3 Selective endonuclease sites on).
  • the pBS-0465 g 09 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0465g09 plasmid, primers Primer-3 and Primer-4 were lpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed by E.coli M5 ⁇ using the calcium chloride method. After culturing the LB plate containing kanamycin (final concentration 30 ⁇ 1) overnight, the positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0465g09) with the correct sequence was selected, and the recombinant plasmid was transformed into Escherichia coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human myosin IXA11. 88-specific peptides: NH2-Met-Pro-Phe-Pro-Ser-Phe-Ser-H is-Ile-Ala-I l e -Phe-Asp-I 1 e-Ser-C00H (SEQ ID NO: 7). The polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting Trace method, Northern blotting method and copying method, etc., are all used to fix the polynucleotide sample to be tested on the filter membrane and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, please refer to the literature DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And the literature Hel le, RA, Schema , M., Chai, A., Sha lom, D., (1997) PN AS 94: 2150
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs as target DNA, including the present invention Polynucleotide. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA), between the points. The distance is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DM on the glass slide to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • Oligotex mRNA Midi Kit purchased from QiaGen.
  • Reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was labeled.
  • the probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2 SDS) at room temperature and scanned with ScanArray 3000.
  • the instrument purchased from General Scanning Company, USA) was used for scanning.
  • the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line, thymus, normal fibroblasts 1024NC, Fibroblast, Growth factor stimulation, 1024NT, scar-to-fc growth factor stimulation, 1013HT, scar-to-fc growth factor stimulation, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen , Prostate cancer, jejunum adenocarcinoma, cardia cancer. Based on these 18 Cy3 / Cy5 ratios, a histogram is drawn (Figure 1). It can be seen from the figure that the expression profiles of human myosin IIA 11.88 and human myosin IXA according to the present invention are very similar.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Endocrinology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une myoglobuline humaine IXA11.88, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de l'obésité, de la dégénérescence des fonctions de reproduction, de syndromes provoquant une déficience mentale, de rétinites pigmentaires, de polydactylies, de syndactylies, de tumeurs, de troubles du développement de l'embryon, d'inflammations et de maladies immunitaires. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la myoglobuline humaine IXA11.88.
PCT/CN2001/001070 2000-06-30 2001-06-29 Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide WO2002006470A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001295404A AU2001295404A1 (en) 2000-06-30 2001-06-29 A novel polypeptide, a human myoglobulin ixa11.88 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116978.5 2000-06-30
CN 00116978 CN1331243A (zh) 2000-06-30 2000-06-30 一种新的多肽——人肌球蛋白ixa11.88和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002006470A1 true WO2002006470A1 (fr) 2002-01-24

Family

ID=4586377

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001070 WO2002006470A1 (fr) 2000-06-30 2001-06-29 Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1331243A (fr)
AU (1) AU2001295404A1 (fr)
WO (1) WO2002006470A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9072748B2 (en) 2008-12-05 2015-07-07 Abbvie Inc. BCL-2-selective apoptosis-inducing agents for the treatment of cancer and immune diseases

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 12 May 1997 (1997-05-12), Database accession no. AC002077.1 *
DATABASE GENBANK [online] 18 September 1996 (1996-09-18), Database accession no. L13197.1 *
DATABASE GENBANK [online] 22 August 1997 (1997-08-22), Database accession no. AF001550.1 *
DATABASE GENBANK [online] 24 May 2000 (2000-05-24), retrieved from HS21C084 accession no. EMBL Database accession no. AL163284.2 *
DATABASE GENBANK [online] 29 May 1997 (1997-05-29), Database accession no. AC000394 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9072748B2 (en) 2008-12-05 2015-07-07 Abbvie Inc. BCL-2-selective apoptosis-inducing agents for the treatment of cancer and immune diseases
US9125913B2 (en) 2008-12-05 2015-09-08 Abbvie Inc. Bcl-2-selective apoptosis-inducing agents for the treatment of cancer and immune diseases
US9315488B2 (en) 2008-12-05 2016-04-19 Abbvie Inc. Bcl-2-selective apoptosis-inducing agents for the treatment of cancer and immune diseases

Also Published As

Publication number Publication date
AU2001295404A1 (en) 2002-01-30
CN1331243A (zh) 2002-01-16

Similar Documents

Publication Publication Date Title
WO2002006470A1 (fr) Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide
WO2002014510A1 (fr) Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide
WO2001092319A1 (fr) NOUVEAU POLYPEPTIDE, RECEPTEUR HUMAIN 19.68 DE L'INTERFERON α, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2002040525A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 18.92, et polynucleotide codant ce polypeptide
WO2001090133A1 (fr) Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2002006471A1 (fr) Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001092329A1 (fr) Nouveau polypeptide, sous-unite $g(a) d'atp-synthetase 9.9, et polynucleotide codant ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001092518A1 (fr) Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide
WO2002012297A1 (fr) Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide
WO2001090352A1 (fr) Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide
WO2001094534A2 (fr) Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide
WO2002006473A1 (fr) Nouveau polypeptide, proteine humaine 10.01 associee au recepteur d'oestrogene, et polynucleotide codant ce polypeptide
WO2001094536A2 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 10.89, et polynucleotide codant ce polypeptide
WO2002012489A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 44, et polynucleotide codant ce polypeptide
WO2001079491A1 (fr) Nouveau polypeptide, canal ionique humain 12 pour le chlore, et polynucleotide codant pour ce polypeptide
WO2001090379A1 (fr) Nouveau polypeptide, nucleoproteine basophile humaine 22.55, et polynucleotide codant ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2002020600A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 10.45, et polynucleotide codant ce polypeptide
WO2001090173A1 (fr) Nouveau polypeptide, chaperonine humaine cpn60 10, et polynucleotide codant pour ce polypeptide
WO2001092516A1 (fr) Nouveau polypeptide, proteine ribosomale s19e 13, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

ENP Entry into the national phase

Country of ref document: RU

Kind code of ref document: A

Format of ref document f/p: F

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP