WO2001092516A1 - Nouveau polypeptide, proteine ribosomale s19e 13, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine ribosomale s19e 13, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001092516A1
WO2001092516A1 PCT/CN2001/000830 CN0100830W WO0192516A1 WO 2001092516 A1 WO2001092516 A1 WO 2001092516A1 CN 0100830 W CN0100830 W CN 0100830W WO 0192516 A1 WO0192516 A1 WO 0192516A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
protein
polynucleotide
ribosomal
sequence
Prior art date
Application number
PCT/CN2001/000830
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU89484/01A priority Critical patent/AU8948401A/en
Publication of WO2001092516A1 publication Critical patent/WO2001092516A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide glycoprotein s l9e protein 1 3, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • the ribosome is a processing site for protein synthesis. It continuously moves along the mRNA in the body to synthesize peptide chains at extremely fast speeds.
  • the ribosomal protein binds to rRNA in a certain order and the proteins interact with each other to assemble into two ribosomal subunits, one large subunit and one small subunit, where the large subunit is approximately twice the small subunit, and rRNA is directly involved in the binding of mRNA and tRNA.
  • the ribosome and its cofactors combine to possess all the enzyme activities required at each stage of protein synthesis. These enzyme activities are only available in the presence of the overall ribosome structure, and neither ribosome proteins nor rRNA can participate in protein synthesis reactions alone.
  • the ribosome is composed of two subunits, the various ribosomal proteins have certain positions in the large and small subunits, and rRNA is the backbone. Some ribosomal proteins bind directly to rRNA. These proteins bind to rRNA and change the conformation of rRNA, so that other proteins bind to rRNA again. They are important components for maintaining ribosome conformation. Some ribosomal proteins do not directly bind to rRNA. rRNA binds, but binds to other proteins. These proteins work in concert with other proteins in the body to enable the ribosome to perform normal physiological functions. All ribosomal proteins form a separate protein family, the ribosomal protein family.
  • Ribosomal protein S19e is a component of the small ribosomal subunit. It is contained in the ribosomal assembly of archaea and eukaryotes. All S19e proteins from different sources have a high degree of sequence similarity. These proteins are members of the ribosomal protein family and all consist of 143-155 amino acid residues. It was found that ribosomal protein S19e directly binds to specific regions of rRNA during ribosome assembly, which plays an important regulatory role in the process of chromatin reduction in organisms. Chromatin depletion is a way for organisms to regulate the expression of different genes.
  • the central region of all ribosomal S19e proteins contains the consensus sequence fragments as shown below: GGGX (2)-[GSA] -QX (2)-[SA] -X (3)-[GSA] -X-[GSTAV]-[KR]-[GSAL]-[LIF];
  • This sequence fragment is a central region where the protein binds to rRNA and other ribosomal constituent proteins, and together maintains the central region of the active conformation of the ribosome and exerts normal physiological functions. Mutations in this fragment will cause abnormal expression of the ribosomal S19e protein, and thus cannot properly regulate the expression of genetic information, that is, affect the normal progress of various related metabolic pathways in the body. Abnormal expression of this protein usually leads to abnormal expression regulation of protein translation level, which causes various related metabolic disorders, immune system diseases, various tumors and cancers, etc. ⁇
  • ribosomal s l9e protein 13 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes.
  • the ribosomal s19e protein 13 protein identifies the amino acid sequence of this protein. Isolation of the new ribosomal s l9e protein 13 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding for DM.
  • An object of the present invention is to provide an isolated novel polypeptide monoribosomal s19e protein 13 and fragments, analogs and derivatives thereof.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a ribosomal s19e protein 13.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a ribosomal s19e protein 13.
  • Another object of the present invention is to provide a method for producing ribosomal s19e protein 13.
  • Another object of the present invention is to provide a peptide-ribosomal sl 9e protein 13 of the present invention. Antibodies.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide monoribosomal s19e protein 13 of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of ribosomal s19e protein 13. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 294-650 in SEQ ID NO: 1; and (b) a sequence having 1-2101 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of ribosomal s19e protein 13 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of ribosomal s l9e protein 13 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of ribosomal s 9e protein 13.
  • Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of ribosomal sl9e protein 13 and ribosomal sl9e protein according to the present invention.
  • the upper graph is a graph of the ribosome sl9e protein 13 expression
  • the lower graph is the ribosome of the sl9e protein expression.
  • 1-bladder mucosa 2-PMA + Ecv304 cell line, 3- LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5- Fibroblas t, growth factor stimulation, 1024NT, 6-scar into fc growth factor Stimulation, 1013HT, 7-scar into fc without stimulation with growth factor, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetus Skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated ribosomal sl9e protein 13. 13kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insert refers to a change in the amino acid sequence or nucleotide sequence that results in Compared to the molecule, one or more amino acids or nucleotides are increased.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with ribosomal s19e protein 13, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to ribosomal s19e protein 13.
  • Antagonist refers to a molecule that, when combined with ribosomal sl9e protein 13, can block or regulate the biological or immunological activity of ribosome sl9e protein 13.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to ribosomal s19e protein 13.
  • ribosomal sl9e protein 13 refers to a change in the function of ribosomal sl9e protein 13, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of ribosomal sl9e protein 13.
  • Substantially pure ' means essentially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can purify ribosomal sl9e protein 13 using standard protein purification techniques. 13 Purely pure Ribosome sl9e protein 13 can generate a single main band on a non-reducing polyacrylamide gel. The purity of ribosomal sl9e protein 13 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b ') 2 and F V, which specifically binds to ribosomal protein antigen sl9e 13 determinant.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides coexist in a natural state Separated in other materials, it is isolated and purified.
  • isolated ribosomal sl9e protein 13 refers to ribosomal sl 9e protein 13 which is essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify ribosomal sl9e protein 13 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of ribosomal s l9e protein 13 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide monoribosomal sl9e protein 13, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of ribosomal sl9e protein 13.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the ribosomal s19e protein 13 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as leader sequences or secretory sequences or sequences used to purify this polypeptide).
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2101 bases, and its open reading frames 294-650 encode 118 amino acids.
  • this polypeptide has a similar expression profile to ribosomal s l9e protein, and it can be deduced that the ribosome sl9e protein 13 has similar functions to ribosomal s l9e protein.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be encoded Chain or non-coding chain.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50 ° /.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding ribosomal sl9e protein 13.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding ribosomal sl 9e protein 13 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DM; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate raRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • fflRM a plasmid or phage cDNA library.
  • kits are also commercially available (Qiagene).
  • construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of ribosomal s 9e protein 13 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of ribosomal s l9e protein 13 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method (Sa iki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-cDM terminal rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. To obtain the full-length CDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a ribosome S 19e protein 13 coding sequence, and a recombinant technology to produce the polypeptide of the present invention method.
  • the polynucleotide sequence encoding the ribosomal s 9e protein 13 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding the ribosomal sl9e protein 13 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Spin Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding ribosomal sl9e protein 13 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • a prokaryotic cell such as a bacterial cell
  • a lower eukaryotic cell such as a yeast cell
  • a higher eukaryotic cell such as a mammalian cell.
  • Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CHO, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the 01 12 method, the steps used are well known in the art.
  • MgCl 2 is used.
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant ribosomal s19e protein 13 (Science, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • the correct translation of proteins requires the cooperation of various aminoacyl-tMA synthetases, various tRNAs, and ribosomes. Ribosomes and other cofactors together provide the full enzymatic activity of the translation process. These enzyme activities are only in the ribosome. Only if the overall structure is complete. Ribosomal protein S19e is one of the proteins in the small ribosomal subunit.
  • Chromatin depletion is a way for organisms to regulate the expression of different genes. Chromatin depletion can regulate the different levels of DM in somatic and embryonic cells and the expression of some genes [Et ter A., et a l., 1991 ].
  • the abnormal expression of the specific S19e family protein mot if will cause the function of the polypeptide containing the mot if of the present invention to be abnormal, which will cause mistranslation of mRNA and cause related diseases such as tumors, embryonic development disorders, and growth. Developmental disorders, etc.
  • ribosomal s19e protein 10 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, growth and development disorders, and inflammation. These diseases include, but are not limited to:
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymus Tumor, Nasal and Sinus Tumors, Nasopharyngeal Carcinoma, Laryngeal Carcinoma, Tracheal Tumor, Pleural Mesothelioma, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma
  • Embryonic developmental disorders congenital abortion, cleft palate, facial oblique fissure, limb absentness, limb differentiation disorder, gastrointestinal atresia or stenosis, hyaline membrane disease, atelectasis, polycystic kidney disease, ectopic kidney, double ureter, cryptorchidism , Congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital Cataract, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, certain diseases. Some hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) ribosomal sl9e protein 13.
  • Agonists enhance ribosomal sl9e protein 13 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing ribosomal s19e protein 13 can be cultured together with labeled ribosomal s19e protein 13 in the presence of a drug. The ability of the drug to increase or block this interaction is then measured.
  • Antagonists of ribosomal s l9e protein 13 include antibodies, compounds, receptor deletions, and the like that have been screened.
  • An antagonist of ribosomal s19e protein 13 can bind to ribosomal s19e protein 13 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform a biological function.
  • ribosomal s19e protein 13 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between ribosomal s19e protein 13 and its receptor. .
  • Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to ribosomal sl 9e protein 13 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the ribosomal s l9e protein 13 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the ribosomal s19e protein 13 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting ribosomal sl 9e protein 13 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
  • Techniques for preparing monoclonal antibodies to ribosomal sl9e protein 13 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morr i son et al, PNAS, 1985, 81: 6851).
  • the single-chain antibody production technology (US Pat No. 4946778) can also be used to produce single-chain antibodies against ribosomal sl9e protein 13.
  • Antibodies against ribosomal sl9e protein 13 can be used in immunohistochemistry to detect ribosome sl9e protein 13 in biopsy specimens.
  • Monoclonal antibodies that bind to ribosomal sl9e protein 13 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins against a specific bead site in the body.
  • ribosomal sl9e protein 13 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill ribosome sl9e protein 13 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to ribosomal sl9e protein 13.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of ribosomal sl9e protein 13.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of ribosomal sl9e protein 13 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of ribosomal sl9e protein 13 detected in the test can be used to explain the importance of ribosomal sl9e protein 13 in various diseases and to diagnose diseases in which ribosomal sl9e protein 13 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding ribosomal S 19e protein 13 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of ribosomal sl9e protein 13.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutant ribosome sl9e protein 13 to inhibit endogenous ribosome sl9e protein 13 activity.
  • a variant ribosomal sl9e protein 13 may be a shortened ribosome sl9e protein 13 that lacks a signaling functional domain, and although it can bind to a downstream substrate, it lacks signaling activity.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of ribosomal sl9e protein 13.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding ribosomal sl9e protein 13 into a cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a ribosomal sl9e protein 13 can be found in the existing literature (Sambrook, et al.).
  • recombinant polynucleotide encoding ribosomal sl9e protein 13 Can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DM
  • ribozymes that inhibit ribosomal s19e protein 13 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as the solid-phase phosphoramidite synthesis method for oligonucleotide synthesis, which is widely used.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding ribosomal S 19e protein 13 can be used for the diagnosis of diseases related to ribosomal sl 9e protein 13.
  • the polynucleotide encoding ribosomal s l9e protein 13 can be used to detect the expression of ribosome s l9e protein 13 or the abnormal expression of ribosome s l9e protein 13 in disease states.
  • the DNA sequence encoding ribosomal sl 9e protein 13 can be used to hybridize biopsy specimens to determine the expression of ribosomal sl 9e protein 13.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like.
  • RNA-polymerase chain reaction with primers specific for ribosomal sl9e protein 13 can also be used to detect the transcription products of ribosome sl9e protein 13.
  • Ribosome sl9e protein 13 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type ribosome sl9e protein 13 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Only few chromosome markers based on actual sequence data (repeat polymorphisms) are available For marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceuticals or biological products, which instructions reflect production, use Or a government agency that sells it allows it to be administered to humans.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Ribosome s l9e protein 13 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of ribosomal s 9e protein 13 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RM using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mMA forms cDNA by reverse transcription. Use Smart cDM Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multicloning site of pBSK (+) vector (Clontech), and transformed into DH5 ⁇ . The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imerl 5,-GATCAGGGATACAAAACAAAAAAC -3, (SEQ ID NO: 3)
  • Primer2 5'- TCATTAATATTTTATTTCCTTTCA -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 ⁇ l of Kol, 10 ramol / L Tri s-HCl pH 8.50, 1.5 mmol / L MgCl 2 , 200 ⁇ 1 / dNTP, lOpmol primer, 1U Taq DNA in a 50 ⁇ 1 reaction volume Polymerase (Clontech).
  • the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as 'daily control' and template blank as negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-2101bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of ribosomal sl9e protein 13 gene expression
  • RNA extraction in one step [Anal. Biochetn 1987, 162, 156-159].
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was electrophoresed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0) and 5 mM sodium acetate-lmM EDTA-2. 2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • 32 P dATP Preparation 32 P- DNA probe labeled by the random primer Method - with oc.
  • the DM probe used is the PCR-encoded ribosome sl9e protein 13 coding region sequence (294bp to 650bp) shown in FIG.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25raM KH 2 P0 4 (pH7. 4) -5 x SSC-5 x Denhardt's solution and 20 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then Analysis and quantification using Phosphor Imager.
  • Example 4 In vitro expression, isolation and purification of recombinant ribosomal sl9e protein 13
  • Primer3 5'-CATGCTAGCATGCATCTCCTCCTGCTCTCCAGC-3 '(Seq ID No: 5)
  • Pr imer4 5'-CCCGAATTCCTATCGGCCTTCCCCCTGAGCCAG-3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Nhel and EcoRI digestion sites, respectively , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Nhel and EcoRI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • the pBS-0680d01 plasmid of the target gene was used as a template for PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0680d01 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into coliform bacteria DH5a by the calcium chloride method, and cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were selected by colony PCR method and sequenced. Positive sequence correct clone (PET-0680d01) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • Polypeptide synthesizer (product of PE company) was used to synthesize the following ribosomal sl9e protein 13-specific peptides: -Leu-Gln-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex.
  • Rabbits were immunized with 4 mg of the hemocyanin polymorphic complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to Identifying whether it contains the polynucleotide sequence of the present invention and detecting a homologous polynucleotide sequence, further The probe is used to detect whether the expression of the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof in cells of normal tissues or pathological tissues is abnormal.
  • the purpose of this example is to select a suitable oligonucleotide fragment from the polynucleotide SBQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method Acid sequence or a homologous polynucleotide sequence thereof.
  • Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their The complementary regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the gene fragment of SEQ ID NO: 1 or its Replacement mutation sequence of complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the sample membrane was placed in a plastic bag, and 3-l Omg pre-hybridization solution (l OxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)) was added. After closing the bag, 68. C. Water shake for 2 hours.
  • 3-l Omg pre-hybridization solution l OxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; finding and screening for tissue specificity New genes, especially those related to diseases such as tumors; Diagnosis of diseases, such as hereditary diseases.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DM on the glass slide to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRM was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen). The fluorescent reagent Cy3dUTP was separately reverse-transcribed.
  • the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar-like fc growth factor stimulation 1013HT, scar into fc not stimulated with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardia cancer.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine ribosomale s19e 13, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine ribosomale s19e 13.
PCT/CN2001/000830 2000-05-24 2001-05-21 Nouveau polypeptide, proteine ribosomale s19e 13, et polynucleotide codant ce polypeptide WO2001092516A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU89484/01A AU8948401A (en) 2000-05-24 2001-05-21 A novel polypeptide, a ribosome s19e protein 13 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00115829 CN1324813A (zh) 2000-05-24 2000-05-24 一种新的多肽——核糖体s19e蛋白13和编码这种多肽的多核苷酸
CN00115829.5 2000-05-24

Publications (1)

Publication Number Publication Date
WO2001092516A1 true WO2001092516A1 (fr) 2001-12-06

Family

ID=4585271

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000830 WO2001092516A1 (fr) 2000-05-24 2001-05-21 Nouveau polypeptide, proteine ribosomale s19e 13, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1324813A (fr)
AU (1) AU8948401A (fr)
WO (1) WO2001092516A1 (fr)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 21 December 1999 (1999-12-21), Database accession no. AC004858 *
DATABASE GENBANK [online] 23 December 1998 (1998-12-23), Database accession no. AF109907.1 *
DATABASE GENBANK [online] 30 May 2000 (2000-05-30), Database accession no. AP001745 *
DATABASE GENBANK [online] 9 March 2000 (2000-03-09), Database accession no. AC012153 *

Also Published As

Publication number Publication date
CN1324813A (zh) 2001-12-05
AU8948401A (en) 2001-12-11

Similar Documents

Publication Publication Date Title
WO2001074879A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s3-12, et polynucleotide codant pour ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001066730A1 (fr) Nouveau polypeptide, proteine humaine rs3 12, et polynucleotide codant pour ce polypeptide
WO2001092516A1 (fr) Nouveau polypeptide, proteine ribosomale s19e 13, et polynucleotide codant ce polypeptide
WO2001092518A1 (fr) Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2002000823A2 (fr) Nouveau polypeptide, proteine d'activation enzymatique ras gtp 9.57, et polynucleotide codant ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001087949A1 (fr) Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide
WO2002006470A1 (fr) Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001092315A1 (fr) Nouveau polypeptide, proteine humaine d'epissage 10.56, et polynucleotide codant ce polypeptide
WO2002012297A1 (fr) Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001092517A1 (fr) Nouveau polypeptide, proteine humaine 29.15 du gene transducteur-2-beta, et polynucleotide codant ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001094532A2 (fr) Nouveau polypeptide, proteine ribosomale l39 9, et polynucleotide codant ce polypeptide
WO2001090172A1 (fr) Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide
WO2001087968A1 (fr) Proteine s4-36 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001092324A1 (fr) Nouveau polypeptide, nucleoproteine humaine 10.78 basophile, et polynucleotide codant ce polypeptide
WO2001090379A1 (fr) Nouveau polypeptide, nucleoproteine basophile humaine 22.55, et polynucleotide codant ce polypeptide
WO2001087966A1 (fr) Nouveau polypeptide, proteine pax humaine 22, et polynucleotide codant pour ce polypeptide
WO2001094534A2 (fr) Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP