WO2001075014A2 - Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase 35 humaine, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase 35 humaine, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001075014A2
WO2001075014A2 PCT/CN2001/000328 CN0100328W WO0175014A2 WO 2001075014 A2 WO2001075014 A2 WO 2001075014A2 CN 0100328 W CN0100328 W CN 0100328W WO 0175014 A2 WO0175014 A2 WO 0175014A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
kinase
polynucleotide
ptdlns
human phosphatidylinositol
Prior art date
Application number
PCT/CN2001/000328
Other languages
English (en)
Chinese (zh)
Other versions
WO2001075014A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU50242/01A priority Critical patent/AU5024201A/en
Publication of WO2001075014A2 publication Critical patent/WO2001075014A2/fr
Publication of WO2001075014A3 publication Critical patent/WO2001075014A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, namely human phosphatidylinositol 3 (Ptdlns 3) -kinase 35, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • PI 3 -kinase Members of the phosphoinositide 3-kinase (PI 3 -kinase) family are involved in various pathways that mediate cellular physiological activities and are involved in receptor signal transduction in mammals, including growth factors, thrombin, chemokines, and cytokines after stimulation of receptor activation PI 3- kinase activity, phosphorylation of D- 3 such that lipid phosphatidylinositol (Ptdlns) (3, 4, 5) within the P-3 cell growth level.
  • PI 3-kinase is linked to a receptor with intrinsic or related tyrosine kinase activity.
  • Ptdlns phosphatidylinositol
  • PtdIns4P phosphatidylinositol
  • Ptdlns 4, 5
  • P 3 2 - a phosphorylated form.
  • Members of this family include heterodimers PI 3-kinase, ⁇ and ⁇ , which are supplemented and activated by tyrosine kinases, PI 3-kinase ⁇ , a type G protein-activated PI 3-kinase via the ⁇ 85 regulatory subunit.
  • the family is divided into two broad categories.
  • KRER located immediately after the conserved DFG template, in the catalytic domain.
  • KRER does not exist in Ptdlns 3-kinase, because this small peptide forms a substrate-binding ring and can interact with two additional phosphate groups on the inositol ring of Ptdlns (4, 5) P 2 , so it is based on Ptdlns ( 4,5)? 2 is unique to p85- pllO PI 3-kinase and PI 3-kinase ⁇ of the substrate.
  • Ptdlns 3-kinases participate in the cell signal cascade to control physiological processes such as cell cycle progression and intracellular protein sorting, and mediate growth factor and oncogene product-related cell mitosis and cell movement. It has four conserved regions: Region I is connected to the p85 conjugate and is involved in and regulates the response of subunits or related proteins. Region II binds to the substrate of phosphoinositide, and region IV is the kinase domain. This region is the core region of all members of the PI 3-stimulus family. It has a high degree of sequence homology and is the catalytic region of protein kinases. Mutation of the base will cause inactivation of Ptdlns 3-kinase.
  • Ptdlns 3-kinase exists in vivo as a cellular complex with the P150 protein, which is a membrane-associated serine / tyrosine Enzyme. This Ptdlns 3-kinase and pl50 protein complex interacts with a mannose hexaphosphate-like receptor to become part of a large sorting system that regulates protein transport from the Golgi to the lysosome.
  • the product of Ptdlns 3-kinase activity is PtdIns3P, a housekeeping protein that regulates the activity of intracellular protein transport (Stefano Volinia et al., The EMBO Journal 14 (14): 3339 (1995)).
  • Ptdlns 3-kinase plays an important role in different cellular signaling processes and can be used to treat diseases caused by abnormal signal cascades.
  • Gene chip analysis revealed that in thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv 304 cell line, non-starved L02 cell line, arsenic-stimulated for 1 hour
  • the expression profile of the polypeptide of the present invention is very similar to the expression profile of human phosphatidylinositol 3 (Ptdlns 3) -kinase, so the functions of the two may also be similar.
  • the present invention is named human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • the human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. More human phosphatidylinositol 3 (PtdIns 3) -kinase 35 proteins involved in these processes need to be identified, especially the amino acid sequence of this protein. Isolation of the novel human phosphatidylinositol 3 (PtdIns 3) -kinase 35 protein encoding gene also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Ptdlns 3 phosphatidylinositol 3
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • Another object of the present invention is to provide a method for producing human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human phosphatidylinositol 3 (Ptdlns 3)-kinase 35.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the polypeptide of the present invention-human phosphatidylinositol 3 (Ptdlns 3)-kinase 35.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 139-1095 in SEQ ID NO: 1; and (b) a sequence having 1-2215 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or disease susceptibility related to abnormal expression of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 protein, comprising detecting the polypeptide or a polynucleotide sequence encoding the same in a biological sample. Mutations, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the polypeptides and / or polynucleotides of the present invention in the preparation for the treatment of malignant tumors, hematological diseases, developmental disorders, HIV infection and immune diseases and various types of inflammation or other due to human phosphatidylinositol 3 (Ptdlns 3)-Use of a medicament for a disease caused by abnormal expression of kinase 35.
  • Ptdlns 3 human phosphatidylinositol 3
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human phosphatidylinositol 3 (kinase 3) -kinase 35, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • Antagonist refers to an organism that can block or regulate human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 when combined with human phosphatidylinositol 3 (kinase).
  • Molecularly active or immunologically active molecule can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • “Regulation” refers to changes in the function of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35, including increased or decreased protein activity, changes in binding properties, and human phosphatidylinositol 3 (kinase) 3 (kinase) Of any other biological, functional or immune properties.
  • substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human phosphatidylinositol 3 (Ptdlns 3) using standard protein purification techniques- Kinase 35.
  • Essentially pure human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of a completely homologous sequence to a target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences interact with each other specifically or selectively.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Cluster method arranges each group of sequences by checking the distance between all pairs. Into clusters. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences is calculated by the following formula: Number of residues matching between sequence A and sequence X 100 Number of residues in sequence A-number of interval residues in sequence A
  • the number of spacer residues in a sequence B can also be determined by the Cluster method or by a method known in the art such as Jotun Hein.
  • the percent identity between nucleic acid sequences (Hein J., (1990) Methods in emzumology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine And alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the epitope of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 means human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 is substantially free of other proteins, lipids, Sugars or other substances.
  • Those skilled in the art can purify human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on a non-reducing polyacrylamide gel. The purity of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human phosphatidylinositol 3 (Ptdlns 3) -kinase 35, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptide of the present invention may be glycosylated, or it may be non-glycosylated.
  • Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives, and analogs of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human phosphatidylinositol 3 (PtdIns 3) -kinase 35 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or UI) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such a Species, wherein the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide (such as Leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences)
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 2215 bases, and its open reading frame 139-1095 encodes 318 amino acids.
  • this peptide has a similar expression profile to human phosphatidylinositol 3 (Ptdlns 3) -kinase, and it can be concluded that the human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 has human phosphatidyl Inositol 3 (Ptdlns 3) -kinase functions similarly.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization L ° / ⁇ Using denaturants, such as 50% (v / v) formamide, 0.1% calf serum / 0. l ° /.
  • hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores Glycylic acid or more.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • polypeptides and polynucleotides of the invention are preferably isolated It is provided in the form and is better purified to homogeneity.
  • the specific polynucleotide sequence of the present invention encoding human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate niRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. when When combined with polymerase reaction technology, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 The level of transcripts; (4) Detecting protein products expressed by genes by immunological techniques or by measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product for detecting human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait.
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 coding sequence, and produced by recombinant technology A method of a polypeptide according to the invention.
  • a vector comprising a polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 coding sequence, and produced by recombinant technology A method of a polypeptide according to the invention.
  • Ptdlns 3 human phosphatidylinositol 3
  • a polynucleotide sequence encoding human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Suitable carriers in the present invention include, but are not limited to: in bacteria T7 promoter-based expression vectors for expression (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • RNA sequence encoding human phosphatidylinositol 3 (PtdIns 3) -kinase 35 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a polynucleotide containing the polynucleotide or the recombinant vector.
  • Genetically engineered host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli, it can absorb W 17 1
  • DM competent cells harvested after exponential growth phase with (Treatment 1 2 ⁇ , with steps well known in the art. Alternatively, it is 2. If necessary, the conversion may be performed by electroporation method MgCl
  • electroporation method MgCl When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 by conventional recombinant DNA technology (Science, 1984; 224: 1431). Generally speaking, there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human phosphatidylinositol 3 (PtdIns 3) -kinase 35 and human phosphatidylinositol 3 (PtdIns 3) -kinase according to the present invention.
  • the upper graph is a graph of the expression profile of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35
  • the lower graph is the graph of the expression profile of human phosphatidylinositol 3 (Ptdlns 3) -kinase.
  • FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of isolated human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • FIG. 35KDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using the Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragments into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ .
  • the bacteria formed a cDNA library.
  • Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0692al2 was a new DM.
  • the inserted cDNA fragment contained in this clone was determined in both directions by synthesizing a series of primers.
  • the 0692al2 clone contained a full-length cDNA of 2215bp (as shown in Seq ID NO: 1), and a 957bp open reading frame (0RF) from 139bp to 1095bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • This clone pBS-0692al2 we named this clone pBS-0692al2, and the encoded protein was named human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • Example 2 Cloning of a gene encoding human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5,-GGGTTCCGGTCCTGCCCTTCACTT -3 '(SEQ ID NO: 3)
  • Primer2 5'- TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAAGA —3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l / L C1, 10mmol / L in 50 ⁇ 1 reaction volume
  • Tris-Cl (pH 8.5), 1.5 mmol / L MgC, 200 ⁇ / L dNTP, lOpmol primer, 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector using a TA cloning kit (Invitrogen).
  • DNA sequence analysis results show The DNA sequence of the PCR product is identical to the 1-2215bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 gene expression: Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0 This method includes acidic thiocyanate Guanidine phenol-chloroform extraction.
  • the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA was precipitated at 70 ° / °. Wash with ethanol, dry and dissolve in water.
  • RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • A- "P dATP was used to prepare a labeled DNA probe by a random primer method.
  • the DNA probe used was the PCR amplified human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 coding region sequence (139bp) shown in Figure 1 To 1095bp).
  • 32P-labeled probes (approximately 2 x 10 6 cpm / nil) were hybridized with nitrocellulose membrane to which RNA was transferred in a solution at 42 ° C overnight, the solution contained 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC- 5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was placed at 1 x
  • Example 4 In vitro expression, isolation and purification of recombinant human phosphatidylinositol 3 (Ptdlns 3) -kinase 35
  • Primer3 5'- CATGCTAGCATGGCTCTCCCTATCATTGTAAAA -3 '(Seq ID No: 5)
  • the 5' ends of these two primers contain Nhel and BamHI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively.
  • Nhel and BamHI restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
  • the PBS-0692al2 plasmid was used as a template for PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0692al2 plasmid, primers Primer-3 and Pr imer-4 were 1 Opmo 1, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 "C 20s, 60" C 30s, 68 "C 2 min, a total of 25 cycles. Nhel and BaraHI were used to double-digest the amplified product and plasmid pET-28 (+) to recover large fragments, respectively. And ligated with T4 ligase. The ligated product was transformed into E.
  • coli DH5 CX by the calcium chloride method, cultured overnight on LB plates containing kanamycin (final concentration 30yg / ml), and colonies PCR method was used to screen positive clones, and Sequencing was performed. A positive clone (pET-0692al2) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using calcium chloride method.
  • the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation.
  • NH2-Met-A 1 a- Leu- Pro- 1 le-Il e- Va 1 -Lys-Trp-G 1 y- G 1 y- G 1 n- G 1 u-Tyr-Ser-COO H (SEQ ID NO: 7).
  • the peptide is coupled to hemocyanin and bovine serum albumin to form a complex.
  • Rabbits were immunized with 4 mg of the above-mentioned L-cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later the hemocyanin-polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.
  • a titer plate coated with 15 ⁇ g / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum.
  • Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit serum.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • Immunoprecipitation demonstrated that the purified antibody specifically binds to human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this example is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-fixed filter is first The hybridization buffer of the probe is pre-hybridized so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe l (p r obel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt) :
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag, and 3- 10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ral) was added.
  • CT DNA (calf thymus DNA).
  • Gene chip or gene microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRisi, J. L., Lyer, V. & Brown, P.0.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). In nature, the distance between points is 280 ⁇ !. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Draw based on these 13 Cy3 / Cy5 ratios Out of the chart. (figure 1 ) . It can be seen from the figure that the expression profiles of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 and human phosphatidylinositol 3 (Ptdlns 3) -kinase according to the present invention are very similar. Industrial applicability
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • PI 3-kinase phosphoinositide 3-kinase family participate in a variety of pathways that mediate cellular physiological activities, and participate in receptor signal transduction in mammals, including growth factors, thrombin, chemokines, and cytokines After the receptor is activated, it further causes a coupling reaction.
  • Ptdlns 3-kinase participates in the cell signal cascade to control physiological processes such as the cell cycle process and intracellular protein sorting, and mediates growth factor and oncogene product-related cell mitosis and cell movement.
  • the tPtdlns 3-kinase and pl50 protein complex interacts with a mannose hexaphosphate-like receptor to become part of a large sorting system that can regulate the transport of proteins from the Golgi to the lysosome.
  • Ptdlns 3-kinase active product PtdIns3P a housekeeping protein, regulates the activity of intracellular protein transport.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human Ptdlns 3-kinase, and both have similar biological functions. It participates in the cell signal cascade in vivo, controls the cell cycle process and intracellular protein sorting and other physiological activities, and mediates growth factor and oncogene product-related cell mitosis and cell movement. Its abnormal expression is usually related to cell division, proliferation, and cell Differentiation, embryonic development, growth and development, tumorigenesis are closely related, and related diseases occur.
  • human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 of the present invention will produce various diseases, especially various tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases. These diseases include, but are not limited to:
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma, embryonic developmental disorders Symptoms: Congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital hearing loss
  • Growth and development disorders mental retardation, brain development disorders, skin, fat and muscle dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, sexual retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, immunity Sexual diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or inhibit (antagonist) human phosphatidylinositol 3 (PtdIns 3) -kinase 35.
  • Agonists enhance human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 can be cultured in the presence of drugs with labeled human phosphatidylinositol 3 (Ptdlns 3)-kinase 35. . The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 can bind to human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 and eliminate its function, or inhibit the production of the polypeptide, or with the polypeptide The active site binding prevents the polypeptide from performing biological functions.
  • human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 can be added to a bioanalytical assay, and the compounds can be tested for human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 and its receptors.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human Ptdlns 3 -kinase 35 molecules should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides a needle Antibody to human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 epitope.
  • Ptdlns 3 human phosphatidylinositol 3
  • These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by direct injection of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including But it is not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies against human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B- Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • Antibodies against human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 can be used in immunohistochemistry to detect human phosphatidylinositol 3 (kinase) 3 (kinase) in biopsy specimens.
  • Monoclonal antibodies that bind to human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human phosphatidylinositol 3 (Ptdlns 3 )-Kinase 35 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 levels.
  • These tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 detected in the test can be used to explain the importance of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 in various diseases and to diagnose humans Diseases where Phosphatidylinositol 3 (Ptdlns 3) -kinase 35 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
  • Polynucleotides encoding human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 can also be used for a variety of therapeutic purposes of. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • Recombinant gene therapy vectors can be designed to express mutated human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 to inhibit endogenous human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 active.
  • a mutated human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 may be shortened and lack a signal transduction domain of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35. Substrate binding, but lacks signaling activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 to cells Inside.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 can be found in existing literature
  • a recombinant polynucleotide encoding human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • a polynucleotide encoding human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 can be used for the diagnosis of diseases related to human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • a polynucleotide encoding human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 can be used to detect the expression of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 or human phosphatidylinositol 3 ( Ptdlns 3)-Aberrant expression of kinase 35.
  • a DNA sequence encoding human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 can be used to hybridize biopsy specimens to determine the expression of human phosphatidylinositol 3 (Ptdlns 3) -kinase 35.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These technical methods are publicly mature technologies, Related kits are commercially available.
  • Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human Phosphatidylinositol 3 (Ptdlns 3) -kinase 35 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 transcription products .
  • Detection of mutations in the human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 gene can also be used to diagnose human phosphatidylinositol 3 (Ptdlns 3) -kinase 35-related diseases.
  • Human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 mutant forms include point mutations, translocations, deletions, recombinations, and others compared to normal wild-type human phosphatidylinositol 3 (Ptdlns 3) -kinase 35 DNA sequences Any exceptions etc. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. Further, mutations may affect protein expression, thus by Northern blotting, W es tern blot or absence of gene mutation can be determined indirectly.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian
  • Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR.
  • the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping Resolving power and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
  • the polypeptide of the present invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human phosphatidylinositol 3 (Pt d l s 3) -kinase 35 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human phosphatidylinositol 3 (P t d l s 3) -kinase 35 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une phosphatidylinositol-3 (PtdIns 3) kinase 35 humaine, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, des troubles du développement, de l'infection par VIH, des maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la phosphatidylinositol-3 (PtdIns 3) kinase 35 humaine.
PCT/CN2001/000328 2000-03-17 2001-03-16 Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase 35 humaine, et polynucleotide codant pour ce polypeptide WO2001075014A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU50242/01A AU5024201A (en) 2000-03-17 2001-03-16 A novel polypeptide, human phosphatidylinositol-3 (ptdins 3) kinase 35 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 00114973 CN1314477A (zh) 2000-03-17 2000-03-17 一种新的多肽——人磷脂酰肌醇3(PtdIns 3)－激酶35和编码这种多肽的多核苷酸

Publications (2)

Publication Number Publication Date
WO2001075014A2 true WO2001075014A2 (fr) 2001-10-11
WO2001075014A3 WO2001075014A3 (fr) 2002-01-24

Family

ID=4584444

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000328 WO2001075014A2 (fr) 2000-03-17 2001-03-16 Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase 35 humaine, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1314477A (fr)
AU (1) AU5024201A (fr)
WO (1) WO2001075014A2 (fr)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN [Online] 03 May 1997 SCHECHINGER W. AND SCHLEICHER E.D. Retrieved from NCBI, accession no. GI:2072014 Database accession no. AAB53645.1 *
DATABASE PROTEIN [Online] 10 June 1998 SCHULZ A. Retrieved from NCBI, accession no. GI:2160048 Database accession no. CAA56868.1 *

Also Published As

Publication number Publication date
CN1314477A (zh) 2001-09-26
WO2001075014A3 (fr) 2002-01-24
AU5024201A (en) 2001-10-15

Similar Documents

Publication Publication Date Title
WO2001068689A1 (fr) Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide
WO2001083688A2 (fr) Nouveau polypeptide, sous-unite humaine 13 phosphatidylinositol-4-phosphate-5-kinase ii beta, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001068688A1 (fr) Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide
WO2001075023A2 (fr) Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001075014A2 (fr) Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase 35 humaine, et polynucleotide codant pour ce polypeptide
WO2001079424A2 (fr) Nouveau polypeptide, facteur humaine de couplage d'atpase mitochondriale 6-10, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001090376A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide
WO2001074876A1 (fr) Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide
WO2001049727A1 (fr) Nouveau polypeptide, transducteur de signal 9 a effet chemotactique de bacteries, et polynucleotide codant pour ce polypeptide
WO2001081382A1 (fr) Nouveau polypeptide, proteine hs1 humaine 16, et polynucleotide codant pour ce polypeptide
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2001070960A1 (fr) Nouveau polypeptide, proteine humaine de reparation 13 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001071000A1 (fr) Nouveau polypeptide, znt-1-22, et polynucleotide codant pour ce polypeptide
WO2001079491A1 (fr) Nouveau polypeptide, canal ionique humain 12 pour le chlore, et polynucleotide codant pour ce polypeptide
WO2001081395A1 (fr) Nouveau polypeptide, adn topo-isomerase i-15, et polynucleotide codant pour ce polypeptide
WO2001074875A1 (fr) Nouveau polypeptide, tyrosine kinase humaine 17, et polynucleotide codant pour ce polypeptide
WO2001064730A1 (fr) Nouveau polypeptide, 5-phosphatase humaine 18, et polynucleotide codant pour ce polypeptide
WO2001083760A1 (fr) Nouveau polypeptide, sous-unite humaine 9 d'alpha-cetone acidohydrogenase ramifiee e1-beta, et polynucleotide codant pour ce polypeptide
WO2001081393A1 (fr) Nouveau polypeptide, proteine kinase ysk1 humaine 20, et polynucleotide codant pour ce polypeptide
WO2001081536A2 (fr) Nouveau polypeptide, proteine kinase ysk1 humaine 10, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP