WO2002000823A2 - Nouveau polypeptide, proteine d'activation enzymatique ras gtp 9.57, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine d'activation enzymatique ras gtp 9.57, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002000823A2
WO2002000823A2 PCT/CN2001/000932 CN0100932W WO0200823A2 WO 2002000823 A2 WO2002000823 A2 WO 2002000823A2 CN 0100932 W CN0100932 W CN 0100932W WO 0200823 A2 WO0200823 A2 WO 0200823A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
activating protein
gtpase activating
ras gtpase
Prior art date
Application number
PCT/CN2001/000932
Other languages
English (en)
Chinese (zh)
Other versions
WO2002000823A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU89527/01A priority Critical patent/AU8952701A/en
Publication of WO2002000823A2 publication Critical patent/WO2002000823A2/fr
Publication of WO2002000823A3 publication Critical patent/WO2002000823A3/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/82Translation products from oncogenes

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, Ras GTPase activating protein 9.57, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • the Ras gene is one of these subgroups and includes at least three members, N-ras, H-ras, and K-ras2.
  • the mutated form of Ras is called a tumor suppressor gene, and it is considered a pathogen of cancer.
  • Ras' normal cell genes and tumor suppressor genes encode chemically related proteins, collectively referred to as the ras p21 protein. Both the normal ras p21 and tumor suppressor gene ras p21 proteins bind to nucleotides, GTP and GDP, and slowly hydrolyze GTP to QDP.
  • GTPase activating protein This intrinsic GTPase activity is stimulated by the cytokine GAP, which is called GTPase activating protein, but it has no effect on GTPase activity related to tumor suppressor mutations.
  • GAP is a cytoplasmic protein that can be transferred from the cytoplasm to the plasma membrane to interact with p21. Because it is a GTP-binding form of active ras, these proteins are called negative regulators of ras.
  • the members of the GAP family are all large molecular weight proteins (from 765 to 3079 residues), but the same conserved sequence is a limited region (about 250 residues), which is called the "catalytic domain” Or rasGAP domain.
  • the most conserved region in this region is a 15-residue motif, which is a characteristic sequence of the protein family:
  • Ras tumor suppressor genes are related to the growth of various tumors and involve 10-40% of the most common human cancers, such as bladder cancer, colon cancer, kidney cancer, liver cancer, lung cancer, nest cancer, pancreatic cancer, and gastric cancer. This gene is also associated with lymphoid and bone marrow hematopoietic tumors, mesenchymal origin tumors.
  • the present invention includes the peptides of the above peptides, and the antagonists, inhibitors and agonists of the polypeptides can be used to diagnose, prevent and treat cancer, especially to detect the overexpression of normal or tumor suppressor gene ras p21 and treat the disease caused by ras tumor suppressor gene. Cancer.
  • Ras GTPase activation protein 9.57 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more participation in the field. These processes Ras GTPase activates the protein 9.57 protein, specifically identifying the amino acid sequence of this protein.
  • the isolation of the new Ras GTPase activation protein 9.57 protein-encoding gene also provides the basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding Ras GTPase activating protein 9.57.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a Ras GTPase activating protein 9. 57.
  • Another object of the present invention is to provide a method for producing Ras GTPase activating protein 9. 57.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention-Ras GTPase activating protein 9. 57.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against Ras GTPase activating protein 9.57 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of Ras GTPase activating protein 9.57.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 518-781 in SEQ ID NO: 1; and (b) a sequence having positions 1-1696 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a screening simulation, activation, antagonism or inhibition of Ra s 0? Method of enzymatically activating a protein 9. 5 7 protein active compound, which comprises utilizing a polypeptide of the invention. The invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of Ras GTPase activating protein 9.57 protein, comprising detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the present invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of Ras GTPase activating protein 9.57. .
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • “Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioly active refers to a protein that has the structure, regulatory, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with Ras GTPase activating protein 9.57, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds Ras GTPase activating protein 9. 57.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of Ras GTPase activating protein 9.57 when combined with Ras GTPase activating protein 9.57.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind Ras GTPase activating protein 9. 57. ,
  • “Regulation” refers to a change in the function of Ras GTPase activating protein 9.57, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological property, function, or immunity of Ras GTPase activating protein 9.57 Change of nature.
  • Substantially pure ' refers to other proteins, lipids, carbohydrates, or other substances with which it is not naturally associated.
  • Those skilled in the art can use standard protein purification techniques to purify Ras GTPase activating protein 9.57.
  • Basic The pure Ras GTPase activating protein 9.57 can generate a single main band on a non-reducing polyacrylamide gel.
  • the purity of Ras GTPase activating protein 9. 57 can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of a polynucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Sou thern blot or Nor thern blot, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences be combined with each other as a specific or selective interaction.
  • Percent identity means the sequence is the same or similar in the comparison of two or more amino acid or nucleic acid sequences Percentage.
  • the percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.).
  • the MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0
  • the Clus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the antigenic determinant of Ras GTPase activating protein 9.57.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally) ⁇ .
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if natural Material, the original environment is the natural environment).
  • natural Material the original environment is the natural environment.
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated Ras GTPase activating protein 9. 57 refers to Ras GTPase activating protein 9. 57 which is substantially free of other proteins, lipids, carbohydrates or other substances naturally associated with it. Those skilled in the art can purify Ras GTPase activating protein 9.57 using standard protein purification techniques. Substantially pure peptides produce a single main band on a non-reducing polyacrylamide gel. The purity of Ras GTPase activating protein 9. 57 peptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide Ras GTPase activating protein 9.57, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of Ras GTPase activating protein 9.57.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the Ras GTPase activating protein 9.57 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
  • such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1696 bases in total length and its open reading frame 518-781 encodes 87 amino acids.
  • this peptide has a similar expression profile to Ras GTPase activating protein, and it can be inferred that this Ras GTPase activating protein 9. 57 has similar functions as Ras GTPase activating protein.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DM format includes cDNA, genome DM or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i col l, 42 ⁇ , etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding Ras GTPase activating protein 9.57.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the Ra s GTPase activating protein 9.57 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is the method of choice. The more commonly used method is the separation of cDM sequences.
  • the standard method for isolating the cDNA of interest is to isolate fflRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Q i agene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Mo l ecul ar
  • cDM libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DNA or DNA-RNA hybridization; (2) the presence or loss of marker gene function; (3) determination of Ras GTPase activating protein 9.57 transcript levels (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably Is at least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2,000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • Ras GTPase activating protein 9 57 gene expression protein products can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method using DNA technology to amplify DNA / RM (Saiki, et al. Sc; 1985; 230: 1350-1 354) is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a vector using the vector of the present invention or directly used Ras GTPase activating protein 9.57 coding sequence is a genetically engineered host cell, and a method for producing the polypeptide of the present invention by recombinant technology.
  • a polynucleotide sequence encoding a Ras GTPase activating protein 9.57 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, etal.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding Ras GTPase activating protein 9.57 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, e. T. A. Mol. Molecular Cloning ,, a Laboratory Manua, Col. Harbor Labora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding Ras GTPase activating protein 9.57 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, Such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS, or Bowes s melanoma cells, etc. .
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce a recombinant Ras GTPase activating protein 9. 57 (Scence, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • FIG. 1 is a comparison diagram of gene chip expression profiles of Ras GTPase activating protein 9.57 and Ras GTPase activating protein of the present invention.
  • the upper graph is a graph of the Ras GTPase activating protein 9.57, and the lower graph is the Ras GTPase activating protein. Expression spectrum chart.
  • 1-bladder mucosa 2- PMA + Ecv304 cell line, 3- LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5- Fibroblast, growth factor stimulation, 1024NT 6- scar scar fc growth factor, 1013HT, 7-scar into fc without stimulation with growth factors, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetal skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated Ras GTPase activating protein 9.57.
  • 9.57kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5 — GTATCTCAACTGCAAGAGACAGGA -3, (SEQ ID NO: 3)
  • Primer2 5'- GAGTAGCAGAAAAGTATTGATAAA -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at the lbp at the 5 ′ end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l of KC1, 10 mmol / L Tris-Cl, ( ⁇ 8.5), 1.5 ⁇ l / L MgCl 2 , 200 ⁇ mol / L in a reaction volume of 50 ⁇ 1 dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • DM sequence analysis results showed that the DM sequence of the PCR product was exactly the same as that of 1-1696bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of Ras GTPase activation protein 9.57 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (G.8 volume) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was prepared by a random primer method using a - 32PdATP.
  • the DNA probe used was the PCR amplified Ras GTPase activating protein 9.57 coding region sequence (518bp to 781bp) shown in FIG.
  • the 32P- labeled probe (about 2x l0 6 cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide - 25mM KH 2 P0 4 ( (P H7.4)-5 x SSC-5 x Denhardt's solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0, 1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant Ras GTPase activating protein 9.57
  • Primer 3 5,-CCCCATATGATGTTGTGTCCACATTATTTAGTC- 3, (Seq ID No: 5)
  • Primer4 5 '-CCCGAGCTCCTAGGTCAGGAG ATGGAGACCATC- 3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and Sacl digestion sites, respectively, followed by the coding sequences of the 5' and 3 'ends of the target gene, respectively.
  • the Ndel and Sacl restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
  • PBS- 0 72 6hOS The plasmid was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: 50 ⁇ l in total volume 1 pBS- 0 726 h0 8 plasmid 10pg, primer Pr 10pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and Sacl were used to double digest the amplified product and plasmid PET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5a by the calcium chloride method.
  • the cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation, and the layers were layered with His s. Bind Quick Cartr idge (product of Novagen) which can bind to 6 histidines (6His-Tag). 57.
  • the purified Ras GTPase activating protein 9.57 was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 9.57kDa ( Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2.
  • a peptide synthesizer (product of PE company) was used to synthesize the following Ras GTPase activating protein 9.57-specific peptides: NH2-Met-Leu-Cys-Pro-His-Tyr-Leu-Val-Phe-Phe-Phe- Phe-Ser-Phe-Glu-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred size of the probe is 18 7 50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as preliminary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The region is compared for homology. If the homology with the non-target molecule region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally
  • Probe l which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • step 14 Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DM, 106 cells per 1- 5 ⁇ extracted plus about lul.
  • steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • Two NC membranes are required for each probe, so that it can be used in subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRi s i, J. L., Lyer, V. & Brown, P. 0.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DM on the glass slides to prepare chips. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Ol igotex mRNA Midi Ki t (purchased from QiaGen).
  • Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5'-triphate coup led to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino- Propargyl-2'-deoxyuridine 5'-tr i phate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification.
  • Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5'-triphate coup led to Cy3 f l
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • the Ra s gene is an intracellular signal transducer and it is also an oncogene.
  • a variant form of Ras is called a tumor suppressor gene, and it is considered a pathogen of cancer.
  • Both Ras normal cell genes and tumor suppressor genes encode chemically related proteins, collectively referred to as ra s p21 protein.
  • Both the normal ras p21 and tumor suppressor gene ra s p21 proteins bind to nucleotides, GTP, and GDP, and slowly hydrolyze GTP to GDP.
  • This intrinsic GTPase activity is stimulated by the cytokine GAP, which is called GTPase activating protein, but it has no effect on GTPase activity related to mutations in tumor suppressor genes.
  • GAP is a cytoplasmic protein that can be transferred from the cytoplasm to the plasma membrane to interact with P21. Because it is a GTP-binding form of active ras, these proteins are called negative regulators of ras.
  • Ras tumor suppressor genes are related to the growth of various tumors and involve 10-40% of the most common human cancers, such as bladder cancer, colon cancer, kidney cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer, and gastric cancer. This gene is also associated with lymphoid and bone marrow hematopoietic tumors, mesenchymal origin tumors.
  • the present invention includes the peptides of the above peptides, and the antagonists, inhibitors and agonists of the polypeptides can be used to diagnose, prevent and treat cancer, especially to detect the overexpression of the normal or tumor suppressor gene ras p21 and treat the tumor suppressor gene by ra s Caused by cancer.
  • GTPase-activating protein-specific conserved sequences are required to form its active motif. It can be seen that abnormal expression of the specific GTPase activating protein mot if will cause abnormal function of the polypeptide containing the mot if of the present invention, thereby causing abnormal cell proliferation and causing related diseases such as various tumors and embryo development Disorders, growth disorders, etc.
  • the abnormal expression of the Ras GTPase activating protein 9.57 of the present invention will produce various diseases, especially various tumors, embryonic development disorders, and growth disorders.
  • diseases include, but are not limited to: various tissues Tumors: bladder cancer, colon cancer, kidney cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer, Gastric cancer, leukemia, lymphoma, bone cancer, osteosarcoma, myeloma, bone marrow cancer, esophageal cancer, breast cancer, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glial cells Tumor, colon cancer, melanoma, adrenal cancer, bladder cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheoma, Fibroid, fibrosarcoma
  • Embryonic disorders congenital abortion, cleft palate, limb absentness, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney disease, double ureter, crypto, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias , Hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness,
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • the abnormal expression of the Ras GTPase activating protein 9.57 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) Ras GTPase activating protein 9.57.
  • Agonists increase Ras GTPase activating protein 9.57 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing Ras GTPase activating protein 9. 57 and a labeled Ras GTPase activating protein 9. 57 can be cultured in the presence of a drug. The ability of the drug to increase or suppress this interaction is then determined.
  • Antagonists of Ras GTPase activation protein 9. 57 include screened antibodies, compounds, receptor deletions, and the like.
  • An antagonist of Ras GTPase activating protein 9.57 can bind to Ras GTPase activating protein 9.57 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function. biological functions.
  • Ras GTPase activating protein 9.57 can be added to the bioanalytical assay, and the compound can be determined by determining the effect of the compound on the interaction between Ras GTPase activating protein 9.57 and its receptor. Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to Ras GTPase activating protein 9.57 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 9.57 molecules of Ras GTPase activating protein should be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies.
  • the present invention also provides
  • These antibodies include (but are not limited to). Polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting Ras GTPase activating protein 9.57 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
  • Techniques for preparing Ras GTPase activating protein 9.57 monoclonal antibodies include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta -Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against Ras GTPase activating protein 9. 57.
  • the antibody can be used in immunohistochemistry to detect Ras GTPase activating protein 9. 57 in biopsy specimens.
  • Monoclonal antibodies that bind to Ras GTPase activator protein 9. 57 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • Ras GTPase activates protein 9.
  • High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill Ras GTPase activating protein 9. 57 positive Cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to Ras GTPase activating protein 9.57. Administration of appropriate doses of antibodies can stimulate or block the production or activity of Ras GTPase activating protein 9.57.
  • the present invention also relates to a diagnostic test method for quantitatively and locally detecting Ras GTPase activating protein 9.57 level. These tests are well known in the art and include FISH assays and radioimmunoassays. Tested during the test
  • the level of Ras GTPase activating protein 9.57 can be used to explain the importance of Ras GTPase activating protein 9.57 in various diseases and to diagnose diseases where Ras GTPase activating protein 9.57 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
  • the polynucleotide encoding Ras GTPase activating protein 9.57 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat the disease caused by non-expression or abnormal / inactive expression of Ra s GTPase activating protein 9. 57 Of abnormal cell proliferation, development, or metabolism. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutant Ras GTPase activating protein 9.57 to inhibit endogenous Ras GTPase activating protein 9.57 activity.
  • a variant Ras GTPase activating protein 9.57 may be a shortened Ras GTPase activating protein 9.57 lacking a signaling domain, although it can bind to downstream substrates, but lacks signaling activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of Ras GTPase activating protein 9.57.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding Ras GTPase activating protein 9.57 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a Ras GTPase activating protein 9.57 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding Ras GTPase activating protein 9.57 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit Ras GTPase activating protein 9.57 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding Ras GTPase activating protein 9.57 can be used for the diagnosis of diseases related to Ras GTPase activating protein 9.57.
  • the polynucleotide encoding Ras GTPase activating protein 9. 57 can be used to detect the expression of Ras GTPase activating protein 9. 57 or the abnormal expression of Ras GTPase activating protein 9. 57 in a disease state.
  • the DM sequence encoding Ras GTPase activating protein 9. 57 can be used to hybridize biopsy specimens to determine the expression of Ras GTPase activating protein 9. 57.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization.
  • a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue.
  • 57 specific primers can be used to detect the transcription product of Ras GTPase activation protein 9. 57 by in vitro amplification of RNA-polymerase chain reaction (RT-PCR).
  • Ras GTPase activating protein 9.57 gene mutations can also be used to diagnose Ras GTPase activating protein 9.57 related diseases.
  • Ras GTPase activating protein 9.57 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type Ras GTPase activating protein 9.57 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position of a human chromosome and can hybridize with it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeat polymorphisms) are available for labeling chromosomal positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells containing human genes corresponding to the primers will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found, for example, in V. ckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all of the affected individuals and the mutation is not observed in any normal individual, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be combined with Use after suitable drug carrier combination.
  • suitable drug carrier combination can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers.
  • the container contains one or more ingredients of the pharmaceutical composition of the invention.
  • the polypeptide of the present invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Ras GTPase activating protein 9. 57 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of Ras GTPase activating protein 9.57 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Oncology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine d'activation enzymatique Ras GTP 9.57, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine d'activation enzymatique Ras GTP 9.57.
PCT/CN2001/000932 2000-06-12 2001-06-11 Nouveau polypeptide, proteine d'activation enzymatique ras gtp 9.57, et polynucleotide codant ce polypeptide WO2002000823A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU89527/01A AU8952701A (en) 2000-06-12 2001-06-11 A novel polypeptide, a enzymatic activation protein ras gtp 9.57 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00116449 CN1327997A (zh) 2000-06-12 2000-06-12 一种新的多肽——Ras GTP酶激活蛋白9.57和编码这种多肽的多核苷酸
CN00116449.X 2000-06-12

Publications (2)

Publication Number Publication Date
WO2002000823A2 true WO2002000823A2 (fr) 2002-01-03
WO2002000823A3 WO2002000823A3 (fr) 2002-05-10

Family

ID=4585853

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000932 WO2002000823A2 (fr) 2000-06-12 2001-06-11 Nouveau polypeptide, proteine d'activation enzymatique ras gtp 9.57, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1327997A (fr)
AU (1) AU8952701A (fr)
WO (1) WO2002000823A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013004766A1 (fr) 2011-07-04 2013-01-10 Ferrari Giulio Antagonistes des récepteurs nk-1 pour traiter une néovascularisation cornéenne

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998037196A1 (fr) * 1997-02-25 1998-08-27 Ludwig Institute For Cancer Research Parg, proteine d'activation de gtpase exerçant une interaction avec ptpl1

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998037196A1 (fr) * 1997-02-25 1998-08-27 Ludwig Institute For Cancer Research Parg, proteine d'activation de gtpase exerçant une interaction avec ptpl1

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [Online] 22 February 2000 WATANABE, K. ET AL. Retrieved from NCBI, accession no. GI: 7020440 Database accession no. (BAA91131.1) *
DATABASE GENBANK [Online] 27 February 1999 BIRREN, B. ET AL. Retrieved from NCBI, accession no. GI: 4309945 Database accession no. (AC006251:3) *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013004766A1 (fr) 2011-07-04 2013-01-10 Ferrari Giulio Antagonistes des récepteurs nk-1 pour traiter une néovascularisation cornéenne

Also Published As

Publication number Publication date
CN1327997A (zh) 2001-12-26
AU8952701A (en) 2002-01-08
WO2002000823A3 (fr) 2002-05-10

Similar Documents

Publication Publication Date Title
WO2001072786A1 (fr) Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide
WO2002000823A2 (fr) Nouveau polypeptide, proteine d'activation enzymatique ras gtp 9.57, et polynucleotide codant ce polypeptide
WO2002014510A1 (fr) Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001066584A1 (fr) Nouveau polypeptide, proteine humaine pax 9, et polynucleotide codant pour ce polypeptide
WO2001066578A1 (fr) Nouveau polypeptide, adn polymerase 10, et polynucleotide codant pour ce polypeptide
WO2001073067A1 (fr) Nouveau polypeptide, thomboplastine humaine 12, et polynucleotide codant pour ce polypeptide
WO2002014365A1 (fr) Nouvelle proteine 12 activatrice du polypeptide-ras gtp et le polynucleotide codant pour ladite proteine
WO2001079437A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide
WO2001081386A1 (fr) Nouveau polypeptide, proteine pax humaine 12.5, et polynucleotide codant pour ce polypeptide
WO2001081399A1 (fr) Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide
WO2001092516A1 (fr) Nouveau polypeptide, proteine ribosomale s19e 13, et polynucleotide codant ce polypeptide
WO2001073072A1 (fr) Nouveau polypeptide, chaperonine humaine 18, et polynucleotide codant pour ce polypeptide
WO2001081535A2 (fr) Nouveau polypeptide, proteine pax humaine 9.9, et polynucleotide codant pour ce polypeptide
WO2001079436A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 10, et polynucleotide codant pour ce polypeptide
WO2001074891A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 17, et polynucleotide codant pour ce polypeptide
WO2001090172A1 (fr) Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide
WO2001055419A1 (fr) Nouveau polypeptide, site de liaison 27 d'arn s1, et polynucleotide codant pour ce polypeptide
WO2002020595A1 (fr) Nouveau polypeptide, proteine a doigt de zinc humaine 18.04, et polynucleotide codant ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP