WO2001079424A2 - A novel polypeptide - human mitochondrial atpase coupling facor 6-10 and the polynucleotide encoding said polypeptide - Google Patents

Abstract

The invention discloses a new polypeptide-human mitochondrial ATPase coupling facor 6-10, the polynucleotide encoding said polypeptide, and a process for producing the polypeptide by recombinant DNA technology. It also discloses methods of applying the polypeptide for the treatment of various diseases, such as malignancy, hemopathy, development disorder, HIV infection, immune disorders, and inflammation. This invention also discloses antagonist against said polypeptide and thereof therapy uses. In addition, it refers to the use of said polynucleotide encoding this new human mitochondrial ATPase coupling facor 6-10.

Description

A new polypeptide-human mitochondrial ATPase coupling factor 6-10 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human mitochondrial ATPase coupling factor 6-10, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. Background technique

 Mitochondria is an important and unique organelle in eukaryotic cells, and it is the "power station" in cells. Mitochondria undergo a series of energy conversions through oxidative phosphorylation to produce a large amount of ATP, providing the energy required for cells to perform various life activities. The energy released during the transfer of electrons from NADH to oxygen is a direct source of energy for ADP coupling phosphorylation to generate ATP. In mitochondria, oxidation and phosphorylation are simultaneously and closely coupled. The coupling factors are small particles located on the matrix side of the mitochondrial inner membrane. Its main function is to make electron transfer and phosphorylation work in harmony. . Mitochondrial ATPase coupling factor 6 (mitochondrial ATPase coupling factor 6) is a member of the mitochondrial ATPase complex and is a necessary component of the interaction in catalytic reactions.

 A cDNA encoding a precursor of the coupling factor 6 protein has been isolated from human fetuses. This 497 bp cDNA contains a 96 bp segment that specifically encodes the precursor protein (containing 108 amino acid residues). 32 amino acids at the front end, this peptide can function as a signal peptide; a 140 bp segment also exists at the 3'-end of the precursor protein, which is an untranslated region, and the remaining cDNA sequence encodes a mature sequence containing 76 amino acid residues Coupling factor 6 protein (Javed AA, Ogata K, Sanadi DR). The amino acid sequence of mitochondrial ATPase coupling factor 6 is very conserved in various mammals.

 Mitochondrial ATPase coupling factor 6 is a hydrophilic protein, and its hydrophilic side exhibits very similar characteristics in different animal bodies. Ol igomycin sensitivity conferral protein, in the absence of coupling factor 6, can bind ATPase to the mitochondrial membrane, and its apparent association concentration is 10 (6) -1, and After the coupling factor 6 was combined, the association concentration of the obtained ATPase decreased by 1 to 2 orders of magnitude. The oligomycin sensitivity-granting protein is sensitive to rutamycin, while the coupling factor 6-dependent membrane-bound ATPase activity is not sensitive to rutamycin. (Liang AM, Fi sher RJ).

Gene chip analysis revealed that in the thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, arsenic stimulated L02 for 1 hour In cell lines and prostate tissues, the expression profile of the polypeptide of the present invention and human mitochondria The expression profile of ATPase coupling factor 6 is very similar, so the functions of the two may be similar. The invention is named human mitochondrial ATPase coupling factor 6-10.

 As mentioned above, the human mitochondrial ATPase coupling factor 6-10 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more participation in the field has been required These processes of the human mitochondrial ATPase coupling factor 6-10 protein, in particular, identify the amino acid sequence of this protein. Isolation of the new human mitochondrial ATPase coupling factor 6-10 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human mitochondrial ATPase coupling factors 6-10 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human mitochondrial ATPase coupling factor 6-10.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human mitochondrial ATPase coupling factor 6-10.

 Another object of the present invention is to provide a method for producing human mitochondrial ATPase coupling factor 6-10. Another object of the present invention is to provide antibodies against the human mitochondrial ATPase coupling factor 6-10 of the polypeptide of the present invention.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the human mitochondrial ATPase coupling factor 6-10 of the polypeptide of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of human mitochondrial ATPase coupling factor 6-10.

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

(b) a polynucleotide complementary to polynucleotide (a); (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b). More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 168-440 in SEQ ID NO: 1; and (b) a sequence having 1-2076 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human mitochondrial ATPa s e coupling factor 6-10 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human mitochondrial ATPa se coupling factor 6-10 protein in vitro, which comprises detecting a mutation in the polypeptide or a coding polynucleotide sequence thereof in a biological sample. Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The invention also relates to the polypeptides and / or polynucleotides of the invention in the preparation for the treatment of malignant tumors, blood diseases, developmental disorders, HIV infection and immune diseases and various types of inflammation or other human mitochondrial ATPa se coupling factors 6- 10 Use of a medicine for diseases caused by abnormal expression.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of Leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with human mitochondrial ATPase coupling factor 6-10, causes a change in the protein to regulate the activity of the protein. Agonists can include proteins, nucleic acids, carbohydrates, or any other molecule that binds human mitochondrial ATPase coupling factor 6-10.

 An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of human mitochondrial ATPase coupling factor 6-10 when combined with human mitochondrial ATPase coupling factor 6-10. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human mitochondrial ATPase coupling factor 6-10.

 "Regulation" refers to a change in the function of human mitochondrial ATPase coupling factor 6-10, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of human mitochondrial ATPase coupling factor 6-10 Change of nature.

 By "substantially pure" is meant substantially free of other proteins, lipids, carbohydrates, or other substances that would otherwise be associated with it. Those skilled in the art can purify human mitochondrial ATPase coupling factors 6-10 using standard protein purification techniques. The substantially pure human mitochondrial ATPase coupling factor 6-10 produces a single main band on a non-reducing polyacrylamide gel. The purity of human mitochondrial ATPase coupling factor 6-10 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be achieved by hybridization under conditions of reduced stringency (Southern blotting or

Northern blot, etc.) to detect. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not imply strict procedures Conditions with reduced degrees allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences based on different methods such as the Cluster method (Higgins, DGPM Sharp (1988) Gene 73: 237-244). _C Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. . The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence B 100 The number of residues in sequence A-the number of spacer residues in sequence A- sequence in the interval B residues may also be measured as jotun He in the percentage of identity between nucleic acid sequences (Hein J., (1990) methods in emzumology 183: 625-645) or by using Cluster method known in the art ₀ "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') ₂ and Fv, which can specifically bind to the epitopes of human mitochondrial ATPase coupling factor 6-10.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide exists in a living animal. It is not isolated, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in the natural state of living cells are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. of.

 As used herein, "isolated human mitochondrial ATPase coupling factor 6-10" means human mitochondrial ATPase coupling factor 6-10 is substantially free of other proteins, lipids, carbohydrates or other substances naturally associated with it. Those skilled in the art can purify human mitochondrial ATPase coupling factors 6-10 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human mitochondrial ATPase coupling factor 6-10 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide-human mitochondrial ATPase coupling factor 6-10, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptide of the present invention may be a naturally purified product or a chemically synthesized product, or may be produced from a prokaryotic or eukaryotic host (for example, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technology. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. The polypeptides of the invention may also include or exclude the initial methionine residue.

The invention also includes fragments, derivatives and analogs of human mitochondrial ATPase coupling factor 6-10. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human mitochondrial ATPase coupling factor 6-10 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (in) such One, in which the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or proteogen sequences) As set forth herein, such fragments, derivatives and analogs are considered to be within the skill of the art. Within the knowledge of the technician.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 2076 bases, and its open reading frame 168-440 encodes 90 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile with human mitochondrial ATPase coupling factor 6, and it can be deduced that the human mitochondrial ATPase coupling factor 6-10 has similar functions as human mitochondrial ATPase coupling factor 6.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, more preferably 97% or more hybridization occurs. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 Energy and activity.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human mitochondrial ATPase coupling factors 6-10.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human mitochondrial ATPase coupling factor 6-10 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). CDNA library is constructed in a conventional method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989) 0 may be obtained commercially available cDNA library such as cDNA library from Clontech is different. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of transcripts of human mitochondrial ATPase coupling factor 6-10; (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

In the (4) method, the protein product of human mitochondrial ATPase coupling factor 6-10 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait.

 Amplification of DM / RNA by PCR (Saiki, et al. Science

1985; 230: 1350-1354) are preferred for obtaining the genes of the invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-rapid amplification of cDNA ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Selected and synthesized by conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes necessary to measure a plurality of cloned cDNA sequences can be assembled into full-length cDNA sequence of bad ¹ J.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by a basic engineering using the vector of the present invention or directly using human mitochondrial ATPasc coupling factor 6-10 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.

 In the present invention, a polynucleotide sequence encoding human mitochondrial ATPase coupling factor 6-10 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem.

 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of an expression vector is that it usually contains an origin of replication, a promoter, a marker gene, and translation control elements.

Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human mitochondrial ATPase coupling factor 6-10 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. Expression vector also includes ribosome binding for translation initiation Site and transcription terminator, etc. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding a human mitochondrial ATPase coupling factor 6-10 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. . The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples include: Escherichia coli, Streptomyces; bacteria Cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as flies S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaClr method. The steps used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 Using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human mitochondrial ATPase coupling factor 6-10 (Science, 1984; 224: 1431). Generally there are the following steps:

 (1) using the polynucleotide (or variant) encoding human human mitochondrial ATPase coupling factor 6-10 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cell has grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cell is re- Cultivate for a while.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of gene chip expression profiles of human mitochondrial ATPase coupling factor 6-10 and human mitochondrial ATPase coupling factor 6 according to the present invention. The upper graph is a graph of the human mitochondrial ATPase coupling factor 6-10, and the lower graph is the graph of the human mitochondrial ATPase coupling factor 6.

 Figure 2 shows the polyacrylamide gel electrophoresis of isolated human mitochondrial ATPase coupling factor 6-10.

(SDS-PAGE). lOKDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are usually performed according to conventional conditions, such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

 Example 1: Cloning of human mitochondrial ATPase coupling factor 6-10

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Using Quik mRNA Isolation Kit

(Qiegene product) Isolate poly (A) mRNA from total RNA. 2ug poly (A) mRNA forms c DNA by reverse transcription. Using a Sma rtc DN A cloning kit (purchased from C1 on tech), the c DN A fragment was inserted into the multicloning site of the pBSK (+) vector (Clontech) to transform DH5a, and the bacteria formed a cDNA library. Dye terminate cycle reaction ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0764dl2 was new DNA. The inserted cDNA fragment contained in the clone was synthesized by a series of primers Perform a two-way measurement. The results showed that the 0764dl2 clone contained a full-length cDNA of 2076bp (as shown in Seq ID NO: 1), and a 273bp open reading frame (0RF) from 168bp to 440bp, encoding a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS-0764dl2 and the encoded protein was named human mitochondrial ATPase coupling factor 6-10. Example 2: Cloning of a gene encoding human mitochondrial ATPase coupling factor 6-10 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:

 Primerl: 5'- CTCCGGGCGGGGACGTGGTCTGGA —3, (SEQ ID NO: 3)

 Primer2: 5,-AAAGAAGAGGTCTTTCTATGTTGC-3, (SEQ ID NO: 4)

 Priraerl is a forward sequence starting at the Ibp at the 5 'end of SEQ ID NO: 1;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

 Amplification reaction conditions: 50 μl of KC1, 1 Ommol / L in 50 μl reaction volume

Tris-Cl, (pH 8.5), 1.5 mmol / L MgCl ₂ , 200 μL / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ^Q C 30sec; 55 "C 30sec; 72 ° C 2min. At the same time, β-act in was set as positive during RT-PCR. Controls and template blanks were negative controls. The amplified products were purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit. DNA sequence analysis showed that the DNA sequence of the PCR product was in accordance with SEQ ID NO: The 1-2076bp shown in Figure 1 are exactly the same. Example 3: Northern blot analysis of human mitochondrial ATPase coupling factor 6-10 gene expression:

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5raM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. A- ³² P dATP with ^{32 Ρ} prepared by random priming Method - labeled DNA probe. The DM probe used was the sequence of the human mitochondrial ATPase coupling factor 6-10 coding region (168bp to 440bp) amplified by PCR as shown in FIG. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H ₂ P0 ₄ (pH7.4) -5 x SSC-5 Denhardt's solution and 200 μ _§ / ηι1 salmon sperm DNA. After hybridization, place the filter in 1 x SSC-0.1% SDS Wash at 55 "C for 30min. Then, analyze and quantify with Phosphor Imager. Example 4: In vitro expression, isolation and purification of recombinant human mitochondrial ATPase coupling factor 6-10

 Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers were designed. The sequences are as follows:

 Primer3: 5'- CCCCATATGATGTTACAGATCACAACGTTCCGC -3, (Seq TD No: 5) Primer4: 5'- CATGGATCCTCAGAGAAGATGAGAGGAGGAGAC -3 '(Seq ID No: 6) These two primers contain Ndel and BamHI restriction sites, respectively. The coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively. The Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site. The pBS-0764dl2 plasmid containing the full-length target gene was used as a template for the PCR reaction. The PCR reaction conditions were as follows: a total volume of 50 μΐ containing pBS-0764dl2 plasmid 10 pg, primers Primer-3 and Primer-4 were 1 Opmol, Advantage polymerase Mix (Clontech) 1 μ1, respectively. Cycle parameters: 94 "C 20s, 60" C 30s, 68 "C 2 min, a total of 25 cycles. Nde I and BamH I were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and recovered The large fragment was ligated with T4 ligase. The ligation product was transformed into E. coli DH5CX by the calcium chloride method, cultured overnight on LB plates containing kanamycin (final concentration 30 μg / ml), and screened for positive by colony PCR method. Cloning and sequencing. Select positive clones (pET-0764dl2) with the correct sequence and transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) using calcium chloride method. In kanamycin (final concentration 30 μ g) / ml) in LB liquid medium, the host bacteria BL21 (pET-0764dl 2) was cultured at 37 ° C to the logarithmic growth phase, IPTG was added to a final concentration of 1mmol / L, and the culture was continued for 5 hours. The supernatant was collected by centrifugation, and the supernatant was collected by centrifugation. Chromatography was performed using an affinity column His. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag). The purified target protein was obtained. Mitochondrial ATPase coupling factor 6-10 After SDS-PAGE electrophoresis, a single band was obtained at lOKDa (Fig. 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. The 15 N-terminal amino acid residues shown in ID NO: 2 are identical. Example 5 Production of anti-human mitochondrial ATPase coupling factor 6-10 antibodies

 The following human mitochondrial ATPase coupling factor 6-10 specific peptides were synthesized using a peptide synthesizer (product of PE company):

 NH2-Met-Leu-G ln-Il e-Thr-Thr-Phe-Arg-Leu-H i s-Val-Ser-H i s- G 1 n-Th r-COO

H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Use 4mg of the above hemocyanin polypeptide And Freund's adjuvant were used to immunize rabbits. After 15 days, the hemocyanin polypeptide complex and incomplete Freund's adjuvant were used to boost the immunity once. The titer of antibody in rabbit serum was determined by ELISA using a titer coated with 15 μg / ml bovine serum albumin peptide complex. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Seph _arOS e4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human mitochondrial ATPase coupling factor 6-10. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

 The purpose of this example is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps to hybridize the fixed polynucleotide sample to the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the spot imprint method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

2, GC content is 30 ° /. -70%, non-specific hybridization increases; 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'- TGTTACAGATCACAACGTTCCGCCTGCACGTTTCCCACCAG -3 '(SEQ ID NO: 8)

 Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO ::

 5- TGTTACAGATCACAACGTTCCGCCTGCACGTTTCCCACCAG -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental procedures, please refer to the literature: DNA PROBES GH Kel ler; MM Manak; Stockton Press, 1989 (USA (USA) ) And more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

1.Extract DNA from fresh or frozen tissue

 Steps: 1) Place fresh or freshly thawed normal liver tissue in ice and hold phosphate buffered saline

(PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) cold homogenization buffer (0.25mol / L sucrose; Implicit 25 ol / L Tris-HCl, pH7.5 ; 25mmol / LnaCl; 25nimol / L MgCl 2) was suspended precipitate (about lOml / g). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1 to 5 ml per 0.1 g of the original tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, phenol extraction method for DNA

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) with cold cell lysate pelleted cells were resuspended (1 X 10 ⁸ cells / ml) Minimum application lOOul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25:24:) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. S) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DNA to a new tube. The DNA was then purified and ethanol precipitated.

3, DNA purification and ethanol precipitation

 Steps: 1) Add 10 volumes of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Store at _20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to evaporate the surface ethanol. Be careful not to dry the precipitate completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend DN. \ Precipitation in a small volume of TE or water. Vortex at low speed or pipette with suction, while gradually increasing TE, mix until the DNA is fully dissolved, add approximately 1ul per 1-5 cells.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DM solution to a final concentration of 100 ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K, the final concentrations are 0.5% and 100ug / ml. Incubate at 37 "C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and use an equal volume of chloroform: iso Amyl alcohol (24: 1) was re-extracted and centrifuged for 10 minutes. 12) Carefully remove the water phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, mix and set at -20 ° C for 1 hour. 13) Wash the precipitate with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid, the process is the same as steps 3 to 6. 14) Determine A _{26 (} , and A ₂ to detect the purity and yield of DNA.) 15) After packing Store at-20 "C.

Preparation of sample film:

 1) Take 4 x 2 nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number with a pencil. Two NC membranes are required for each probe for subsequent experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

 2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ^u C for 2 hours.

Labeling of probes 1) 3 μl Probe (0.1OD / 10 μ 1), add 2 μ IKinase buffer, 8-10 uCi y- ³² P-dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of bromophenol blue indicator (BPB I

 4) Pass through a Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (moni tor can be used for monitoring).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) After combining the collection solutions of the first peak, the ³² P-Probe (the second peak is free γ- ³² P-dATP) is prepared. Pre-hybridization

 Place the sample film in a plastic bag, add 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).), Seal the bag, and shake in a 68 "C water bath for 2 hours .

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it in a 42 "C water bath overnight. Wash the film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

2) 2xSSC, 0.1% SDS, 40 ⁿ C for 15 minutes (twice).

 3) 0. IxSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 4) 0. IxSSC, 0.1% SDS, wash at 55 C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 "C for 15 minutes (twice).

 3) 0. IxSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 4) 0. IxSSC, 0.1 ° /. In SDS, wash at 40 ° C for 15 minutes (twice) and dry at room temperature.

X-ray autoradiography:

 -70, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

 Experimental results:

The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of hybridization spots of probe 1 Significantly more radioactive than the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with Probe 1.

Example 7 DNA Microarray

 Gene chip or gene microarray (DNAMicroarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research on the function of new genes; finding and screening new tissue-specific novel genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature, for example, see the literature DeRisi, J. L., Lyer, V. & Brown, P.0.

(1997) Science 278, 680-686. And Helle, R. A., Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian, USA). The distance is 280 m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to prepare DNA on a glass slide to prepare a chip. The specific method has been reported in the literature in various ways. The post-spot processing steps in this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

 4. NaB is blocked for 5 minutes;

 5. 95 "C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

8. Dry and store at 25 ⁿ C in the dark for future use.

 (2) Probe marking

Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) by one-step method, and mRNA was purified by Oligotex mRNA Midi Kit (purchased from QiaGen). Another ¹ J will be scored. Cy3dUTP (5-Araino-propargyl-2 -deoxyur idine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamac ia Biotech) is used to label the mRNA of human mixed tissues. Cy5dUTP (5-Amino-propargyl-2 -deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Pharaacia Biotech) was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and was prepared after purification. Probe. For specific steps and methods, see:

Schena,

 M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena,., Shalon, Dari., Davis, RW (1995) Science .270. (20): 467-480.

 (Three) cross

 The probes from the two types of tissues and the chips were hybridized in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000. The scanner (purchased from General Scanning Company, USA) was used for scanning. The scanned image was analyzed and processed with Imagene software (Biod i scovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Plot a graph based on these 13 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profiles of human mitochondrial ATPase coupling factor 6-10 and human mitochondrial ATPase coupling factor 6 according to the present invention are very similar. Industrial applicability

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

 Mitochondria produce a large amount of ATP through oxidative phosphorylation, providing the energy required for various life activities of cells. Mitochondrial RNA coupling factor 6 is a member of the mitochondrial ATPase complex and is a necessary component of the interaction in catalytic reactions.

The expression profile of the polypeptide of the present invention is consistent with the expression profile of human mitochondrial RNA coupling factor 6, and both have similar biological functions. As a member of the mitochondrial ATPase complex in the body, it is important for energy generation and material metabolism. Its abnormal expression is usually associated with some related disorders of material metabolism disorders, growth and development of related tissue tumors and cancer. Closely related and produce related diseases. It can be seen that the abnormal expression of the human mitochondrial ATPase coupling factor 6-10 of the present invention will produce various diseases, especially various tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases. These diseases include but not limited to:

 Tumors of various tissues: stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymoma, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma embryonic development Disorders: congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness

 Growth and development disorders: mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation

 Inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations

 Immune diseases: Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome

 Abnormal expression of the human mitochondrial ATPase coupling factor 6-10 of the present invention will also produce certain hereditary, bloody diseases and the like.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, immunity Sexual diseases, certain hereditary, blood diseases, etc.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human mitochondrial ATPase coupling factors 6-10. Agonists increase human mitochondrial ATPase coupling factor 6-10 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human mitochondrial ATPase coupling factor 6-10 can be cultured with labeled human mitochondrial ATPase coupling factor 6-10 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.

Antagonists of human mitochondrial ATPase coupling factor 6-10 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human mitochondrial ATPase coupling factor 6-10 can bind to human mitochondrial ATPase coupling factor 6-10 and eliminate its function, or inhibit the production of the polypeptide, or interact with the multiple The active site binding of the peptide prevents the polypeptide from performing its biological function.

 When screening compounds as antagonists, human mitochondrial ATPase coupling factor 6-10 can be added to bioanalytical assays, and compounds can be identified by measuring the effect of the compound on the interaction between human mitochondrial ATPase coupling factor 6-10 and its receptor Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human mitochondrial ATPase coupling factor 6-10 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, human mitochondrial ATPase coupling factor 6-10 molecules should generally be labeled.

 The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against human mitochondrial ATPase coupling factor 6-10 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

 Polyclonal antibodies can be produced by injecting human mitochondrial ATPase coupling factor 6-10 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc. Techniques for preparing monoclonal antibodies to human mitochondrial ATPase coupling factor 6-10 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al.

al, PNAS, 1985, 81: 6851) 0 only some technical production of single chain antibodies (US Pa t No.4946778) may also be used to produce an anti-human mitochondrial ATPase-coupling factor of the single-chain antibody 6-10.

 Antibodies against human mitochondrial ATPase coupling factor 6-10 can be used in immunohistochemistry to detect human mitochondrial ATPase coupling factor 6-10 in biopsy specimens.

 Monoclonal antibodies that bind to human mitochondrial ATPase coupling factor 6-10 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human mitochondrial ATPase coupling factor 6-10 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human mitochondrial ATPase coupling factor 6-10 positive Cell.

The antibody of the present invention can be used for treating or preventing human mitochondrial ATPase coupling factor 6-10 Disease. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human mitochondrial ATPase coupling factor 6-10.

 The invention also relates to a diagnostic test method for quantitative and localized detection of human mitochondrial ATPase coupling factor 6-10 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The levels of human mitochondrial ATPase coupling factor 6-10 detected in the test can be used to explain the importance of human mitochondrial ATPase coupling factor 6-10 in various diseases and to diagnose human mitochondrial ATPase coupling factor 6-10 disease.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.

 Polynucleotides encoding human mitochondrial ATPase coupling factor 6-10 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human mitochondrial ATPase coupling factor 6-10. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human mitochondrial ATPase coupling factor 6-10 to inhibit endogenous human mitochondrial ATPase coupling factor 6-10 activity. For example, a mutated human mitochondrial ATPase coupling factor 6-10 may be a shortened human mitochondrial ATPase coupling factor 6-10 lacking a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human mitochondrial ATPase coupling factor 6-10. Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding human mitochondrial ATPase coupling factor 6-10 into cells. Methods for constructing recombinant viral vectors carrying polynucleotides encoding human mitochondrial ATPase coupling factors 6-10 can be found in existing literature (Sambrook, et al.). In addition, recombinant polynucleotides encoding human mitochondrial ATPase coupling factor 6-10 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human mitochondrial ATPa se coupling factor 6-10 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DM synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in various ways, such as To increase the sequence length on both sides, the linkage between ribonucleosides uses phosphothioester or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding human mitochondrial ATPase coupling factor 6-10 can be used for the diagnosis of diseases related to human mitochondrial ATPase coupling factor 6-10. Polynucleotides encoding human mitochondrial ATPase coupling factor 6-10 can be used to detect the expression of human mitochondrial ATPase coupling factor 6-10 or the abnormal expression of human mitochondrial ATPase coupling factor 6-10 in disease states. For example, the DNA sequence encoding human mitochondrial ATPase coupling factor 6-10 can be used to hybridize biopsy specimens to determine the expression of human mitochondrial ATPase coupling factor 6-10. Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. Human mitochondrial ATPase coupling factor 6-10 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human mitochondrial ATPase coupling factor 6-10 transcription products.

 Detection of human mitochondrial ATPase coupling factor 6-10 mutations can also be used to diagnose human mitochondrial ATPase coupling factor 6-10 related diseases. Human mitochondrial ATPase coupling factor 6-10 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human mitochondrial ATPase coupling factor 6-10 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries. Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian

Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them. In addition, the polypeptide of the present invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human mitochondrial ATPase coupling factor 6-10 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of human mitochondrial ATPase coupling factor 6-10 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnosing physician.

Claims

 Request for Rights

 1. An isolated polypeptide-human mitochondrial ATPase coupling factor 6-10, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or an active fragment, analog or derivative thereof.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having an amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence at positions 168-440 in SEQ ID NO: 1 or a sequence at positions 1-2076 in SEQ ID NO: 1. .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human mitochondrial ATPase coupling factor 6-10 activity, characterized in that the method includes:

 (a) culturing the engineered host cell of claim 8 under the condition of expressing human mitochondrial ATPase coupling factor 6-10;

 (b) Isolating a polypeptide with human mitochondrial ATPase coupling factor 6-10 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that the antibody is an antibody capable of specifically binding to human mitochondrial ATPase coupling factor 6-10. u. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human mitochondrial ATPase coupling factor 6-10.

12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

13. Use of a compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human mitochondrial ATPase coupling factor 6-10 in vitro and in vivo.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide. 15. Use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human mitochondrial ATPase coupling factor 6-10; or Identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or used for manufacturing a gene chip. Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human mitochondrial ATPase coupling factor 6-10 abnormality.

18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.