WO2001079424A2 - Nouveau polypeptide, facteur humaine de couplage d'atpase mitochondriale 6-10, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, facteur humaine de couplage d'atpase mitochondriale 6-10, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001079424A2
WO2001079424A2 PCT/CN2001/000330 CN0100330W WO0179424A2 WO 2001079424 A2 WO2001079424 A2 WO 2001079424A2 CN 0100330 W CN0100330 W CN 0100330W WO 0179424 A2 WO0179424 A2 WO 0179424A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
coupling factor
human mitochondrial
mitochondrial atpase
Prior art date
Application number
PCT/CN2001/000330
Other languages
English (en)
Chinese (zh)
Other versions
WO2001079424A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU50243/01A priority Critical patent/AU5024301A/en
Publication of WO2001079424A2 publication Critical patent/WO2001079424A2/fr
Publication of WO2001079424A3 publication Critical patent/WO2001079424A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human mitochondrial ATPase coupling factor 6-10, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. Background technique
  • Mitochondria is an important and unique organelle in eukaryotic cells, and it is the "power station" in cells. Mitochondria undergo a series of energy conversions through oxidative phosphorylation to produce a large amount of ATP, providing the energy required for cells to perform various life activities. The energy released during the transfer of electrons from NADH to oxygen is a direct source of energy for ADP coupling phosphorylation to generate ATP. In mitochondria, oxidation and phosphorylation are simultaneously and closely coupled. The coupling factors are small particles located on the matrix side of the mitochondrial inner membrane. Its main function is to make electron transfer and phosphorylation work in harmony. . Mitochondrial ATPase coupling factor 6 (mitochondrial ATPase coupling factor 6) is a member of the mitochondrial ATPase complex and is a necessary component of the interaction in catalytic reactions.
  • a cDNA encoding a precursor of the coupling factor 6 protein has been isolated from human fetuses.
  • This 497 bp cDNA contains a 96 bp segment that specifically encodes the precursor protein (containing 108 amino acid residues). 32 amino acids at the front end, this peptide can function as a signal peptide; a 140 bp segment also exists at the 3'-end of the precursor protein, which is an untranslated region, and the remaining cDNA sequence encodes a mature sequence containing 76 amino acid residues Coupling factor 6 protein (Javed AA, Ogata K, Sanadi DR). The amino acid sequence of mitochondrial ATPase coupling factor 6 is very conserved in various mammals.
  • Mitochondrial ATPase coupling factor 6 is a hydrophilic protein, and its hydrophilic side exhibits very similar characteristics in different animal bodies. Ol igomycin sensitivity conferral protein, in the absence of coupling factor 6, can bind ATPase to the mitochondrial membrane, and its apparent association concentration is 10 (6) -1, and After the coupling factor 6 was combined, the association concentration of the obtained ATPase decreased by 1 to 2 orders of magnitude.
  • the oligomycin sensitivity-granting protein is sensitive to rutamycin, while the coupling factor 6-dependent membrane-bound ATPase activity is not sensitive to rutamycin. (Liang AM, Fi sher RJ).
  • the human mitochondrial ATPase coupling factor 6-10 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more participation in the field has been required
  • These processes of the human mitochondrial ATPase coupling factor 6-10 protein in particular, identify the amino acid sequence of this protein. Isolation of the new human mitochondrial ATPase coupling factor 6-10 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human mitochondrial ATPase coupling factor 6-10.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human mitochondrial ATPase coupling factor 6-10.
  • Another object of the present invention is to provide a method for producing human mitochondrial ATPase coupling factor 6-10.
  • Another object of the present invention is to provide antibodies against the human mitochondrial ATPase coupling factor 6-10 of the polypeptide of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the human mitochondrial ATPase coupling factor 6-10 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of human mitochondrial ATPase coupling factor 6-10.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • polynucleotide complementary to polynucleotide (a);
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 168-440 in SEQ ID NO: 1; and (b) a sequence having 1-2076 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human mitochondrial ATPa s e coupling factor 6-10 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human mitochondrial ATPa se coupling factor 6-10 protein in vitro, which comprises detecting a mutation in the polypeptide or a coding polynucleotide sequence thereof in a biological sample. Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the invention also relates to the polypeptides and / or polynucleotides of the invention in the preparation for the treatment of malignant tumors, blood diseases, developmental disorders, HIV infection and immune diseases and various types of inflammation or other human mitochondrial ATPa se coupling factors 6- 10 Use of a medicine for diseases caused by abnormal expression.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of Leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human mitochondrial ATPase coupling factor 6-10, causes a change in the protein to regulate the activity of the protein.
  • Agonists can include proteins, nucleic acids, carbohydrates, or any other molecule that binds human mitochondrial ATPase coupling factor 6-10.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human mitochondrial ATPase coupling factor 6-10 when combined with human mitochondrial ATPase coupling factor 6-10.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human mitochondrial ATPase coupling factor 6-10.
  • Regular refers to a change in the function of human mitochondrial ATPase coupling factor 6-10, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of human mitochondrial ATPase coupling factor 6-10 Change of nature.
  • substantially pure is meant substantially free of other proteins, lipids, carbohydrates, or other substances that would otherwise be associated with it.
  • Those skilled in the art can purify human mitochondrial ATPase coupling factors 6-10 using standard protein purification techniques.
  • the substantially pure human mitochondrial ATPase coupling factor 6-10 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of human mitochondrial ATPase coupling factor 6-10 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology” refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be achieved by hybridization under conditions of reduced stringency (Southern blotting or
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not imply strict procedures Conditions with reduced degrees allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences based on different methods such as the Cluster method (Higgins, DGPM Sharp (1988) Gene 73: 237-244). C Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. . The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence B 100
  • the number of residues in sequence A-the number of spacer residues in sequence A- sequence in the interval B residues may also be measured as jotun He in the percentage of identity between nucleic acid sequences (Hein J., (1990) methods in emzumology 183: 625-645) or by using Cluster method known in the art 0 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the epitopes of human mitochondrial ATPase coupling factor 6-10.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide exists in a living animal. It is not isolated, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in the natural state of living cells are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. of.
  • isolated human mitochondrial ATPase coupling factor 6-10 means human mitochondrial ATPase coupling factor 6-10 is substantially free of other proteins, lipids, carbohydrates or other substances naturally associated with it. Those skilled in the art can purify human mitochondrial ATPase coupling factors 6-10 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human mitochondrial ATPase coupling factor 6-10 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide-human mitochondrial ATPase coupling factor 6-10, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptide of the present invention may be a naturally purified product or a chemically synthesized product, or may be produced from a prokaryotic or eukaryotic host (for example, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technology.
  • polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of human mitochondrial ATPase coupling factor 6-10.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human mitochondrial ATPase coupling factor 6-10 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (in) such One, in which the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or proteogen sequences)
  • such fragments, derivatives and analogs are considered to be within the skill of the art. Within the knowledge of the technician.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 2076 bases, and its open reading frame 168-440 encodes 90 amino acids.
  • this peptide has a similar expression profile with human mitochondrial ATPase coupling factor 6, and it can be deduced that the human mitochondrial ATPase coupling factor 6-10 has similar functions as human mitochondrial ATPase coupling factor 6.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, more preferably 97% or more hybridization occurs.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 Energy and activity.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human mitochondrial ATPase coupling factors 6-10.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human mitochondrial ATPase coupling factor 6-10 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • CDNA library is constructed in a conventional method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989) 0 may be obtained commercially available cDNA library such as cDNA library from Clontech is different. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of transcripts of human mitochondrial ATPase coupling factor 6-10; (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human mitochondrial ATPase coupling factor 6-10 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait.
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Selected and synthesized by conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes necessary to measure a plurality of cloned cDNA sequences can be assembled into full-length cDNA sequence of bad 1 J.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by a basic engineering using the vector of the present invention or directly using human mitochondrial ATPasc coupling factor 6-10 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
  • a polynucleotide sequence encoding human mitochondrial ATPase coupling factor 6-10 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of an expression vector is that it usually contains an origin of replication, a promoter, a marker gene, and translation control elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human mitochondrial ATPase coupling factor 6-10 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • coli the PL promoter of lambda phage
  • eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • Expression vector also includes ribosome binding for translation initiation Site and transcription terminator, etc. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
  • Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription.
  • Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human mitochondrial ATPase coupling factor 6-10 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Representative examples include: Escherichia coli, Streptomyces; bacteria Cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as flies S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaClr method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human mitochondrial ATPase coupling factor 6-10 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cell has grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cell is re- Cultivate for a while.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human mitochondrial ATPase coupling factor 6-10 and human mitochondrial ATPase coupling factor 6 according to the present invention.
  • the upper graph is a graph of the human mitochondrial ATPase coupling factor 6-10, and the lower graph is the graph of the human mitochondrial ATPase coupling factor 6.
  • Figure 2 shows the polyacrylamide gel electrophoresis of isolated human mitochondrial ATPase coupling factor 6-10.
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0764dl2 was new DNA.
  • the inserted cDNA fragment contained in the clone was synthesized by a series of primers Perform a two-way measurement. The results showed that the 0764dl2 clone contained a full-length cDNA of 2076bp (as shown in Seq ID NO: 1), and a 273bp open reading frame (0RF) from 168bp to 440bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- CTCCGGGCGGGGACGTGGTCTGGA —3, (SEQ ID NO: 3)
  • Primer2 5,-AAAGAAGAGGTCTTTCTATGTTGC-3, (SEQ ID NO: 4)
  • Priraerl is a forward sequence starting at the Ibp at the 5 'end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l of KC1, 1 Ommol / L in 50 ⁇ l reaction volume
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5raM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • A- 32 P dATP with 32 ⁇ prepared by random priming Method - labeled DNA probe.
  • the DM probe used was the sequence of the human mitochondrial ATPase coupling factor 6-10 coding region (168bp to 440bp) amplified by PCR as shown in FIG.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H 2 P0 4 (pH7.4) -5 x SSC-5 Denhardt's solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DNA. After hybridization, place the filter in 1 x SSC-0.1% SDS Wash at 55 "C for 30min. Then, analyze and quantify with Phosphor Imager.
  • Example 4 In vitro expression, isolation and purification of recombinant human mitochondrial ATPase coupling factor 6-10
  • Primer3 5'- CCCCATATGATGTTACAGATCACAACGTTCCGC -3, (Seq TD No: 5)
  • Primer4 5'- CATGGATCCTCAGAGAAGATGAGAGGAGGAGAC -3 '(Seq ID No: 6)
  • the coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the pBS-0764dl2 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ containing pBS-0764dl2 plasmid 10 pg, primers Primer-3 and Primer-4 were 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 "C 20s, 60" C 30s, 68 "C 2 min, a total of 25 cycles. Nde I and BamH I were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and recovered The large fragment was ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5CX by the calcium chloride method, cultured overnight on LB plates containing kanamycin (final concentration 30 ⁇ g / ml), and screened for positive by colony PCR method. Cloning and sequencing. Select positive clones (pET-0764dl2) with the correct sequence and transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) using calcium chloride method.
  • kanamycin final concentration 30 ⁇ g) / ml
  • the host bacteria BL21 pET-0764dl 2
  • IPTG was added to a final concentration of 1mmol / L
  • Chromatography was performed using an affinity column His. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag).
  • the purified target protein was obtained.
  • Mitochondrial ATPase coupling factor 6-10 After SDS-PAGE electrophoresis, a single band was obtained at lOKDa (Fig. 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. The 15 N-terminal amino acid residues shown in ID NO: 2 are identical.
  • Example 5 Production of anti-human mitochondrial ATPase coupling factor 6-10 antibodies
  • H SEQ ID NO: 7
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Use 4mg of the above hemocyanin polypeptide And Freund's adjuvant were used to immunize rabbits. After 15 days, the hemocyanin polypeptide complex and incomplete Freund's adjuvant were used to boost the immunity once.
  • the titer of antibody in rabbit serum was determined by ELISA using a titer coated with 15 ⁇ g / ml bovine serum albumin peptide complex. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this example is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps to hybridize the fixed polynucleotide sample to the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the spot imprint method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • GC content is 30 ° /. -70%, non-specific hybridization increases; 3. There should be no complementary regions inside the probe;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO ::
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • Probes 1 3 ⁇ l Probe (0.1OD / 10 ⁇ 1), add 2 ⁇ IKinase buffer, 8-10 uCi y- 32 P-dATP + 2U Kinase, to make up to a final volume of 20 ⁇ 1.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research on the function of new genes; finding and screening new tissue-specific novel genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRisi, J. L., Lyer, V. & Brown, P.0.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian, USA). The distance is 280 m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to prepare DNA on a glass slide to prepare a chip. The specific method has been reported in the literature in various ways. The post-spot processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) by one-step method, and mRNA was purified by Oligotex mRNA Midi Kit (purchased from QiaGen). Another 1 J will be scored. Cy3dUTP (5-Araino-propargyl-2 -deoxyur idine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamac ia Biotech) is used to label the mRNA of human mixed tissues.
  • Cy5dUTP (5-Amino-propargyl-2 -deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Pharaacia Biotech) was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and was prepared after purification. Probe. For specific steps and methods, see:
  • the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • the scanner purchased from General Scanning Company, USA
  • the scanned image was analyzed and processed with Imagene software (Biod i scovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Plot a graph based on these 13 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profiles of human mitochondrial ATPase coupling factor 6-10 and human mitochondrial ATPase coupling factor 6 according to the present invention are very similar. Industrial applicability
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Mitochondria produce a large amount of ATP through oxidative phosphorylation, providing the energy required for various life activities of cells.
  • Mitochondrial RNA coupling factor 6 is a member of the mitochondrial ATPase complex and is a necessary component of the interaction in catalytic reactions.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human mitochondrial RNA coupling factor 6, and both have similar biological functions.
  • the abnormal expression of the human mitochondrial ATPase coupling factor 6-10 of the present invention will produce various diseases, especially various tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases. These diseases include but not limited to:
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymoma, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma embryonic development Disorders: congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • Abnormal expression of the human mitochondrial ATPase coupling factor 6-10 of the present invention will also produce certain hereditary, bloody diseases and the like.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, immunity Sexual diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human mitochondrial ATPase coupling factors 6-10.
  • Agonists increase human mitochondrial ATPase coupling factor 6-10 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human mitochondrial ATPase coupling factor 6-10 can be cultured with labeled human mitochondrial ATPase coupling factor 6-10 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human mitochondrial ATPase coupling factor 6-10 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human mitochondrial ATPase coupling factor 6-10 can bind to human mitochondrial ATPase coupling factor 6-10 and eliminate its function, or inhibit the production of the polypeptide, or interact with the multiple The active site binding of the peptide prevents the polypeptide from performing its biological function.
  • human mitochondrial ATPase coupling factor 6-10 When screening compounds as antagonists, human mitochondrial ATPase coupling factor 6-10 can be added to bioanalytical assays, and compounds can be identified by measuring the effect of the compound on the interaction between human mitochondrial ATPase coupling factor 6-10 and its receptor Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human mitochondrial ATPase coupling factor 6-10 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, human mitochondrial ATPase coupling factor 6-10 molecules should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against human mitochondrial ATPase coupling factor 6-10 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human mitochondrial ATPase coupling factor 6-10 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to human mitochondrial ATPase coupling factor 6-10 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al.
  • Antibodies against human mitochondrial ATPase coupling factor 6-10 can be used in immunohistochemistry to detect human mitochondrial ATPase coupling factor 6-10 in biopsy specimens.
  • Monoclonal antibodies that bind to human mitochondrial ATPase coupling factor 6-10 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human mitochondrial ATPase coupling factor 6-10 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human mitochondrial ATPase coupling factor 6-10 positive Cell.
  • the antibody of the present invention can be used for treating or preventing human mitochondrial ATPase coupling factor 6-10 Disease.
  • Administration of appropriate doses of antibodies can stimulate or block the production or activity of human mitochondrial ATPase coupling factor 6-10.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human mitochondrial ATPase coupling factor 6-10 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The levels of human mitochondrial ATPase coupling factor 6-10 detected in the test can be used to explain the importance of human mitochondrial ATPase coupling factor 6-10 in various diseases and to diagnose human mitochondrial ATPase coupling factor 6-10 disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
  • Polynucleotides encoding human mitochondrial ATPase coupling factor 6-10 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human mitochondrial ATPase coupling factor 6-10.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human mitochondrial ATPase coupling factor 6-10 to inhibit endogenous human mitochondrial ATPase coupling factor 6-10 activity.
  • a mutated human mitochondrial ATPase coupling factor 6-10 may be a shortened human mitochondrial ATPase coupling factor 6-10 lacking a signaling functional domain.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human mitochondrial ATPase coupling factor 6-10.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding human mitochondrial ATPase coupling factor 6-10 into cells.
  • Methods for constructing recombinant viral vectors carrying polynucleotides encoding human mitochondrial ATPase coupling factors 6-10 can be found in existing literature (Sambrook, et al.).
  • recombinant polynucleotides encoding human mitochondrial ATPase coupling factor 6-10 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human mitochondrial ATPa se coupling factor 6-10 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DM synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in various ways, such as To increase the sequence length on both sides, the linkage between ribonucleosides uses phosphothioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human mitochondrial ATPase coupling factor 6-10 can be used for the diagnosis of diseases related to human mitochondrial ATPase coupling factor 6-10.
  • Polynucleotides encoding human mitochondrial ATPase coupling factor 6-10 can be used to detect the expression of human mitochondrial ATPase coupling factor 6-10 or the abnormal expression of human mitochondrial ATPase coupling factor 6-10 in disease states.
  • the DNA sequence encoding human mitochondrial ATPase coupling factor 6-10 can be used to hybridize biopsy specimens to determine the expression of human mitochondrial ATPase coupling factor 6-10.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like.
  • Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human mitochondrial ATPase coupling factor 6-10 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human mitochondrial ATPase coupling factor 6-10 transcription products.
  • Human mitochondrial ATPase coupling factor 6-10 mutations can also be used to diagnose human mitochondrial ATPase coupling factor 6-10 related diseases.
  • Human mitochondrial ATPase coupling factor 6-10 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human mitochondrial ATPase coupling factor 6-10 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
  • the polypeptide of the present invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human mitochondrial ATPase coupling factor 6-10 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human mitochondrial ATPase coupling factor 6-10 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnosing physician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un nouveau polypeptide, un facteur humaine de couplage d'ATPase mitochondriale 6-10, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, des troubles du développement, de l'infection par VIH, des maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour le facteur humaine de couplage d'ATPase mitochondriale 6-10.
PCT/CN2001/000330 2000-03-17 2001-03-16 Nouveau polypeptide, facteur humaine de couplage d'atpase mitochondriale 6-10, et polynucleotide codant pour ce polypeptide WO2001079424A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU50243/01A AU5024301A (en) 2000-03-17 2001-03-16 A novel polypeptide, a human coupling atpase mitochondrial 6-10 factor and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00114976.8 2000-03-17
CN 00114976 CN1314367A (zh) 2000-03-17 2000-03-17 一种新的多肽——人线粒体ATPase耦合因子6－10和编码这种多肽的多核苷酸

Publications (2)

Publication Number Publication Date
WO2001079424A2 true WO2001079424A2 (fr) 2001-10-25
WO2001079424A3 WO2001079424A3 (fr) 2002-03-28

Family

ID=4584447

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000330 WO2001079424A2 (fr) 2000-03-17 2001-03-16 Nouveau polypeptide, facteur humaine de couplage d'atpase mitochondriale 6-10, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1314367A (fr)
AU (1) AU5024301A (fr)
WO (1) WO2001079424A2 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113365535B (zh) 2018-12-03 2023-01-06 尚科宁家运营有限公司 用于向自主装置传送信息的光学标记

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN [Online] 07 March 1997 CAGGESE C. Retrieved from NCBI, accession no. GI:1490234 Database accession no. (CAA67979) *
DATABASE PROTEIN [Online] 31 October 1994 JAVED A.A., OGATA K. AND SANADI D.R. Retrieved from NCBI, accession no. GI:179275 Database accession no. (AAA51807) *

Also Published As

Publication number Publication date
WO2001079424A3 (fr) 2002-03-28
CN1314367A (zh) 2001-09-26
AU5024301A (en) 2001-10-30

Similar Documents

Publication Publication Date Title
WO2001068689A1 (fr) Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide
WO2001079424A2 (fr) Nouveau polypeptide, facteur humaine de couplage d'atpase mitochondriale 6-10, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001075023A2 (fr) Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001075014A2 (fr) Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase 35 humaine, et polynucleotide codant pour ce polypeptide
WO2001073061A1 (fr) Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide
WO2001081392A1 (fr) Nouveau polypeptide, phosphoproteine nucleolaire humaine 13, et polynucleotide codant pour ce polypeptide
WO2001064730A1 (fr) Nouveau polypeptide, 5-phosphatase humaine 18, et polynucleotide codant pour ce polypeptide
WO2001079491A1 (fr) Nouveau polypeptide, canal ionique humain 12 pour le chlore, et polynucleotide codant pour ce polypeptide
WO2001070960A1 (fr) Nouveau polypeptide, proteine humaine de reparation 13 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001070791A1 (fr) Nouveau polypeptide, facteur humain lie a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001072802A1 (fr) Nouveau polypeptide, proteine humaine de liaison 14 d'une proteine precurseur de l'amyloide, et polynucleotide codant pour ce polypeptide
WO2001077165A1 (fr) Nouveau polypeptide, proteine humaine de liaison 12 d'une proteine precurseur de l'amyloide, et polynucleotide codant pour ce polypeptide
WO2001081395A1 (fr) Nouveau polypeptide, adn topo-isomerase i-15, et polynucleotide codant pour ce polypeptide
WO2001081592A1 (fr) Nouveau polypeptide, proteine humaine 11 contenant un fragment de sequence particulier d'une signal peptidase i, et polynucleotide codant pour ce polypeptide
WO2001075029A2 (fr) Nouveau polypeptide, facteur humain 11 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001075013A2 (fr) Nouveau polypeptide, kinase humaine cycline-dependante 14, et polynucleotide codant pour ce polypeptide
WO2001072795A1 (fr) Nouveau polypeptide, quinine reductase humaine 16, et polynucleotide codant pour ce polypeptide
WO2001068874A1 (fr) Nouveau polypeptide, polypeptide humain d'activation endotheliale ii-62, et polynucleotide codant pour ce polypeptide
WO2001048001A1 (fr) Nouveau polypeptide, quinone-proteine reductase 7, et polynucleotide codant pour ce polypeptide
WO2001073008A1 (fr) Nouveau polypeptide, nucleoproteine humaine 13 associee aux tumeurs, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP