WO2001081382A1 - Nouveau polypeptide, proteine hs1 humaine 16, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, proteine hs1 humaine 16, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001081382A1 WO2001081382A1 PCT/CN2001/000580 CN0100580W WO0181382A1 WO 2001081382 A1 WO2001081382 A1 WO 2001081382A1 CN 0100580 W CN0100580 W CN 0100580W WO 0181382 A1 WO0181382 A1 WO 0181382A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- protein
- polynucleotide
- human
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide—human HS1 protein 16, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide. Background technique
- Hematopoiesis specific protein 1 is a hematopoietic system-specific protein, which is the main substrate of the antigen-receptor-associated PTKs process.
- the structure and functional characteristics of HS1 protein have been found. Actively participate in the signal transduction system generated from the antigen receptor, and directly regulate the transcription process of genes. In addition, it is also related to signal transduction.
- BCR B cell antigen receptor
- BCR-related tyrosine kinase Lyn and Syk synergistically phosphorylate HS1, and its Tyr-378 and Tyr-397 are very conserved residues, which are directly related to BCR-induced phosphorylation.
- Tyrosine phosphorylation of HS1 is a prerequisite for BCR-induced apoptosis and nuclear translocation of HS1.
- HS1 belongs to the cytoskeleton SH3 protein growth family. Except for alpha spectrin in this family, most proteins in this family contain a single SH3 region at the C-terminus and an F-actin at the N-terminus. Protein-binding region, HS1 is the first and only tumor suppressor with auto-carcinogenicity in some actin-binding tumor suppressor preparations, and its N-terminal actin-binding region is Vital.
- HS1 encodes a full-length protein containing 486 amino acid residues, which can suppress the tumor from malignant transformation caused by the oncogenic Ras mutation (vHa-Ras).
- some proteins similar to HS1, such as EMSl / cortactin, were found to belong to the same protein family as HS1, and also a tumor suppressor.
- HS1 protein it does not have auto-carcinogenicity.
- the human HS1 protein 16 protein plays an important role in regulating cell division and embryonic development.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a method for producing human HS 1 protein 16.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human HS1 protein 16.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human HS1 protein 16.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human HS1 protein 16.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 75-509 in SEQ ID NO: 1; and (b) a sequence having 1-671 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human HS1 protein 16 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human HS 1 protein 16 protein, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological sample The amount or biological activity of a polypeptide of the invention.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of hematological tumors, immune diseases, developmental disorders, inflammation, HIV infection or other diseases caused by abnormal expression of human HS 1 protein 16 the use of.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DM or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similar The term “immunologically active” refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human HS1 protein 16, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human HS1 protein 16.
- Antagonist refers to a molecule that, when combined with human HS 1 protein 16, can block or regulate the biological or immunological activity of human HS 1 protein 16.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human HS 1 protein 16.
- Regular refers to a change in the function of human HS 1 protein 16, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immunological changes in human HS1 protein 16.
- substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human HS1 protein 16 using standard protein purification techniques.
- the substantially pure human HS 1 protein 16 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of human HS1 protein 16 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of a completely homologous sequence to a target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences interact with each other specifically or selectively.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (La ser gene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The C l uster method arranges each group of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
- Two amino acid sequences such as sequence A and sequence B
- the percent identity is calculated by the following formula: The number of matching residues between sequence A and sequence X 100
- the percent identity between nucleic acid sequences is determined by the Cluster method or by methods known in the art such as Jotun He in (He in J., (1990) Methods in emzumo logy 183: 625-645), "similarity" It refers to the degree of the same or conservative substitution of amino acid residues at corresponding positions when the amino acid sequences are aligned.
- Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (1) ') 2 and? ⁇ It can specifically bind to the epitope of human HS 1 protein 16.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). Polynucleotides in their natural state in living cells It is not isolated and purified from polypeptides, but the same polynucleotide or polypeptide is separated and purified from other substances existing in its natural state.
- isolated human HS 1 protein 16 means that human HS 1 protein 16 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human HS 1 protein 16 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human HS1 protein 16 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide-human HS1 protein 16, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human HS 1 protein 16.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human HS1 protein 16 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (in) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
- an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence that is 671 bases in length and its open reading frame 75-5 09 encodes 144 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with human HS 1 protein, and it can be inferred that human HS1 protein 16 has similar functions to human HS1 protein.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 Identical or degenerate variants.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% ( ⁇ / ⁇ ) formamide, 0.1% calf serum / 0.1 l // F i co ll, 42 ° C, etc .; or (3) only in two Hybridization occurs only when the sequence identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biology as the mature polypeptide shown in SEQ ID NO: 2 Function and activity.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human HS 1 protein 16.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human HS 1 protein 16 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) Isolation of double-stranded DNA from genomic DNA Sequence; 2) chemically synthesize a DM sequence to obtain a double-chain DM of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- kits are also commercially available (Qiagene).
- CDNA library is constructed in a conventional method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989) 0 may be obtained commercially available cDNA library such as cDNA library from Clontech is different. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DNA-DNA or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human HS1 protein 16 transcripts; (4) passing Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human HS1 protein 16 gene expression.
- ELISA enzyme-linked immunosorbent assay
- the RACE method RACE-rapid cDNA end rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
- the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a vector using the vector of the present invention or directly used Human HS 1 protein 16 coding sequence is a genetically engineered host cell, and a method for producing the polypeptide of the present invention by recombinant technology.
- a polynucleotide sequence encoding human HS 1 protein 16 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing DM sequences encoding human HS1 protein 16 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et a l. Mo l ecu l ar C l on ing, a
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis.
- promoters are: the l ac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, HSV thymidine kinase promoter, and early and late SV40 promoters Promoters, retroviral LTRs, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses.
- the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selecting transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
- selectable marker genes to provide phenotypic traits for selecting transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human HS 1 protein 16 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- Cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
- the host is a prokaryote, such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human HS1 protein 16 by conventional recombinant DNA technology (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
- FIG. 1 is a comparison diagram of gene chip expression profiles of human HS1 protein 16 and human HS1 protein of the present invention.
- the upper graph is a graph of the expression profile of human HS1 protein 16, and the lower graph is the graph of the expression profile of human HS1 protein.
- 1 represents the fetus Kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates non-starved L02
- 8 indicates L02 +, lhr
- As 3 ⁇ , 9 indicates ECV304 PMA-, 10 ECV304 PMA +, 11 for fetal liver, 12 for normal liver, 13 for thyroid, 14 for skin, 15 for fetal lung, 16 for lung, 17 for lung cancer, 18 for fetal spleen, 19 for spleen, 20 for prostate, and 21 for Fetal heart
- 22 is the heart
- 23 is the muscle
- 24 is the testis
- 25 is the fetal thymus
- 26 is the thymus.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human HS1 protein 16 isolated.
- 16KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using the Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 ⁇ fragment was inserted into the multiple cloning site of pBSK (+) vector (C'lontech), and transformed into DH5 oc. The bacteria formed a cDNA library.
- the Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the inserted cDNA fragment contained in this clone was determined in both directions by synthesizing a series of primers.
- CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.
- PCR amplification was performed with the following primers:
- Primer 1 5,-TCGTGGTGCTGGAGTTTAAGTTGA -3, (SEQ ID NO: 3)
- Priraer2 5,-AGAGAAGGGGTCTCACTGTGTTGC -3, (SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 mmol / L KC1, 10 mmol / L in a 50 ⁇ l reaction volume
- the 32P- labeled probes (about 2 x l0 6 cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 U C in a hybridization solution, the solution comprising 50% formamide - 25mM KH 2 P0 4 (pH7.4)-5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 minutes. Then, use Phosphor Imager for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human HS1 protein 16
- Priraer3 5'- CCCCATATGATGGTTATGTTAGGGTTGTACGGT -3, (Seq ID No: 5)
- Primer4 5'- CATGGATCCCTAAACTGTGTGCTTAAGCTTCCT -3, (Seq ID No: 6)
- These two primers contain Ndel and BamHI restriction sites, respectively.
- the coding sequences of the 5 'and 3' ends of the target gene are followed respectively, and the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen Company product, Cat. No. 69865.3).
- the PCR reaction was performed using the pBS-0043h08 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions are: Total volume 50 ⁇ ⁇
- pBS- 0043h08 plasmid 10pg, primers Primer-3 and Primer-4 were 10 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively.
- Cycle parameters 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
- Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E. coli DH5 by the calcium chloride method.
- the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidines (6His-Tag).
- the purified human HS1 protein 16 was purified. After SDS-PAGE electrophoresis, a single band was obtained at 16 KDa ( Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were completely identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2.
- Example 5 Production of anti-human HS1 protein 16 antibody
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.
- a titer plate coated with 15 ⁇ g / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum.
- Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit serum.
- the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
- the immunoprecipitation method proved that the purified antibody could specifically bind to human HS1 protein 16.
- Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to Identifying whether it contains the polynucleotide sequence of the present invention and detecting a homologous polynucleotide sequence, further The probe is used to detect whether the expression of the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof in cells of normal tissues or pathological tissues is abnormal.
- the purpose of this example is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods, etc. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the probes from the hybridization are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the spot imprint method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe l which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 belongs to the second type of probe, which is equivalent to the gene fragment of SEQ ID NO: 1 or Replacement mutant sequence of its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe for subsequent experiments.
- the film is washed with high-strength conditions and strength conditions, respectively.
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
- the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (lOxDenhardfs; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA). ), After sealing the bag, shake at 68 ° C for 2 hours.
- prehybridization solution lOxDenhardfs; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA).
- Gene chip or gene micro-matrix is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments.
- the data is compared and analyzed on a carrier such as glass, silicon, and the like by fluorescence detection and computer software, so as to achieve the purpose of analyzing biological information quickly, efficiently, and with high throughput.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps are in the literature There have been many reports, for example, see the literature DeRisi, JL, Lyer, V. & Brown, P.0.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian, USA). The distance is 280 ⁇ ⁇ 1 . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
- polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HV infection and immune diseases.
- Hematopoiesis-specific protein 1 is a hematopoietic system-specific protein that is the main substrate of the antigen-receptor-associated PTKs process. HS1 protein actively participates in the signal transduction system of antigen receptor production. And directly regulate the gene's transcription process. In addition, it is also related to signaling. In the B cell antigen receptor (BCR) -mediated signaling system, tyrosine phosphorylation of HS 1 is responsible for BCR-induced apoptosis and nuclear translocation of HS 1 is B cell apoptosis. Prerequisites.
- BCR B cell antigen receptor
- HS 1 belongs to the cytoskeleton SH3 protein growth family. In some actin-bound tumor suppressors,
- HS1 is the first and only auto-carcinogenic tumor suppressor preparation, and its N-terminal actin binding region is essential for its auto-carcinogenicity.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of human blood cell-specific protein 1, both of which have similar biological functions. It is important for the immune response of the immune system and the immune monitoring of tumors in the body. It also plays a role in the activation and apoptosis of B cells. It is also a tumor suppressor with auto-carcinogenic properties. Its abnormal expression is usually closely related to the occurrence of biological disorders of the above-mentioned tissue systems, and causes related diseases.
- the abnormal expression of the human HS1 protein 16 of the present invention will produce various diseases, especially hematological tumors, immune diseases, development disorders, and inflammations, and these diseases include, but are not limited to:
- Hematological tumors acute leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, malignant lymphoma (such as lymphatic reticulum, malignant lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, etc.), malignant tissue cells
- Sick Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- Developmental disorders congenital abortion, cleft palate, lack of limbs, limb differentiation disorders, atrial septal defect, neural tube defects, congenital hydrocephalus, mental retardation, brain development disorders, skin, fat and muscular dysplasia, Bone and joint dysplasia, various metabolic defects, Cushing syndrome, sexual retardation
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
- Abnormal expression of the human HS 1 protein 16 of the present invention may also cause certain genetic diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially hematological tumors, immune diseases, development disorders, inflammation, and some hereditary Disease, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human HS 1 protein 16.
- Agonists enhance human HS 1 protein 16 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human HS 1 protein 16 can be cultured together with labeled human HS 1 protein 16 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human HS 1 protein 16 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human HS 1 protein 16 can bind to human HS 1 protein 16 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- human HS 1 protein 16 When screening compounds as antagonists, human HS 1 protein 16 can be added to bioanalytical assays to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human HS 1 protein 16 and its receptor. In the same manner as described above for screening compounds, receptor deletions and analogs that act as antagonists can be screened. Polypeptide molecules capable of binding to human HS 1 protein 16 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human HS 1 protein 16 molecules should generally be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against human HS 1 protein 16 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, Monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human HS1 protein 16 directly into immunized animals (such as rabbits, mice, rats, etc.). Various adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Techniques for preparing monoclonal antibodies to human HS1 protein 16 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV-hybridoma Technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human HS1 protein 16.
- Antibodies against human HS1 protein 16 can be used in immunohistochemistry to detect human HS1 protein 16 in biopsy specimens.
- Monoclonal antibodies that bind to human HS1 protein 16 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human HS1 protein 16 high affinity monoclonal antibody can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human HS1 protein 16-positive cells.
- the antibodies of the present invention can be used to treat or prevent human HS1 protein 16-related diseases. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human HS1 protein 16.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human HS1 protein 16 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human HS1 protein 16 detected in the test can be used to explain the importance of human HS1 protein 16 in various diseases and to diagnose diseases in which human HS1 protein 16 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
- the polynucleotide encoding human HS1 protein 16 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human HS1 protein 16.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human HS1 protein 16 to inhibit endogenous human HS1 protein 16 activity.
- a mutated human HS1 protein 16 may be a shortened human HS1 protein 16 lacking a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat human HS1 protein 16 expression. Or disease caused by abnormal activity.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human HS1 protein 16 into a cell.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human HS1 protein 16 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human HS1 protein 16 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human HS1 protein 16 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
- This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human HS1 protein 16 can be used for the diagnosis of diseases related to human HS1 protein 16.
- the polynucleotide encoding human HS1 protein 16 can be used to detect the expression of human HS1 protein 16 or the abnormal expression of human HS1 protein 16 in a disease state.
- the DNA sequence encoding human HS1 protein 16 can be used to hybridize biopsy specimens to determine the expression of human HS1 protein 16.
- Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and the relevant kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human HS1 protein 16 specific primers can also be used to detect human HS1 protein 16 transcripts by in vitro amplification of RNA-polymerase chain reaction (RT-PCR).
- Detection of mutations in the human HS1 protein 16 gene can also be used to diagnose human HS1 protein 16-related diseases.
- Human HS1 protein 16 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human HS1 protein 16 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- the specificity of each gene on the chromosome needs to be identified Site.
- an important first step is to locate these DNA sequences on a chromosome.
- the PCR primers (preferably 15-35b P ) are prepared based on the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian
- the cDNA or genomic sequence differences between the affected and the affected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- containers there can be medicines manufactured or used by or sold An indicative prompt given by a government regulatory agency for biological products that reflects the permission of the government regulatory agency that produces, uses, or sells it to be administered to the human body.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human HS 1 protein 16 is administered in an amount effective to treat and / or prevent a particular indication.
- the amount and dosage range of human HS 1 protein 16 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU68899/01A AU6889901A (en) | 2000-04-27 | 2001-04-23 | A novel polypeptide-homo hs1 protein 16 and polynucleotide encoding said polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00115496.6 | 2000-04-27 | ||
CN 00115496 CN1320641A (zh) | 2000-04-27 | 2000-04-27 | 一种新的多肽——人hs1蛋白16和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001081382A1 true WO2001081382A1 (fr) | 2001-11-01 |
Family
ID=4584942
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000580 WO2001081382A1 (fr) | 2000-04-27 | 2001-04-23 | Nouveau polypeptide, proteine hs1 humaine 16, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1320641A (fr) |
AU (1) | AU6889901A (fr) |
WO (1) | WO2001081382A1 (fr) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2637401C1 (ru) * | 2016-08-03 | 2017-12-04 | федеральное государственное бюджетное образовательное учреждение высшего образования "Тверской государственный медицинский университет" Министерства здравоохранения Российской Федерации (ФГБОУ ВО Тверской ГМУ Минздрава России) | Способ профилактики отдаленных послеоперационных осложнений у больных с дисплазией соединительной ткани |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999032631A1 (fr) * | 1997-12-23 | 1999-07-01 | Hyseq, Inc. | CHIMIOKINE OBTENUE A PARTIR D'UNE BANQUE D'ADNc DE FOIE-RATE DE FOETUS |
-
2000
- 2000-04-27 CN CN 00115496 patent/CN1320641A/zh active Pending
-
2001
- 2001-04-23 AU AU68899/01A patent/AU6889901A/en not_active Abandoned
- 2001-04-23 WO PCT/CN2001/000580 patent/WO2001081382A1/fr active Application Filing
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999032631A1 (fr) * | 1997-12-23 | 1999-07-01 | Hyseq, Inc. | CHIMIOKINE OBTENUE A PARTIR D'UNE BANQUE D'ADNc DE FOIE-RATE DE FOETUS |
Non-Patent Citations (1)
Title |
---|
DATABASE GENBANK [online] accession no. EMBL Database accession no. AE001761 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2637401C1 (ru) * | 2016-08-03 | 2017-12-04 | федеральное государственное бюджетное образовательное учреждение высшего образования "Тверской государственный медицинский университет" Министерства здравоохранения Российской Федерации (ФГБОУ ВО Тверской ГМУ Минздрава России) | Способ профилактики отдаленных послеоперационных осложнений у больных с дисплазией соединительной ткани |
Also Published As
Publication number | Publication date |
---|---|
AU6889901A (en) | 2001-11-07 |
CN1320641A (zh) | 2001-11-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001072786A1 (fr) | Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide | |
WO2001068689A1 (fr) | Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide | |
WO2001081382A1 (fr) | Nouveau polypeptide, proteine hs1 humaine 16, et polynucleotide codant pour ce polypeptide | |
WO2001088112A1 (fr) | Nouveau polypeptide, kinase d'adhesion focale humaine (fak) 13, et polynucleotide codant pour ce polypeptide | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001075023A2 (fr) | Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001055414A1 (fr) | Nouveau polypeptide, proteine rgs 17, et polynucleotide codant pour ce polypeptide | |
WO2001070796A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 78, et polynucleotide codant pour ce polypeptide | |
WO2001068873A1 (fr) | Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide | |
WO2001064721A1 (fr) | Nouveau polypeptide, adenosine triphosphatase 30, et polynucleotide codant pour ce polypeptide | |
WO2001070960A1 (fr) | Nouveau polypeptide, proteine humaine de reparation 13 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001073061A1 (fr) | Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide | |
WO2001075059A2 (fr) | Nouveau polypeptide, proteine humaine 11 de regulation de gtp, et polynucleotide codant pour ce polypeptide | |
WO2001040295A1 (fr) | Nouveau polypeptide, proteine humaine 48 a doigt de zinc, et polynucleotide codant pour ce polypeptide | |
WO2001083676A2 (fr) | Nouveau polypeptide, phosphatase humaine 10 fortement striee, et polynucleotide codant pour ce polypeptide | |
WO2002012492A1 (fr) | Nouveau polypeptide, proteine npat humaine 11, et polynucleotide codant pour ce polypeptide | |
WO2001081536A2 (fr) | Nouveau polypeptide, proteine kinase ysk1 humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001064730A1 (fr) | Nouveau polypeptide, 5-phosphatase humaine 18, et polynucleotide codant pour ce polypeptide | |
WO2001079430A2 (fr) | Nouveau polypeptide, serine protease humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001070779A1 (fr) | Nouveau polypeptide, proteine humaine 12 de type cdc4, et polynucleotide codant pour ce polypeptide | |
WO2001074995A2 (fr) | Nouveau polypeptide, protéine humaine de mutation 15 de l'ataxie telangiectasie, et de polynucléotide codant pour ce polypeptide | |
WO2001064917A1 (fr) | Nouveau polypeptide, proteine kinase humaine de transduction de signal 11, et polynucleotide codant pour ce polypeptide | |
WO2001075014A2 (fr) | Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase 35 humaine, et polynucleotide codant pour ce polypeptide | |
WO2001094402A1 (fr) | Nouveau polypeptide, proteine npat humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001055400A1 (fr) | Nouveau polypeptide, site 90 actif de la famille rho des enzymes gtp, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |