WO2001055414A1 - Nouveau polypeptide, proteine rgs 17, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, proteine rgs 17, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001055414A1 WO2001055414A1 PCT/CN2001/000032 CN0100032W WO0155414A1 WO 2001055414 A1 WO2001055414 A1 WO 2001055414A1 CN 0100032 W CN0100032 W CN 0100032W WO 0155414 A1 WO0155414 A1 WO 0155414A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- rgs protein
- protein
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, RGS protein 17, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. Background technique
- the RGS protein is a GTPase agonist of the heterotrimeric G protein.
- G protein is activated by receptor proteins of seven transmembrane helix families. By covalent binding, the receptor protein catalyzes the G protein ⁇ subunit to form a complex with GTP, which in turn regulates intracellular receptor proteins. active.
- the life cycle of the complex and the concentration and duration of the signal generated by the receptor are determined by the degree of hydrolysis of GTP, which is determined by the relatively weak catalytic activity of the G protein ⁇ subunit.
- the G protein ex subunit catalyzes the hydrolysis rate of GTP usually at 2-5 / min.
- RGS protein and the RAS protein are not the same in the primary structure. All RGS protein families have a conserved domain composed of about 130 residues. This conserved structure is of different lengths. The connection is interrupted. Biochemical studies of RGS4, GAIP, RGS1, RGS 10, and RGS-r have proven that all RGS proteins have the same mechanism of action. RGS proteins have almost no affinity for the G a -GTP complex, and have almost no direct impact on the hydrolysis rate of GTP. . The RGS protein mainly binds to the cc subunit of the G protein to activate the G protein activity, thereby increasing the GTP hydrolysis rate.
- the conserved domain of the RGS protein (residue 58 to 178 in RGS4) forms a structure called a box, with non-conserved sequences on each side of the box. These Non-conserved sequences do not have a significant effect on binding to the G protein a subunit or fixing the RGS box compartment, and this RGS box compartment, as a water-soluble protein, still maintains intact GTPase activity in vitro.
- the box-shaped chamber has 9 a-helixes, which make up two subdomains.
- the terminal subdomain includes the N-terminus and C-terminal of the box-shaped chamber, and consists of al, cc 2, a3, a8, and a9, where cc l and a 9 are arranged in anti-parallel direction, so that the N-terminus and C-terminus of the box-shaped chamber are juxtaposed; the other subdomain consists of four spirals a 4, a 5, a 6 and a 7 to form a classic right-handed anti-parallel bundle ⁇ ⁇ Like structure. Both subdomains are required for GAP activity.
- the RGS protein 17 protein plays an important role in important functions in the body, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there has been a need in the art to identify more RGS protein 17 proteins involved in these processes, especially to identify The amino acid sequence of this protein.
- the isolation of the new RGS protein 17 protein encoding gene also provides a basis for research to determine the role of the protein in health and disease states. This protein May form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating their coding DNA is very important,
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a RGS protein 17. It is another object of the present invention to provide a genetically engineered host cell containing a polynucleotide encoding the RGS protein 17.
- Another object of the present invention is to provide a method for producing RGS protein 17.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-RGS protein 17.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against RGS protein 17 of the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormality of RGS protein 17.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1 76 to 634 in SEQ ID NO: 1; and (b) a sequence having 1-1 in SEQ ID NO: 1 1795-bit sequence.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the RGS protein 17 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to an in vitro detection of a disease or disease associated with abnormal expression of RGS protein 17 protein.
- a method for susceptibility comprising detecting mutations in said polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of RGS protein 17.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with RGS protein 17, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to RGS protein 17.
- An "antagonist” or “inhibitor” refers to a molecule that, when combined with RGS protein 17, can block or regulate the biological or immunological activity of RGS protein 17.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to RGS protein 17.
- Regulation refers to a change in the function of RGS protein 17, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of RGS protein 17.
- substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify RGS protein 17 using standard protein purification techniques.
- the substantially pure RGS protein 17 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of the RGS protein 17 peptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other specifically or selectively.
- Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method ( Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then allocated in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by:
- the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by a method known in the art such as Jotun He in. (He in J., (1990) Methods in emzumo ogy 183: 625-645). "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and?, which can specifically bind to the epitope of RGS protein 17.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated RGS protein 17 means that RGS protein 17 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify RGS protein 17 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the RGS protein 17 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, RGS protein 17, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be obtained from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammals using recombinant technology). Cell). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of RGS protein 17.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the RGS protein 17 of the invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
- an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptid
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1795 bases in length and its open reading frame of 176-634 encodes 152 amino acids.
- This polypeptide has the characteristic sequence of members of the RGS protein family, and it can be deduced that the RGS protein 17 has the structure and function represented by the members of the RGS protein family.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring Allelic or non-naturally occurring variants.
- These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least two sequences between
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, more preferably 97% or more hybridization occurs.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding RGS protein 17.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the RGS protein 17 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the appearance or loss of marker gene function; (3) measurement Determine the level of the transcript of RGS protein 17; (4) Detect the protein product of gene expression by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of the RGS protein 17 gene expression can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the RGS protein 17 coding sequence, and a method for producing a polypeptide according to the present invention by recombinant technology.
- the polynucleotide sequence encoding the RGS protein 17 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements. Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding RGS protein 17 and appropriate transcriptional / translational regulatory elements.
- DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
- promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding the RGS protein 17 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells
- Drosophila S2 or Sf9 animal cells
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote, such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used for expression or production Recombinant RGS protein 17 (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- Fig. 1 is a comparison diagram of the amino acid sequences of the functional domains of the RGS protein 17 and members of the RGS protein family of the present invention.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated RGS protein 17.
- 17KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- a Smart cDNA cloning kit purchased from Clontech
- Clontech was used to insert the 00 ⁇ fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5a.
- the bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0403M1 was new DNA.
- the sequence of the RGS protein 17 of the present invention and the protein sequence encoded by the RGS protein 17 were analyzed using the profile scan program (Basiclocal Alignment search tool) in GCG [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10 ], Perform domain analysis in databases such as prosite.
- the RGS protein 17 of the present invention is homologous to members of the domain RGS protein family, and the homology results are shown in FIG. 1.
- Example 3 Cloning of the gene encoding RGS protein 17 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Primerl 5'- GGTTACCACTTGGAAAACAATTCA -3 '(SEQ ID NO: 3)
- Primer2 5'- TTTGAATATGTTTAAATGTTTATT -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp at the 5 'end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions 50 mmol / L KC1, 10 mmol / L Tris-CI, (pH 8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer, 1U in a reaction volume of 50 ⁇ 1 Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
- RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. DNA sequence analysis results indicate PCR The DNA sequence of the product is exactly the same as that shown in SEQ ID NO: 1.
- Example 4 Northern blot analysis of RGS protein 17 gene expression:
- RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation 32 ⁇ - DM probe labeled with a- 32 P dATP by random priming method.
- the DNA probe used was the sequence of the RGS protein 17 coding region (176bp to 634bp) amplified by PCR as shown in FIG.
- a 32P-labeled probe (approximately 2 ⁇ 10 6 cpm / ml) and a nitrocellulose membrane to which RNA was transferred were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, place the filter at 1 x SSC-0.1 ° /. Wash in SDS for 30 min at 55 ° C. Then, Phosphor Imager was used for analysis and quantification.
- Example 5 In vitro expression, isolation and purification of recombinant RGS protein 17
- Primer3 5'- CCCCATATGATGCCAGTGAAATGCTGTTTCTAC -3 '(Seq ID No: 5)
- Primer4 5'- CATGGATCCTCACAAAAAAGGGAGCCATTTTTT -3 '(Seq ID No: 6)
- the 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively.
- the Ndel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET 28b (+) (Novagen, Cat. No. 69865.3).
- the PCR reaction was performed using the pBS-Q403M1 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0403M1 plasmid, primer Primer-3, and? 1 ⁇ 0161-4 points separately!] Is 10 11101, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into the colibacillus DH5 ⁇ by the calcium chloride method.
- a peptide synthesizer (product of PE company) was used to synthesize the following RGS protein 17-specific peptides:
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For the method, see: Avrameas, et al. I. Unochemi Stry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes, and Incubation hybridizes the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its alternate fragment (41Nt) :
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
- pre-hybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA).
- Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of large numbers of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature, for example, refer to the documents DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And the documents Helle, RA, Schema, M. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a sloped glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA) between the points. The distance is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
- Total mRNA was extracted from normal laryngeal and laryngeal carcinoma by one-step method, and the mRNA was purified by Oligotex mRNA Mid i Kit (purchased from QiaGen).
- Oligotex mRNA Mid i Kit purchased from QiaGen.
- the fluorescent reagent Cy3dUTP (5- Amino- propargyl-2) was separately reverse-transcribed.
- Solut ion (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 ⁇ SSC, 0.2% SDS) at room temperature, and then scanned with a ScanArray 3000 scanner (purchased from Genera l Scanning, USA). The scanned image was analyzed by Imagene software (Biodi scovery, USA) to calculate the Cy3 / Cy5 ratio of each point, and the points with the ratio less than 0.5 and greater than 2 were considered to be genes with different expression.
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases. Disease, etc.
- the RGS protein is a GTPase agonist of the heterotrimeric G protein.
- G protein is activated by receptor proteins of seven transmembrane helix families. By covalent binding, the receptor protein catalyzes the G protein ⁇ subunit to form a complex with GTP, which in turn regulates intracellular receptor proteins. active. The life cycle of the complex and the concentration and duration of the signal produced by the receptor are determined by the degree of hydrolysis of GTP.
- the RGS protein mainly activates G protein activity by binding to the ⁇ subunit of G protein, thereby increasing the rate of GTP hydrolysis.
- the characteristic sequences of the RGS protein family are necessary for its biological activity.
- the polypeptide of the present invention is a polypeptide containing a characteristic sequence of the RGS protein family. Abnormal expression of the polypeptide will lead to abnormal regulation of G protein activity, impede the transmission of cell signals, and cause related diseases.
- the abnormal expression of the RGS protein 17 of the present invention will produce various diseases, especially various tumors, growth and development disorders, inflammation, and immune diseases. These diseases include, but are not limited to:
- Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma, Leiomyoma
- Inflammation allergic reaction, bronchial asthma, sarcoidosis, rheumatoid arthritis, rheumatoid arthritis, osteoarthritis, dermatomyositis, urticaria, specific dermatitis, polymyositis, systemic lupus erythematosus, severe Myasthenia, Cerebral Spinal Multiple Sclerosis, Pancreatitis, Cholecystitis, Glomerulonephritis, Chronic Active Hepatitis, Myocarditis, Cardiomyopathy, Atherosclerosis, Gastric Ulcer, Prostatic Hyperplasia, Cervitis, Various Infections Sexual inflammation
- Immune diseases rheumatoid arthritis, systemic lupus erythematosus, scleroderma, myasthenia gravis, common variable immunodeficiency disease, acquired immunodeficiency syndrome, bronchial asthma, aspirin asthma, allergic rhinitis , Diffuse pulmonary interstitial fibrosis, urticaria, specific dermatitis
- Abnormal expression of the RGS protein 17 of the present invention will also cause certain hereditary, hematological diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, growth and development disorders, inflammation, immune diseases, and some Hereditary, hematological diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) RGS protein 17.
- Agonists enhance biological functions such as RGS protein 17 to stimulate cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing RGS protein 17 can be cultured together with labeled RGS protein 17 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of RGS protein 17 include antibodies, compounds, receptor deletions, and the like that have been screened.
- the antagonist of RGS protein 17 can bind to RGS protein 17 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- RGS protein 17 When screening compounds as antagonists, RGS protein 17 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between RGS protein 17 and its receptor. In the same manner as described above for screening compounds, receptor deletions and analogs that act as antagonists can be screened. Polypeptide molecules capable of binding to RGS protein 17 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the RGS protein 17 molecule should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the RGS protein 17 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting RGS protein 17 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to RGS protein 17 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-production (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (U. S. Pat No. 4946778) can also be used to produce single chain antibodies against RGS protein 17.
- Anti-RGS protein 17 antibodies can be used in immunohistochemical techniques to detect RGS protein 17 in biopsy specimens.
- Monoclonal antibodies that bind to RGS protein 17 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- Such as RGS protein 17 A neutralizing monoclonal antibody can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill RGS protein 17 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to RGS protein 17.
- Administration of an appropriate amount of antibody can stimulate or block the production or activity of RGS protein 17.
- the invention also relates to a diagnostic test method for quantitative and localized detection of RGS protein 17 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of RGS protein 17 detected in the test can be used to explain the importance of RGS protein 17 in various diseases and to diagnose diseases in which RGS protein 17 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding the RGS protein 17 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of RGS protein 17.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated RGS protein 17 to inhibit endogenous RGS protein 17 activity.
- a variant RGS protein 17 may be a shortened RGS protein 17 lacking a signal transduction domain. Although it can bind to downstream substrates, it lacks signal transduction activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of RGS protein 17.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding the RGS protein 17 into a cell.
- Methods for constructing a recombinant viral vector carrying a polynucleotide encoding the RGS protein 17 can be found in existing literature (Sambrook, et al.).
- a polynucleotide encoding the RGS protein 17 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit RGS protein 17 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA and D and ribozymes can be obtained by any existing RNA or DNA synthesis technology. For example, the technique of solid phase phosphate amide synthesis of oligonucleotides has been widely used. Antisense RNA molecule can pass the DNA encoding this RM The sequences are obtained by in vitro or in vivo transcription.
- This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding RGS protein 17 can be used for the diagnosis of diseases related to RGS protein 17.
- the polynucleotide encoding RGS protein 17 can be used to detect the expression of RGS protein 17 or the abnormal expression of RGS protein 17 in a disease state.
- the DNA sequence encoding RGS protein 17 can be used to hybridize biopsy specimens to determine the expression of RGS protein 17.
- Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on. These techniques and methods are all mature and open technologies, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DM chip (also known as a "gene chip") for differential expression analysis and gene diagnosis of genes in tissues.
- RGS protein 17 specific primers can also be used to detect RGS protein 17 transcripts by in vitro amplification of RNA-polymerase chain reaction (RT-PCR).
- Detection of mutations in the RGS protein 17 gene can also be used to diagnose RGS protein 17-related diseases.
- RGS protein ⁇ mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type RGS protein 17 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DM sequences on a chromosome.
- PCR primers (preferably 15-35 bp) are prepared based on cDNA, and the sequence can be located to stain the hybrid cells that contain human genes corresponding to the primers to produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckus i ck, Mendel ian Inher i tance in Man (available online with Johns Hopk ins University Welch Medica l Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- RGS protein 17 is administered in an amount effective to treat and / or prevent a particular indication.
- the amount and range of RGS protein 17 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2001229970A AU2001229970A1 (en) | 2000-01-26 | 2001-01-15 | Novel polypeptide---rgs protein 17 and polynucleotide encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00111515 CN1306980A (zh) | 2000-01-26 | 2000-01-26 | 一种新的多肽——rgs蛋白17和编码这种多肽的多核苷酸 |
CN00111515.4 | 2000-01-26 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001055414A1 true WO2001055414A1 (fr) | 2001-08-02 |
Family
ID=4581425
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000032 WO2001055414A1 (fr) | 2000-01-26 | 2001-01-15 | Nouveau polypeptide, proteine rgs 17, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1306980A (fr) |
AU (1) | AU2001229970A1 (fr) |
WO (1) | WO2001055414A1 (fr) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003016345A1 (fr) * | 2001-08-16 | 2003-02-27 | Bayer Healthcare Ag | Regulation du regulateur humain de la signalisation des proteines g |
-
2000
- 2000-01-26 CN CN 00111515 patent/CN1306980A/zh active Pending
-
2001
- 2001-01-15 WO PCT/CN2001/000032 patent/WO2001055414A1/fr active Application Filing
- 2001-01-15 AU AU2001229970A patent/AU2001229970A1/en not_active Abandoned
Non-Patent Citations (3)
Title |
---|
DATABASE GENBANK [online] 17 March 1999 (1999-03-17), HUNT T.W. ET AL., Database accession no. S71812 * |
DATABASE GENBANK [online] 26 January 1996 (1996-01-26), KOELLE M.R. ET AL., Database accession no. AAC50351 * |
DATABASE GENBANK [online] 7 June 1999 (1999-06-07), SCHIFF M. ET AL., Database accession no. AAD30568 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003016345A1 (fr) * | 2001-08-16 | 2003-02-27 | Bayer Healthcare Ag | Regulation du regulateur humain de la signalisation des proteines g |
Also Published As
Publication number | Publication date |
---|---|
CN1306980A (zh) | 2001-08-08 |
AU2001229970A1 (en) | 2001-08-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001064892A1 (fr) | Nouveau polypeptide, threonyl-arnt synthetase humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001055414A1 (fr) | Nouveau polypeptide, proteine rgs 17, et polynucleotide codant pour ce polypeptide | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001068684A1 (fr) | Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001068688A1 (fr) | Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide | |
WO2001075048A2 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001079432A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide | |
WO2001075023A2 (fr) | Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001081382A1 (fr) | Nouveau polypeptide, proteine hs1 humaine 16, et polynucleotide codant pour ce polypeptide | |
WO2001075101A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide | |
WO2001066578A1 (fr) | Nouveau polypeptide, adn polymerase 10, et polynucleotide codant pour ce polypeptide | |
WO2001066575A1 (fr) | Nouveau polypeptide, actine 49, et polynucleotide codant pour ce polypeptide | |
WO2001079423A2 (fr) | Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide | |
WO2001072801A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide | |
WO2002012297A1 (fr) | Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide | |
WO2001055400A1 (fr) | Nouveau polypeptide, site 90 actif de la famille rho des enzymes gtp, et polynucleotide codant pour ce polypeptide | |
WO2001055419A1 (fr) | Nouveau polypeptide, site de liaison 27 d'arn s1, et polynucleotide codant pour ce polypeptide | |
WO2001064732A1 (fr) | Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide | |
WO2001075024A2 (fr) | Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001081537A2 (fr) | Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001064893A1 (fr) | Nouveau polypeptide, transcriptase inverse humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001047993A1 (fr) | Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide | |
WO2001083683A2 (fr) | Nouveau polypeptide, proteine pax humaine 11.3, et polynucleotide codant pour ce polypeptide | |
WO2001075037A2 (fr) | Nouveau polypeptide, dihydroorotase humaine 40, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |