WO2001079437A2 - Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001079437A2 WO2001079437A2 PCT/CN2001/000518 CN0100518W WO0179437A2 WO 2001079437 A2 WO2001079437 A2 WO 2001079437A2 CN 0100518 W CN0100518 W CN 0100518W WO 0179437 A2 WO0179437 A2 WO 0179437A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- transcription factor
- human cell
- cell differentiation
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide-human cell differentiation transcription factor 14, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Background technique
- Pax is a family of genes.
- the proteins encoded by Pax genes play the role of transcription factors during cell differentiation and embryonic development, and such genes are highly conserved in spinal thrusters and lower organisms.
- the Pax gene is characterized by a paired box domain (Paired Box domain), which encodes a protein domain to help identify specific DNA sequences.
- the paired box domain has DNA binding activity and has an alpha helix at its amino terminus, which is of great significance for its binding to DNA. (Genes Dev 1991 Apr; 5 (4): 594-604)
- the paired box domain is composed of 124 amino acid residues and is found in many proteins in many organisms, including the mammalian PAX protein family. Although the function of the paired box domain is not clear at present, most of it is located at the N-terminus of proteins such as PAX, which has extremely important regulatory significance for the normal function of PAX proteins.
- paired box domains contain a conserved region containing the following consistent sequence fragments: RP- C- x (ll)-C- V- S, which is found in PAX proteins in many different organisms Sequence fragment, this structural motif plays a very important role in the process of the protein's normal physiological function.
- RP- C- x (ll)-C- V- S which is found in PAX proteins in many different organisms Sequence fragment, this structural motif plays a very important role in the process of the protein's normal physiological function.
- PAX protein can bind to DNA, which depends on the paired box domain's DNA binding activity. Pax gene expression plays an important role in the development of organisms.
- Pax gene is also present in human tumor tissue, and experimental results in vivo and in vitro have demonstrated that Pax gene is a possible oncogene.
- PAX-3 and PAX-6 are related to the occurrence and treatment of Waardenburg's syndrome.
- the human cell differentiation transcription factor 14 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these
- a transcription factor 14 protein is identified, in particular the amino acid sequence of this protein is identified.
- Isolation of new human cell differentiation transcription factor 1 4 protein encoding genes also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human cell differentiation transcription factor 14.
- Another object of the present invention is to provide a method for producing human cell differentiation transcription factor 14.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human cell differentiation transcription factor 1 4.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the polypeptide-human cell differentiation transcription factor 14 of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormal human cell differentiation transcription factor 14.
- the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 97 to 474 in SEQ ID NO: 1; and (b) a sequence having 1 to 2777 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human cell differentiation transcription factor 14 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human cell differentiation transcription factor 14 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human cell differentiation transcription factor 14.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, which The amino acid substituted in the amino acid has a structural or chemical property similar to that of the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with human cell differentiation transcription factor 14 can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human cell differentiation transcription factor 14.
- Antagonist refers to a molecule that, when combined with human cell differentiation transcription factor 14 can block or regulate the biological or immunological activity of human cell differentiation transcription factor 14.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human cell differentiation transcription factor 14.
- Regular refers to a change in the function of human cell differentiation transcription factor 14, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immunological changes in human cell differentiation transcription factor.
- “Substantially pure '” means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human cell differentiation transcription factor 14 using standard protein purification techniques. Basically Pure human cell differentiation transcription factor 14 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human cell differentiation transcription factor 14 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and suppress Binding of a homologous sequence to a target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences.
- the percentage identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.).
- the MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244).
- the Cluster method arranges each group of sequences by checking the distance between all pairs. Clusters are then assigned in pairs or groups.
- the percent identity between two amino acid sequences such as sequence 1 and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence B
- the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Cluster method or by methods known in the art such as Jotun Hein. , (1990) Methods in emzumology 183: 625-645) 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ) 2 and? It can specifically bind to the epitope of human cell differentiation transcription factor 14.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of matter from its original environment (for example, Natural environment).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated human cell differentiation transcription factor 14 means that human cell differentiation transcription factor 14 is substantially free of other proteins, lipids, carbohydrates, or other substances naturally associated with it. Those skilled in the art can purify human cell differentiation transcription factor 14 using standard protein purification techniques. Substantially pure peptides produce a single main band on a non-reducing polyacrylamide gel. The purity of human cell differentiation transcription factor 14 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a novel polypeptide-human cell differentiation transcription factor 14, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human cell differentiation transcription factor 14.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human cell differentiation transcription factor 14 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by other groups to include a substituent; or (in) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences)
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art. Within range.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2777 bases and its open reading frame 97-474 encodes 125 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to human Pax protein 12, and it can be deduced that the human cell differentiation transcription factor 14 has a similar function to human Pax protein 12.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- "strict conditions” means: (1) Hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 ° /. SDS, 6 (TC; or (2) adding denaturing agents during hybridization, such as 50 ° /.
- hybridizable polynucleotide (V / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3 ) Hybridization occurs only when the identity between the two sequences is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide is the mature polypeptide shown in SEQ ID NO: 2 Have the same biological function and activity.
- the invention also relates to nucleic acid fragments that hybridize to the sequences described above.
- nucleic acid fragment contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human cell differentiation transcription factor 14.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- polynucleotide sequence encoding the human cell differentiation transcription factor 14 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Various methods have been developed for mRNA extraction, and kits are also commercially available (Qiagene :).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) measuring the level of human cell differentiation transcription factor 14 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human cell differentiation transcription factor 14 gene.
- ELISA enzyme-linked immunosorbent assay
- Amplification of DNA / RNA by PCR (Saiki, et al. Science 1985; 230: 1350-1354) are preferred for obtaining the genes of the invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human cell differentiation transcription factor coding sequences, and a method for producing the polypeptide of the present invention by recombinant technology.
- a polynucleotide sequence encoding human cell differentiation transcription factor 14 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will allow it to be expressed in higher eukaryotic cells The transcription was enhanced.
- Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human cell differentiation transcription factor 14 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells
- fly S2 or Sf9 animal cells
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (1 2 method used in the step are well known in the art. Alternatively, it is a MgCl 2.
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging Wait.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human cell differentiation transcription factor 14 (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art.
- FIG. 1 is a comparison diagram of gene chip expression profiles of human cell differentiation transcription factor 14 and human Pax protein 12 according to the present invention.
- the upper graph is a graph of the expression profile of human cell differentiation transcription factor 14, and the lower graph is the graph of the expression profile of human Pax protein 12.
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates unstarved L02
- 8 indicates L02 +, lhr, As 3+
- 9 indicates ECV304 PMA-
- 10 means ECV304 PMA +
- 11 means fetal liver
- 12 means normal liver
- 13 means thyroid
- 14 means skin
- 15 means fetal lung
- 16 means lung
- 17 means lung cancer
- 18 means fetal spleen
- 19 means spleen
- 20 Indicates prostate
- 21 indicates fetal heart
- 22 indicates heart
- 23 indicates muscle
- 24 indicates testis
- 25 indicates fetal thymus
- 26 indicates thymus.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human cell differentiation transcription factor 14. 14kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA forms c DNA by reverse transcription.
- the Sma rtc DN A cloning kit (purchased from C1 on te ch) was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ .
- the bacteria formed a cDNA library.
- the terminate cycle reaction sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0153h02 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction.
- PCR amplification was performed with the following primers:
- Primerl 5 a AAAACTGTGGCTGTGGCCTTTTGT— 3 '(SEQ ID NO: 3)
- Primer2 5'- GGCTGCGAGAAGACGAAGCTTAGG- 3, (SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at Ibp;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions 50 ⁇ l of KCl '10 ⁇ l / L Tris-CI, (pH8.5), 1.5mmol / L MgCl 2 , 200 ⁇ mol / L dNTP in 50 ⁇ 1 reaction volume , lOpmol primer, 1U of Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55. C 30sec; 72. C 2min.
- RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
- the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-2777bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human cell differentiation transcription factor 14 gene expression:
- RNA is extracted in one step [Anal. Biochem 1987, 162, 156-159] c
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation cx- 32 P dATP using 32 P- labeled by the random primer DNA Probe Method Needle. The DNA probe used was the PCR amplified human cell differentiation transcription factor 14 coding region sequence (97bp to 474bp) shown in FIG. 1.
- the 32P- labeled probe (approximately 2 X 10 6 cpm / m l ) and the RNA transferred to nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide -25mM KH 2 P0 4 ( P H7.4) -5 x SSC-5 x Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human cell differentiation transcription factor 14
- Primer3 5'- CCCCATATGATGCTCCAGCCACATAGAATTATT- 3, (Seq ID No: 5)
- Primer4 5, — CCCGAATTCTTAATGAGAATTTATTGAGTTCTT— 3, (Seq ID No: 6)
- the 5 'ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences of the 5' and 3 'ends of the target gene, respectively.
- the Ndel and BamHI restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
- the pBS-0153h02 plasmid containing the full-length target gene was used as a template for the PCR reaction.
- the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 contains 10 pg of pBS-0153h02 plasmid and primers! ⁇ ! ⁇ ! ⁇ And? ! ⁇ ! ! ⁇ Points are ⁇ !!!. 1.
- Advantage polymerase Mix (Clontech) 1 ⁇ 1.
- Cycle parameters 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles.
- Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligated product was transformed into E. coli DH5 ⁇ by the calcium chloride method.
- the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation, and the supernatant was collected by centrifugation.
- the purified human protein differentiation factor 14 was purified. After SDS-PAGE electrophoresis, a single band was obtained at 14 kDa ( Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2.
- the following peptides specific for human cell differentiation and transcription factor 14 were synthesized using a peptide synthesizer (product of PE): NH2-Me t-Leu-G l n-Pro-Hi s-Arg-I 1 e ⁇ I l e-Tyr-Cys-Ser-Leu-Leu-Phe-Asn- C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avramea s, etal. Immunochemi stry, 1969; 6: 43.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered: 1.
- the preferred range of probe size is 18-50 nucleotides;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (4) Nt:
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe for subsequent experiments.
- the film is washed with high-strength conditions and strength conditions, respectively.
- Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. For example, see DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And Helle, RA, Schema, M. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian, USA). The distance is 280 ⁇ ⁇ 1 . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
- Total niRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP 5-Amino-propargyl-2'-deoxyuridine 5'- tr iphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl-2'-deoxyuridine) was used.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
- Pax is a family of genes.
- the proteins encoded by Pax genes act as transcription factors during cell differentiation and embryonic development.
- the specific paired box domains on Pax genes encode a protein domain that helps identify specific DNA sequences. . Paired box domains are found in many proteins in many organisms, mainly in the PAX protein family in mammals.
- Pax gene expression plays an important role in the development of organisms. Recent studies have also shown that Pax gene is also present in human tumor tissue, and experimental results in vivo and in vitro have demonstrated that Pax gene is a possible oncogene. (Adv Clin Path 1997 Oct; 1 (4): 243-255). Studies have also shown that Pax gene expression is extremely important for regulating the early formation of organisms.
- abnormal expression of the polypeptide containing the paired box domain sequence will make the Pax protein family dysfunctional, and may cause embryonic development disorders, growth disorders, tumors, and Waardenburg's syndrome.
- human cell differentiation transcription factor 14 of the present invention will produce various diseases, especially Waardenburg's syndrome, embryonic developmental disorders, growth and development disorders, and tumors. These diseases include, but are not limited to:
- Fetal developmental disorders congenital abortion, cleft palate, facial oblique fissure, limb absentness, limb differentiation disorder, gastrointestinal atresia or stenosis, hyaline membrane disease, pulmonary insufficiency, polycystic kidney disease, ectopic kidney, double ureter, crypto, Congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract , Congenital glaucoma or cataract, congenital deafness
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon Cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, pleural mesothelioma, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
- the abnormal expression of the human cell differentiation transcription factor 14 of the present invention will also produce certain hereditary, hematological and immune system diseases.
- the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human cell differentiation transcription factor 14.
- Agonist enhances human cell differentiation and transcription factor 14 stimulates cell proliferation And other biological functions, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human cell differentiation transcription factor 14 can be cultured with labeled human cell differentiation transcription factor 14 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human cell differentiation transcription factor 14 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human cell differentiation transcription factor 14 can bind to human cell differentiation transcription factor 14 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- human cell differentiation transcription factor 14 can be added to bioanalytical assays to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human cell differentiation transcription factor 14 and its receptor .
- Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
- Polypeptide molecules capable of binding to human cell differentiation transcription factor 14 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the human cell differentiation transcription factor 14 molecule should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against human cell differentiation transcription factor 14 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human cell differentiation transcription factor 14 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait. Techniques for preparing monoclonal antibodies against human cell differentiation transcription factor 14 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV- Hybridoma technology, etc. Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against human cell differentiation transcription factor 14.
- Antibodies against human cell differentiation transcription factor 14 can be used in immunohistochemical techniques to detect human cell differentiation transcription factor 14 in biopsy specimens.
- Monoclonal antibodies that bind to human cell differentiation transcription factor 14 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis. Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, monoclonal antibodies with high affinity for human cell differentiation transcription factor 14 can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human cell differentiation transcription factor 14 positive cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to human cell differentiation and transcription factors. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human cell differentiation transcription factor 14.
- the invention also relates to a diagnostic test method for the quantitative and localized detection of human cell differentiation transcription factor 14 levels. These tests are well known in the art and include F I SH assays and radioimmunoassays.
- the level of human cell differentiation transcription factor 14 detected in the test can be used to explain the importance of human cell differentiation transcription factor 14 in various diseases and to diagnose diseases in which human cell differentiation transcription factor 14 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding human cell differentiation transcription factor 14 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human cell differentiation transcription factor 14.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human cell differentiation transcription factor 14 to inhibit endogenous human cell differentiation transcription factor 14 activity.
- a mutated human cell differentiation transcription factor 14 may be a shortened human cell differentiation transcription factor 14 lacking a signal transduction domain. Although it can bind to downstream substrates, it lacks signal transduction activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human cell differentiation transcription factor 14.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human cell differentiation transcription factor 4 into a cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding human cell differentiation transcription factor 14 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human cell differentiation transcription factor 14 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human cell differentiation transcription factor 14 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DM synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human cell differentiation transcription factor 14 can be used for the diagnosis of diseases related to human cell differentiation transcription factor 14.
- the polynucleotide encoding human cell differentiation transcription factor 14 can be used to detect the expression of human cell differentiation transcription factor 14 or the abnormal expression of human cell differentiation transcription factor 14 in a disease state.
- a DNA sequence encoding human cell differentiation transcription factor 14 can be used to hybridize biopsy specimens to determine the expression status of human cell differentiation transcription factor 14.
- Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on. These techniques and methods are all mature and open technologies, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for differential expression analysis and gene diagnosis of genes in tissues.
- Human cell differentiation transcription factor 14 specific primers can also be used to detect the transcription products of human cell differentiation transcription factor 14 by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
- RT-PCR RNA-polymerase chain reaction
- Human cell differentiation transcription factor 14 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human cell differentiation transcription factor 14 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome can be utilized Or a large number of genomic clones to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human cell differentiation transcription factor 14 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of human cell differentiation transcription factor 14 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU73776/01A AU7377601A (en) | 2000-03-29 | 2001-03-26 | A novel polypeptide, human cellular differentiation transcription factor 14 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115268 CN1315441A (zh) | 2000-03-29 | 2000-03-29 | 一种新的多肽——人细胞分化转录因子14和编码这种多肽的多核苷酸 |
CN00115268.8 | 2000-03-29 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001079437A2 true WO2001079437A2 (fr) | 2001-10-25 |
WO2001079437A3 WO2001079437A3 (fr) | 2002-02-28 |
Family
ID=4584736
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000518 WO2001079437A2 (fr) | 2000-03-29 | 2001-03-26 | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1315441A (fr) |
AU (1) | AU7377601A (fr) |
WO (1) | WO2001079437A2 (fr) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994021661A1 (fr) * | 1993-03-23 | 1994-09-29 | The Board Of Trustees Of The Leland Stanford Junior University | Regulation cellulaire a l'aide de riboregulateurs |
WO1997022697A1 (fr) * | 1995-12-20 | 1997-06-26 | Ontogeny, Inc. | PROTEINES AGISSANT SUR LA TRANSDUCTION DE SIGNAL PAR TGFβ GENES ASSOCIES ET LEURS UTILISATIONS |
-
2000
- 2000-03-29 CN CN 00115268 patent/CN1315441A/zh active Pending
-
2001
- 2001-03-26 WO PCT/CN2001/000518 patent/WO2001079437A2/fr active Application Filing
- 2001-03-26 AU AU73776/01A patent/AU7377601A/en not_active Abandoned
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994021661A1 (fr) * | 1993-03-23 | 1994-09-29 | The Board Of Trustees Of The Leland Stanford Junior University | Regulation cellulaire a l'aide de riboregulateurs |
WO1997022697A1 (fr) * | 1995-12-20 | 1997-06-26 | Ontogeny, Inc. | PROTEINES AGISSANT SUR LA TRANSDUCTION DE SIGNAL PAR TGFβ GENES ASSOCIES ET LEURS UTILISATIONS |
Also Published As
Publication number | Publication date |
---|---|
WO2001079437A3 (fr) | 2002-02-28 |
AU7377601A (en) | 2001-10-30 |
CN1315441A (zh) | 2001-10-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001072812A1 (fr) | Nouveau polypeptide, bromodomaine humain 10, et polynucleotide codant pour ce polypeptide | |
WO2001072796A1 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide | |
WO2001079432A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide | |
WO2001081594A1 (fr) | Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide | |
WO2001070965A1 (fr) | Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide | |
WO2001079437A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide | |
WO2001075101A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide | |
WO2001066584A1 (fr) | Nouveau polypeptide, proteine humaine pax 9, et polynucleotide codant pour ce polypeptide | |
WO2001087949A1 (fr) | Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001074876A1 (fr) | Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001075048A2 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide | |
WO2001079434A2 (fr) | Nouveau polypeptide, signal peptidase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001079436A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 10, et polynucleotide codant pour ce polypeptide | |
WO2001081535A2 (fr) | Nouveau polypeptide, proteine pax humaine 9.9, et polynucleotide codant pour ce polypeptide | |
WO2001074893A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 11.8, et polynucleotide codant pour ce polypeptide | |
WO2001081399A1 (fr) | Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001072809A1 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 9, et polynucleotide codant pour ce polypeptide | |
WO2001081386A1 (fr) | Nouveau polypeptide, proteine pax humaine 12.5, et polynucleotide codant pour ce polypeptide | |
WO2001077163A1 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 16, et polynucleotide codant pour ce polypeptide | |
WO2001074891A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 17, et polynucleotide codant pour ce polypeptide | |
WO2001070803A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 9.7, et polynucleotide codant pour ce polypeptide | |
WO2001087966A1 (fr) | Nouveau polypeptide, proteine pax humaine 22, et polynucleotide codant pour ce polypeptide | |
WO2001074895A1 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 12.1, et polynucleotide codant pour ce polypeptide | |
WO2001072806A1 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 8, et polynucleotide codant pour ce polypeptide | |
WO2001081398A1 (fr) | Nouveau polypeptide, proteine pax humaine 16, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |