WO2001066578A1 - Nouveau polypeptide, adn polymerase 10, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, adn polymerase 10, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001066578A1
WO2001066578A1 PCT/CN2001/000245 CN0100245W WO0166578A1 WO 2001066578 A1 WO2001066578 A1 WO 2001066578A1 CN 0100245 W CN0100245 W CN 0100245W WO 0166578 A1 WO0166578 A1 WO 0166578A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
dna polymerase
dna
sequence
Prior art date
Application number
PCT/CN2001/000245
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU42252/01A priority Critical patent/AU4225201A/en
Publication of WO2001066578A1 publication Critical patent/WO2001066578A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, DNA polymerase 10, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
  • DNA polymerase can synthesize DNA-strands from four precursor nucleotides according to the rule of base pairing. They all require a single strand of DNA as a template and RNA or protein as a primer. DNA polymerase can only use four kinds of nucleotides 5, -triphosphate as precursors.
  • the general reaction formula is: Po ly (nucleotide) n -3, -0H + DNTP——> Po ly (nucleotide) n + 1 -3'-OH + 2P i, in addition to extending the DNA strand, this activity also has the effect of repairing DM and replacing RNA primers.
  • DNA polymerase also has 3'- 5 'exonuclease activity. This enzymatic activity is based on single-strand recognition of unpaired bases. Therefore, this enzyme activity is indispensable to ensure the correctness of its polymerization. This function is called proofreading function. This is essential for the stability and high fidelity necessary for DNA as genetic material.
  • DNA polymerase also has 5, 3 'exonuclease activity. This activity can translate the gap in the DM duplex.
  • DM polymerase Many types have been discovered. Different DNA polymerases have different functions. By comparing the protein sequences of different DNA polymerases, it was found that six regions have high homology. The first region is the most conserved and includes a tetrapeptide structure with two aspartic acid residues. The function of this region may be related to the binding of magnesium ions. This conserved sequence is: [YA]-[GLIVMSTAC] -D-T-D- [SG] ⁇ [L I VMFTC] -x- [LIVMSTAC]
  • DNA polymerase 10 protein is important in regulating cell division and embryonic development. Function plays an important role, and it is believed that a large number of proteins are involved in these regulatory processes, so the art has always needed to identify more DNA polymerase 10 proteins involved in these processes, especially the amino acid sequence of this protein.
  • the isolation of the new DM polymerase 10 protein-encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding D. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a DNA polymerase 10.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a DM polymerase 10.
  • Another object of the present invention is to provide a method for producing DNA polymerase 10.
  • Another object of the present invention is to provide antibodies against the polypeptide "DNA polymerase 10" of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, Agonists, inhibitors.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with a DNA polymerase 10 abnormality.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 682-945 in SEQ ID NO: 1; and (b) a sequence having 1-651 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the D polymerase 10 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of a DNA polymerase 10 protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample The amount or biological activity of a polypeptide of the invention.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of DNA polymerase 10.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of DM polymerase 10 and DM polymerase 17 of the present invention.
  • the upper graph is a graph of the DNA polymerase 10 expression profile
  • the lower graph is the DNA polymerase 17 expression profile.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated DNA polymerase 10.
  • OkDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule
  • polypeptide or “protein” is not meant to limit the amino acid sequence to the complete natural amino acid associated with the protein molecule.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with DNA polymerase 10, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind a DNA polymerase 10.
  • Antagonist refers to a molecule that, when combined with DM polymerase 10, can block or regulate the biological or immunological activity of DNA polymerase 10.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind DM polymerase 10.
  • Regular refers to a change in the function of DM polymerase 10, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of D polymerase 10.
  • Substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify DNA polymerase 10 using standard protein purification techniques. Substantially pure DNA polymerase 10 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the DNA polymerase 10 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to polynucleotides that naturally bind through base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence CGA
  • G-ACT complementary sequence
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • Homology refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid.
  • the inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P.M. Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art, such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ,) 2 and? It can specifically bind to the epitope of DNA polymerase 10.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated DM polymerase 10 means that DNA polymerase 10 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify DNA polymerase 10 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on non-reducing polyacrylamide gels. The purity of the DNA polymerase 10 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide DNA polymerase 10, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide.
  • Recombinant polypeptides Polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (such as bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technology. According to For the host used in the recombinant production scheme, the polypeptide of the present invention may be glycosylated or may be non-glycosylated.
  • the polypeptide of the present invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of DNA polymerase 10.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the DNA polymerase 10 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
  • such fragments, and their derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of an amino acid encoding SEQ ID NO: 2 Polynucleotide composition of a polypeptide of the amino acid sequence.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 651 bases in length and its open reading frames 120-416 encode 98 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to DNA polymerase 17, and it can be deduced that the DNA polymerase 10 has a similar function to DNA polymerase 17.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 'C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, preferably at least 100 nucleotides.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding DNA polymerase 10.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding D polymerase 10 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of DNA polymerase 10 transcripts; (4) passing Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the DNA polymerase 10 gene.
  • a method of amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end amplification method
  • the primers can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a DNA polymerase 10 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
  • the polynucleotide sequence encoding the DNA polymerase 10 may be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding DM polymerase 10 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, and polyomas on the late side of the origin of replication Enhancers and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a DNA polymerase 10 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells, etc. .
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant DNA polymerase 10 by conventional recombinant DNA technology (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic bacteria, Ultrasonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • DNA polymerase plays a key role in the precise semi-reserved replication of DNA.
  • DNA polymerase can synthesize DNA strands based on the base pairing rules of four precursor nucleotides.
  • DNA polymerase also has 3, -5, exonuclease activity. This enzymatic activity is based on single-strand recognition of unpaired bases. Therefore, this enzyme activity is indispensable to ensure the correctness of its polymerization. This function is called proofreading function. This is essential for the stability and high fidelity necessary for DNA as genetic material.
  • DNA polymerase has 5'-3 'exonuclease activity. This activity translates the gap in the DNA double-strand. Therefore, abnormal expression of a polypeptide containing a DNA polymerase-specific sequence will cause errors in DM replication, resulting in deletions, translocations, duplications, inversions, etc. of DM, further leading to related diseases such as chromosomal disease, single gene genetic disease, various Tumors, embryonic disorders, etc.
  • D polymerase 10 of the present invention will produce various diseases, especially chromosomal disease, single-gene genetic disease, various tumors, and embryonic developmental disorders. These diseases include, but are not limited to:
  • Chromosome diseases K inefe ter syndrome, XYY syndrome, XX male syndrome, XXX female syndrome, Turner syndrome, 21-trisomy syndrome, meow syndrome, 1 3-trisomy syndrome, 18 -Trisomy Syndrome, Fragile X Syndrome, Chromosome Fracture Syndrome, and other disorders of chromosome structure and number
  • Single gene hereditary diseases autosomal dominant hereditary diseases such as Marfan syndrome, Ehler s-Danl os syndrome, congenital cartilage hypoplasia, polycystic kidney disease, tuberous sclerosis, Hunting ton chorea, familial hypercholesterolemia Disease, neurofibromatosis, intestinal polyposis, retinoblastoma; autosomal recessive diseases: lysosomal storage diseases such as glycogen storage disease, lipid storage disease, mucopolysaccharidosis, synthetase Defects such as hemoglobin deficiency, albinism, phenylketonuria, hepatolenticular degeneration, galactosemia; sexually linked genetic diseases: hemophilia A, pseudohypertrophic muscular dystrophy, red-green blindness
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymus Swollen Tumor, Nasal and Sinus Tumors, Nasopharyngeal Carcinoma, Laryngeal Carcinoma, Tracheal Tumor, Pleural Mesothelioma, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma
  • Embryonic developmental disorders congenital abortion, cleft palate, facial oblique fissure, limb absentness, limb differentiation disorder, gastrointestinal atresia or stenosis, hyaline membrane disease, atelectasis, polycystic kidney disease, ectopic kidney, double ureter, cryptorchidism , Congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital Cataract, congenital glaucoma or cataract, congenital deafness, auricle deformity
  • the abnormal expression of the DNA polymerase 10 of the present invention will also cause certain blood diseases and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) DNA polymerase 10.
  • Agonists increase DNA polymerase 10 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing DNA polymerase 10 can be cultured together with labeled DNA polymerase 10 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • D polymerase 10 antagonists include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of DM polymerase 10 can bind to DNA polymerase 10 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • DNA polymerase 10 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between D polymerase 10 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to DNA polymerase 10 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, DNA polymerase 10 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the DNA polymerase 10 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting DNA polymerase 10 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. .
  • Techniques for preparing monoclonal antibodies to DNA polymerase 10 include, but are not limited to, hybridoma technology (Koh l er and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against DNA polymerase 10.
  • Antibodies to DNA polymerase 10 can be used in immunohistochemistry to detect DNA polymerase 10 in biopsy specimens.
  • Monoclonal antibodies that bind to DM polymerase 10 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • DNA polymerase 10 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill DNA polymerase 10 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to DNA polymerase 10. Administration of an appropriate amount of antibody can stimulate or block the production or activity of DNA polymerase 10.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of DNA polymerase 10 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of DM polymerase 10 detected in the test can be used to explain the importance of DNA polymerase 10 in various diseases and to diagnose diseases in which DNA polymerase 10 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, more preferably mass spectrometry analysis.
  • the polynucleotide encoding DNA polymerase 10 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of DNA polymerase 10.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated DNA polymerase 10 to inhibit endogenous DNA polymerase 10 activity.
  • a mutated DM polymerase 10 may be a shortened DNA polymerase 10 lacking a signal transduction domain. Although it can bind to a downstream substrate, it lacks signal transduction activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of DNA polymerase 10.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding DNA polymerase 10 into a cell.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a DNA polymerase 10 can be found in the literature (Sambrook, et al.).
  • recombinantly encoded DNA aggregates The polynucleotide of enzyme 10 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit D polymerase 10 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific R. The mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding DNA polymerase 10 can be used for the diagnosis of diseases related to DM polymerase 10.
  • the polynucleotide encoding DNA polymerase 10 can be used to detect the expression of DNA polymerase 10 or the abnormal expression of DNA polymerase 10 in a disease state.
  • a DNA sequence encoding DNA polymerase 10 can be used to hybridize biopsy specimens to determine the expression of DNA polymerase 10.
  • Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a micro array (Mi croar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues .
  • DNA polymerase 10 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect DNA polymerase 10 transcripts.
  • DNA polymerase 10 gene can also be used to diagnose DNA polymerase 10-related diseases.
  • the forms of DNA polymerase 10 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type DNA polymerase 10 DNA sequences. Mutations can be detected using existing techniques such as Sou thern imprinting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on the cDNA, which can be used to position the sequence for staining. Physically. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct a chromosome-specific c-leg bank.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by topical, intravenous, intraperitoneal, intramuscular, Subcutaneous, intranasal or intradermal route of administration.
  • DNA polymerase 10 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dosage range of DNA polymerase 10 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA was reverse transcribed to form cDNA. Use Smart cDM Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multiple cloning site of pBSK (+) vector (Clontech), and transformed into DH5a. The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0219g02 was a new D.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imerl 5,-CTCAAAAAAAAGAAAAATAGCTAA -3, (SEQ ID NO: 3) Pr imer2: 5,-ATCACTGGTTTATTCCGTTTCATC -3, (SEQ ID NO: 4) Primerl is located at the 5th end of SEQ ID NO: 1, starting with the lbp Forward sequence
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50ramo l / LC 1, 10mmo l / L in 50 ⁇ 1 reaction volume Tris-HCl, pH 8.5, 1.5ramol / L MgCl 2 , 200 mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-651bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of DNA polymerase 10 gene expression
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] ⁇ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added. ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained R precipitate was washed with 70% ethanol, dried and dissolved in water.
  • the 32P- labeled probe (about 2x l0 6 cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide -25mM KH 2 P0 4 ( pH7.4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 20 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 Q C for 30 min. Then, Phosphor Imager for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant DNA polymerase 10
  • Primer3 5,-CCCCATATGATGTCAGCGTTCCTCCAAGGAGTG- 3, (Seq ID No: 5)
  • Primer 4 5,-CCCGAATTCTTAATACCTGCCTGGATGCTGCCA- 3, (Seq ID No: 6)
  • the two ends of these two primers contain Ndel and EcoRI restriction sites, respectively.
  • the coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and EcoRI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the PCR reaction was performed using the pBS-0219g02 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 contains 10 pg of pBS-0219g02 plasmid, primers? 1 ⁇ : ⁇ 1-3 and? 1 ⁇ [116]: -4 are 10 11101, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60. C 30s, 68 ° C 2 min, 25 cycles in total. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E. coli DH5a using the calcium chloride method.
  • a peptide synthesizer (product of PE company) was used to synthesize the following DNA polymerase 10-specific peptides:
  • NH2-Met-Ser-Ala-Phe-Leu-Gln-Gly-Val-Ala-Leu-Gly-Gln-Glu-Asp-Arg-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For the method, see: Avraraeas, et al. Immmochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex and complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex and incomplete Freund's adjuvant were used to boost the immunity once.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 ′ of the present invention as a hybridization probe, and to use a membrane hybridization method to identify whether some tissues contain the multicore of the present invention.
  • Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt): 5'- TGTCAGCGTTCCTCCAAGGACTGGCTTTGGGTCAAGAAGAC -3 '(SEQ ID NO: 9)
  • SEQ ID NO: 9 For other common reagents not listed below and their preparation methods, please refer to the reference: DNA PROBES GH Keller; MM Manak; Stockton Press, 1989 (USA (USA) ) And more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide” (Second Edition 1998) [US] Sambrook et al., Science Press.
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • step ⁇ the film was washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag, and 3-lOmg prehybridization solution (10xDenhardt's; 6xSSC, 0. lrag / ml was added).
  • CT DNA calf thymus DNA
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Sc ience 278, 680-686. And documents Helle, RA, Schema, M., Cha i, A., Sha lom, D., (1997) PNAS 94: 2150-2155
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification.
  • the spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ .
  • the spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed on the glass slides to prepare chips.
  • the specific method steps have been reported in the literature.
  • the sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Ol igotex mRNA Midi Ki t (purchased from QiaGen), and another 1 J was separated by reverse transcription.
  • the fluorescent reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5--tr iphate coupled to Cy3 f luorescent dye, purchased from Araersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino — Propargy l-2'-deoxyur idine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • Cy3dUTP 5-Amino-propargyl-2'-deoxyur idine 5--tr iphate coupled to Cy3 f luorescent dye, purchased from Araersham Phamacia Biotech
  • the probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and a washing solution (1 ⁇ SSC, 0.2% SDS) was used at room temperature. After washing, use a ScanArray 3000 scanner (purchased from Genera Scanning, USA). Scanning), the scanned images were processed with Imagene software (Biodiscovery, USA) for data analysis, and the Cy3 / Cy5 ratio of each point was calculated.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these 13 Cy3 / Cy5 ratios, draw a bar graph ( Figure 1). It can be seen from the figure that the expression profiles of DNA polymerase 10 and DNA polymerase 17 according to the present invention are very similar.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne un nouveau type de polypeptide, une ADN polymérase 10, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des cancers, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour l'ADN polymérase 10.
PCT/CN2001/000245 2000-03-10 2001-02-26 Nouveau polypeptide, adn polymerase 10, et polynucleotide codant pour ce polypeptide WO2001066578A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU42252/01A AU4225201A (en) 2000-03-10 2001-02-26 A novel polypeptide-dna polymerase 10 and polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00111964 CN1313394A (zh) 2000-03-10 2000-03-10 一种新的多肽——dna聚合酶10和编码这种多肽的多核苷酸
CN00111964.8 2000-03-10

Publications (1)

Publication Number Publication Date
WO2001066578A1 true WO2001066578A1 (fr) 2001-09-13

Family

ID=4581860

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000245 WO2001066578A1 (fr) 2000-03-10 2001-02-26 Nouveau polypeptide, adn polymerase 10, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1313394A (fr)
AU (1) AU4225201A (fr)
WO (1) WO2001066578A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023031247A1 (fr) * 2021-09-01 2023-03-09 Ludwig-Maximilians-Universität München Adn polymérase activable

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1031251A (zh) * 1987-01-14 1989-02-22 哈佛大学校长及研究员协会 T7脱氧核糖酸聚合酶
JPH0975080A (ja) * 1995-09-14 1997-03-25 Yasukazu Tanuma 新規ｄｎａポリメラーゼ
CN1209170A (zh) * 1995-12-27 1999-02-24 宝酒造株式会社 新型dna聚合酶

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1031251A (zh) * 1987-01-14 1989-02-22 哈佛大学校长及研究员协会 T7脱氧核糖酸聚合酶
JPH0975080A (ja) * 1995-09-14 1997-03-25 Yasukazu Tanuma 新規ｄｎａポリメラーゼ
CN1209170A (zh) * 1995-12-27 1999-02-24 宝酒造株式会社 新型dna聚合酶

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023031247A1 (fr) * 2021-09-01 2023-03-09 Ludwig-Maximilians-Universität München Adn polymérase activable

Also Published As

Publication number Publication date
AU4225201A (en) 2001-09-17
CN1313394A (zh) 2001-09-19

Similar Documents

Publication Publication Date Title
WO2001072786A1 (fr) Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide
WO2001066578A1 (fr) Nouveau polypeptide, adn polymerase 10, et polynucleotide codant pour ce polypeptide
WO2001046244A1 (fr) Nouveau polypeptide, adn polymerase 17, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001070956A1 (fr) Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001055414A1 (fr) Nouveau polypeptide, proteine rgs 17, et polynucleotide codant pour ce polypeptide
WO2002000823A2 (fr) Nouveau polypeptide, proteine d'activation enzymatique ras gtp 9.57, et polynucleotide codant ce polypeptide
WO2001092541A1 (fr) Nouveau polypeptide, catalase 12, et polynucleotide codant ce polypeptide
WO2001094402A1 (fr) Nouveau polypeptide, proteine npat humaine 12, et polynucleotide codant pour ce polypeptide
WO2002020590A1 (fr) Nouveau polypeptide, sucre phosphotransferase phosphoenolpyruvate-dependante 33, et polynucleotide codant ce polypeptide
WO2001087963A1 (fr) Proteine s18-12 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001075027A2 (fr) Nouveau polypeptide, helicase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001066585A1 (fr) Nouveau polypeptide, proteine humaine 10 regulant la protease, et polynucleotide codant pour ce polypeptide
WO2001083778A1 (fr) Nouveau polypeptide, proteine pax humaine 10.3, et polynucleotide codant pour ce polypeptide
WO2001070795A1 (fr) Nouveau polypeptide, glycinamide ribonucleotide synthetase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001088147A1 (fr) Polypeptide de tyrosine kinase 14 humaine et polynucleotide le codant
WO2001055419A1 (fr) Nouveau polypeptide, site de liaison 27 d'arn s1, et polynucleotide codant pour ce polypeptide
WO2001083683A2 (fr) Nouveau polypeptide, proteine pax humaine 11.3, et polynucleotide codant pour ce polypeptide
WO2002012492A1 (fr) Nouveau polypeptide, proteine npat humaine 11, et polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001047969A1 (fr) Nouveau polypeptide, proteine de translocation nucleaire i10, et polynucleotide codant pour ce polypeptide
WO2001073041A1 (fr) Nouveau polypeptide, adn ligase humaine 15, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP