WO2001079491A1 - A novel polypeptide-human chloride channel protein 12 and the polynucleotide encoding said polypeptide - Google Patents

Abstract

The invention discloses a new polypeptide-human chloride channel protein 12, the polynucleotide encoding said polypeptide, and a process for producing the polypeptide by recombinant DNA technology. It also discloses methods of applying the polypeptide for the treatment of various diseases, such as paramyotonia, myonosus, various tumour, inflammation, immune disorders, hemopathy, development disorder, and HIV infection. This invention also discloses antagonist against said polypeptide and thereof therapy uses. In addition, it refers to the use of said polynucleotide encoding this new human chloride channel protein 12.

Description

 A new polypeptide-human chloride channel protein 12 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, namely human chloride channel protein 12, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique

 There is a material exchange between the cell and the surrounding environment and other cells at all times. The exchange channels are diverse. The ion channel is one of the exchange modes. It changes the ion communication of the plasma membrane of the cell. Permeability to regulate the concentration of substances in cells. Ion channels are proteins distributed on the cell membrane, which are involved in the homeostasis of cells and the maintenance of electrical pulse binding and transfer. This function is particularly important in cellular events such as muscle contraction, neuronal signal transmission, and extracellular secretion of cells (Hill, B. (1992)). According to the different ion channel control mechanisms, ion channels can be divided into two main types: ligand-gated and voltage-controlled (voUaged-gated). The two different types of ion channel proteins also show large differences in structure.

 The chloride channel family (C1C) is by far the most thoroughly studied channel protein family in ion channels. More typical genes, such as C1CN4, belong to the chloride channel family, which is located on the sex chromosome X. Its sequence contains 260 amino acid residues and there are 12 hydrophobic regions in the structure. Analysis and comparison of its expression in various body tissues revealed that the expression of CLCN4 showed a higher level in skeletal muscle, while the expression level in the heart and brain was lower.

 A number of ion channel genes have been found to be associated with certain diseases, as well as in the chloride channel family. For example, Myotonias is a hereditary heterogeneous muscle disorder with symptoms of skeletal muscle stiffness and easy damage (Ptacek, LJ, Johnson, KJ (1993)), Thomsen and Becker-type myotonia in humans Research on the disease revealed that the ion channel C1C-1 gene was mutated, which led to the occurrence of heterogeneous muscle disorders (Koch, MC; Steinmeyer,. Et al.).

 Gene chip analysis revealed that in the thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, arsenic-stimulated L02 In cell lines and prostate tissues, the expression profile of the polypeptide of the present invention is very similar to the expression profile of the chloride ion channel protein, so their functions may also be similar. The invention is named human Chloride Channel Protein 12.

As mentioned above, human chloride channel protein 12 protein regulates cell division and embryonic development. It plays an important role in important functions, and it is believed that a large number of proteins are involved in these regulatory processes, so the art has always needed to identify more human chloride channel protein 12 proteins involved in these processes, especially the amino acid sequence of this protein. Isolation of the new human chloride channel protein 1 2 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of a diagnostic and / or therapeutic agent for the disease, and it is therefore important to isolate its coding DNA. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human chloride channel protein 12 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human chloride channel protein 1 2.

 It is another object of the present invention to provide a genetically engineered host cell containing a polynucleotide encoding human chloride channel protein 1 2.

 Another object of the present invention is to provide a method for producing human chloride ion channel protein 12.

 Another object of the present invention is to provide an antibody against the polypeptide-human chloride channel protein 1 2 of the present invention.

 Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the human chloride ion channel protein 12 of the polypeptide of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating a disease associated with an abnormality of human chloride channel protein 1 2.

 The present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID D. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID D NO: 1

A sequence of positions 587-928; and (b) a sequence of positions 1-2373 in SEQ ID NO: 1.

The invention further relates to a vector, in particular an expression vector, containing a polynucleotide of the invention; A host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; a method for preparing a polypeptide of the present invention comprising culturing the host cell and recovering an expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human chloride channel protein 12 protein activity, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human chloride channel protein 12 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the polypeptides and / or polynucleotides of the present invention prepared for the treatment of myotonia, other muscle diseases, various tumors, inflammation, immune diseases, blood diseases, developmental disorders, HIV infection or other human Use of medicament for diseases caused by abnormal expression of chloride channel protein 12.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

 The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

"Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" means the replacement of a different amino acid or A nucleotide replaces one or more amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

 An "agonist" refers to a molecule that, when combined with human chloride channel protein 12, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human chloride channel protein 12.

 An "antagonist" or "inhibitor" refers to a molecule that, when combined with human chloride channel protein 12, can block or regulate the biological or immunological activity of human chloride channel protein 12. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human chloride channel protein 12.

 "Regulation" refers to a change in the function of human chloride channel protein 12, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human chloride channel protein 12.

"Substantially pure ¹ 'means substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human chloride channel protein 12 using standard protein purification techniques. Basically Pure human chloride channel protein 12 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human chloride channel protein 12 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Mad Son Wis.). MEGALIGN The program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). _{0 The} Cluster method arranges each group of sequences by checking the distance between all pairs. cluster. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by the Cluster method or by the method known in the art such as Jotun Hein. The percent identity between nucleic acid sequences (Hein J., (1990) Methods in emzumology 183: 625-645). "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions when the alignment between amino acid sequences is aligned. Amino acids used for conservative substitutions For example, negatively charged amino acids may include aspartic acid and glutamine Acids; positively charged amino acids can include lysine and arginine; amino acids with similarly hydrophilic head groups that have no charge can include leucine, isoleucine, and valine; glycine and Alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to an intact antibody molecules and fragments thereof, such as _{Fa, F (a b ')} 2 and F _V, which specifically binds to human chloride ion channel protein antigenic determinant 12.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

As used in the present invention, "isolated" means that the substance is separated from its original environment (if it is natural Natural material, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .

 As used herein, "isolated human chloride channel protein 1 2" means that human chloride channel protein 1 2 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human chloride channel proteins 1 2 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human chloride ion channel protein] 2 The purity of the peptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, human chloride channel protein 12, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The present invention also includes fragments, derivatives, and analogs of human chloride channel protein 1 2. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human chloride ion channel protein 1 2 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by other groups to include a substituent; or (III) such One, wherein the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 2 373 bases, and its open reading frames 587- 928 encode 113 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with chloride ion channel protein, and it can be deduced that the human chloride ion channel protein 12 has similar functions to chloride ion channel protein. The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used in the present invention, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50% (v / v) formamide, 0.1M, bovine serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, more preferably 97% or more hybridization occurs. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human chloride channel protein 12.

The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human chloride channel protein 12 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These technologies include, but are not limited to: 1) Hybridize a probe with a genomic or cDNA library to detect homologous polynucleotide sequences, and 2) screen antibodies for the expression library to detect cloned polynucleotide fragments with common structural characteristics.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be screened from these cDNA libraries by conventional methods. These methods include the following: (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of humans The level of the transcript of chloride channel protein 12; (4) The protein product of the gene is detected by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 3Q nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, the protein product expressed by the human chloride channel protein 2 gene can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

 DNA / RNA Amplification Using PCR Techniques (Saiki, et al. Science

1985; 230: 1350-1354) are preferred for obtaining the genes of the invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-rapid amplification of cDNA ends) may be preferably used. The primers used for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. To obtain the full-length cDNA sequence, The sequence needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human chloride channel protein 12 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology .

 In the present invention, a polynucleotide sequence encoding human chloride channel protein 12 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct a protein containing human chloride ion channel protein 12

An expression vector for DNA sequences and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the _PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, and the early and late SV40 promoters , Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

Those of ordinary skill in the art will know how to select an appropriate vector / transcription regulatory element (such as Promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding human chloride channel protein 12 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as Fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote, such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl ₂ method. The steps used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 The polynucleotide sequence of the present invention can be used to express or produce recombinant human chloride channel protein 12 by conventional recombinant DNA technology (Science, 1984; 224: 1431). Generally, the following steps are taken:

 (1) using the polynucleotide (or variant) encoding human human chloride channel protein 12 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3). Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of gene chip expression profiles of human chloride ion channel protein 12 and chloride ion channel protein of the present invention. The upper graph is a graph of the expression profile of human chloride channel protein 12, and the lower graph is the graph of the expression profile of chloride channel protein 12.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human chloride ion channel protein 12. 12KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

 Example 1: Cloning of human chloride channel protein 12

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using the Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. The Smart cDNA Cloning Kit (purchased from Clontech) was used to insert the cDM fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5cc. The bacteria formed a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0708c05 was new DNA. The inserted cDNA fragment contained in this clone was determined in both directions by synthesizing a series of primers. The results show that the 0708c05 clone contains a full-length cDNA of 2373bp (as shown in Seq TD NO: 1), and has a 342bp open reading frame (0RF) from 587bp to 928bp, encoding a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS-0708c05 and the encoded protein was named human chloride channel protein 12. Example 2: Cloning of a gene encoding human chloride channel protein 12 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction.

After purification of Qiagene's kit, PCR amplification was performed with the following primers:

Primerl: 5'- ATCATAAAAAATAGTAAATAAATT-3, (SEQ ID NO: 3) Primer2: 5'- ATCAAAAAATGTGTATTGAACAAT -3, (SEQ ID NO: 4)

 Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Conditions for the amplification reaction: 50 mmol / L KC1, 10 mmol / L Tris-CI, (pH 8.5), 1.5 mmol / L MgCl ₂ , 200 μ mol / L dNTP, lOpmol primers in a 50 μ 1 reaction volume, 1U of Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min ₀ β-act in was set as positive during RT-PCR Controls and template blanks are negative controls. The amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2373bp shown in SEQ ID NO: 1. Example 3: Northern blot analysis of human chloride channel protein 12 gene expression:

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 _M g RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. With α- ³² Ρ dATP Preparation ^{32 Ρ-} DNA probe labeled by the random primer method. The DNA probe used was the PCR amplified human chloride channel protein 12 coding region sequence (587bp to 928bp) shown in FIG. 1. A 32P-labeled probe (approximately 2 x 1 (cpm / ml)) was transferred to a nitrocellulose membrane to which RNA was transferred in a solution at 42 ° C overnight. The solution contained 50% formamide-25m H ₂ P0 ₄ (pH7.4) -5 χ SSC-5 χ Denhardt's solution and 200 μg / ml salmon sperm DNA. After hybridization, the filter was washed in 1 χ SSC-0.1% SDS at 55 ° C for 30 minutes. Then, Phosphor Imager for analysis and quantification. Example 4: In vitro expression, isolation and purification of recombinant human chloride channel protein 12.

 According to SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers was designed, the sequence is as follows:

Primer3: 5,-CCCCATATGATGGAAGCTTTAAAACAAGAGAGA-3-(Seq ID No: 5) Primer4: 5'- CATGGATCCTTATAAATGGAATGAGACTGCTCG -3, (Seq ID No: 6) The 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively. The coding sequences of the 5 'and 3' ends of the target gene are followed respectively, and the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen Company product, Cat. No. 69865.3). The pBS-0708c05 plasmid containing the full-length target gene was used as a template for the PCR reaction. The PCR reaction conditions are as follows: a total volume of 50 μ1 containing 10 pg of pBS-0708c05 plasmid, primers? !! ^! ^-? with? !! ^! ^ It is divided into ^! ^, Advantage polymerase Mix (Clontech) 1 μ1. Cycle parameters: 9 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into the coliform bacteria DH5α by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 _M g / ml), positive clones were screened by colony PCR method and sequenced. A positive clone (pET-0708c05) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In containing kanamycin (final concentration 30 g / ml) of LB liquid medium, host strain BL21 _(P ET-0708c05) were cultured to logarithmic growth phase, IPTG was added to a final concentration Immol / L at 37 ° C, Continue incubation for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation, and the supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used for chromatography to obtain 6 histidines (6His-Tag). Purified the target protein human chloride channel protein 12. After SDS-PAGE electrophoresis, a single band was obtained at 12 KDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of Anti-Human Chloride Channel Protein 12 Antibody

 Polypeptide synthesizer (product of PE company) was used to synthesize the following human chloride channel protein 12-specific peptides: NH2-Met-G 1 u- A 1 a- Leu- Ly s- G 1 nG 1 u-Arg-Arg- G 1 u- Thr- Leu- Ty r- H i s- Leu- C00H

(SEQ ID NO: 7). This peptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemistry, 1969; 6:43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex and complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex and incomplete Freund's adjuvant were used to boost the immunity once. A 15 g / ml bovine serum albumin peptide complex-coated titer plate was used for ELISA to determine the titer of antibody in rabbit serum. Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit sera. The peptide was bound to a cyanogen bromide-activated Sepharose 4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method demonstrated that the purified antibody specifically binds to human chloride channel protein 12. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to Identifying whether it contains the polynucleotide sequence of the present invention and detecting a homologous polynucleotide sequence, further The probe is used to detect whether the expression of the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof in cells of normal tissues or pathological tissues is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;

 3, there should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID D NO: 1 (41Nt):

5'- TGGAAGCTTTAAAACAAGAGAGAAGAGAAACACTATATCAT -3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the gene fragment of SEQ ID NO: 1 Or the replacement mutant sequence of its complementary fragment (41Nt):

 5'- TGGAAGCTTTAAAACAAGAGCGAAGAGAAACACTATATCAT -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods related to the following specific experimental steps, please refer to the literature: DNA PROBES GH Kel ler; MM Manak; Stockton Press, 1989 ( USA) and more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" (U998 Second Edition) [US] Sambrook et al., Science Press.

 Sample Preparation:

1. Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. ² ) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the precipitate (about 10 ml / g) with a cold homogenate buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mol / LnaCl; 25 mmol / L MgCl ₂ ). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1-5 ml per 0.1 g of the original tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add 1 ml per 0.1 g of the initial tissue sample), and then follow the following phenol extraction method.

 2, DNA phenol extraction method

Steps: 1) Wash the cells with 1-lOral cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells (lx 10 ^s cells / ml) with cold cell lysate and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. ⁴ ) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 1 volume of cold 100% ethanol to the DNA solution and mix. At -20. C Let stand for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Take care not to completely settle Dry, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DM pellet with a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, every ^1- 5 χ 10 ό extracted cells plus about lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / nil, respectively. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 10 volumes of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, mix and set at -20 ° C for 1 hour. 13) Wash the precipitate with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A _28Q to detect DNA purity and yield. 15) Store at -20 ° C after dispensing. Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and gently mark the spotting position and sample number on them with a pencil. Two NC membranes are required for each probe for subsequent experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

 2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), and dry in 0.5 mol / L Tris-HCl ( _P H7.0), 3 mol / L NaCl Leave on filter paper for 5 minutes (twice) and dry.

 4) Caught in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0. IOD / Ιθμ 1), add 2 μ 1 Kinase buffer, 8-10 uCi γ- ³² P- dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of bromophenol blue indicator (BPB).

 4) Pass Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

 8) After the collection of the first peak is combined, the "P-Probe" (the second peak is free γ--dATP) is prepared.

Pre-hybridization Put the sample film in a plastic bag, add 3-10 mg of pre-hybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).), Seal the bag, and shake at 68 ° C for 2 hours in a water bath .

 Cross

Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it in a 42 ^U C water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, 40. C Wash for 15 minutes (twice).

 4) 0.1xSSC, 0.1 ° /. Wash in SDS at 55 ° C for 30 minutes (twice) and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) 0. lxSSC, 0.1 ° /. Wash in SDS at 37 ° C for 15 minutes (twice).

 4) In 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray autoradiography:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than that of hybridization spots. The radioactive intensity of the hybridization spot of the other probe. Therefore, probes can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotides of the present invention in different tissues.

Example 7 DNA Microarray

Gene chip or gene microarray (DNA Microarray) is a new technology that many national laboratories and large pharmaceutical companies are currently researching and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on slopes. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; finding and screening for tissue specificity New genes, especially those related to diseases such as tumors; Diagnosis of diseases, such as hereditary diseases. The specific method steps have been reported in the literature. For example, refer to the documents DeRisi, JL, Lyer, V. & Brown, PO (1997) Science 278, 680-686. And the documents Helle, RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA), between the points. The distance is 280 μ _ηΐ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

 Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen). The fluorescent reagent Cy3dUTP ( 5- Amino- propargy 2'-deoxyuridine 5'-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech Company) mRNA of human mixed tissue was labeled with Cy5dUTP (5-Amino-propargyl-2'-deoxyuridine) fluorescent reagent 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe. For specific steps and methods, see:

 Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Shalon, Dari., Davis, RW (1995 ) Science.270. (20): 467-480. (3) Hybridization

Combine the probes from the two tissues with the chips in UniHyb ™ Hybridization Solution (purchased from TeleChem) was used for hybridization for 16 hours, and washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned image Imagene software (Biodiscovery, USA) was used for data analysis and processing to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these 13 Cy3 / Cy5 ratios, a bar graph is drawn. (figure 1 ) . It can be seen from the figure that the expression profiles of human chloride ion channel protein 12 and chloride ion channel protein according to the present invention are very similar. Industrial applicability

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.

 Ion channels are proteins distributed on the cell membrane and are involved in the dynamic balance and information transmission of ions inside and outside the cell. This function is particularly important in cellular events such as muscle contraction, neuronal signal transmission, and extracellular secretion of cells. The chloride channel family proteins are present in various body tissues and are highly expressed in muscle tissues.

 Studies have found that mutations in members of the chloride channel family, such as the C1C-1 gene, cause myotonia, which is a genetic heterogeneous muscle disorder.

 The expression profile of the polypeptide of the present invention is consistent with the expression profile of human chloride ion channel protein, and both have similar biological functions. It involves the dynamic balance of ions inside and outside the cell and information transmission in the body, which regulates the normal function of the cell, especially related to the physiological function of muscle tissue. Its abnormal expression will cause the dysfunction of the above-mentioned tissue cells and cause related diseases.

 It can be seen that the abnormal expression of human chloride channel protein 12 of the present invention will produce various diseases, especially myotonia, other muscle diseases, various tumors, embryonic development disorders, growth disorders, inflammation, and immunity. Diseases, including but not limited to:

 Muscle disorders: Myotonia, myasthenia gravis, spinal muscular atrophy, muscular pseudohypertrophy, Ducheme muscular dystrophy, tonic muscular dystrophy, myasthenia, bradykinesia, dystonia

 Tumors of various tissues: gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, bladder cancer, uterine cancer, endometrial cancer, colon cancer, laryngeal cancer, trachea tumor

Embryonic disorders: congenital abortion, cleft palate, limb absentness, limb differentiation disorder, atrial septum Defects, neural tube defects, congenital hydrocephalus, congenital glaucoma or cataract, congenital hearing loss, growth and development disorders: skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects Disease, stunting, dwarfism, Cushing syndrome, sexual retardation

 Inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations

 Immune diseases: systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, common variable immunodeficiency disease, acquired immunodeficiency syndrome Abnormal expression of chloride channel protein 1 2 may also cause certain hereditary and hematological diseases.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used for the treatment of diseases, for example, it can treat various diseases, especially myotonia, other muscle diseases, various tumors, embryonic developmental disorders, growth Developmental disorders, inflammation, immune diseases, certain hereditary, blood diseases, etc. The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human chloride channel protein 1 2. Agonists enhance biological functions such as human chloride channel protein 1 2 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human chloride channel protein 1 2 can be cultured together with labeled human chloride channel protein 1 2 in the presence of a drug. The ability of the drug to increase or block this interaction is then measured.

 Antagonists of human chloride channel protein 1 2 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human chloride channel protein 1 2 can bind to human chloride channel protein 1 2 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.

When screening compounds as antagonists, human chloride channel protein 1 2 can be added to a bioanalytical assay to determine whether a compound is a compound by measuring the effect of the compound on the interaction between human chloride channel protein 1 2 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human chloride channel protein 1 2 may It is obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, 12 molecules of human chloride ion channel protein should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against human chloride ion channel protein 12 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.

Polyclonal antibodies can be produced by injecting human chloride ion protein 12 directly into immunized animals (such as home immunity, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. . Techniques for preparing monoclonal antibodies to human chloride channel protein 12 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV- Hybridoma technology, etc. Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). ₀ Existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against human chloride channel protein 12.

 Antibodies to human chloride channel protein 12 can be used in immunohistochemistry to detect human chloride channel protein 12 in biopsy specimens.

 Monoclonal antibodies that bind to human chloride channel protein 12 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human chloride channel protein 12 has a high affinity monoclonal antibody that can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human chloride channel protein 12 positive cells .

 The antibodies of the present invention can be used to treat or prevent diseases related to human chloride channel protein 12. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human chloride ion channel protein 12.

 The invention also relates to a diagnostic test method for the quantitative and localized detection of human chloride channel protein 12 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The levels of human chloride channel protein 12 detected in the test can be used to explain the importance of human chloride channel protein 12 in various diseases and to diagnose diseases in which human chloride channel protein 12 plays a role.

The polypeptides of the present invention can also be used for peptide mapping, for example, the polypeptides can be physically, chemically or enzymatically Specific cleavage and one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, preferably mass spectrometry.

 The polynucleotide encoding human chloride channel protein 12 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human chloride channel protein 12. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human chloride channel protein 12 to inhibit endogenous human chloride channel protein 12 activity. For example, a mutated human chloride channel protein 12 may be a shortened human chloride channel protein 12, which lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human chloride channel protein 12. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human chloride channel protein 12 into cells. Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human chloride channel protein 12 can be found in the existing literature (Sambrook, et al.). In addition, the recombinant polynucleotide encoding human chloride channel protein 12 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human chloride channel protein 12 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DM, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid phase phosphoramidite chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.

The polynucleotide encoding human chloride channel protein 12 can be used for the diagnosis of diseases related to human chloride channel protein 12. The polynucleotide encoding human chloride channel protein 12 can be used to detect the expression of human chloride channel protein 12 or the abnormal expression of human chloride channel protein 12 in a disease state. For example, the DNA sequence encoding human chloride channel protein 12 can be used to hybridize biopsy specimens to determine the expression of human chloride channel protein 12. Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These technical methods are all mature technologies that are publicly available. Related kits are available from commercial sources. Get. A part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray (Microarray) or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. RNA chloride polymerase chain reaction (RT-PCR) using human chloride channel protein 12 specific primers for in vitro amplification can also detect human chloride channel protein 12 transcription products.

 Detection of mutations in the human chloride channel protein 12 gene can also be used to diagnose human chloride channel protein 12-related diseases. Human chloride channel protein 12 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human chloride channel protein 12 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If at A mutation is observed in some or all of the affected individuals, and the mutation is not observed in any normal individuals, then the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for changes in scabs in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping) Resolving power and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human chloride channel protein 1 2 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human chloride channel protein 1 2 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Claim

1. An isolated polypeptide-human chloride channel protein 12, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID D0: 2, or an active fragment, analog, or derivative thereof.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: (a) encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, or an analog thereof; Polynucleotides of derivatives;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 587-928 in SEQ ID NO: 1 or the sequence of positions 1-2373 in SEQ ID NO: 1 .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human chloride channel protein 1 2 activity, characterized in that the method includes:

 (a) culturing the engineered host cell of claim 8 under the condition of expressing human chloride channel protein 12;

 (b) Isolation of peptides with human chloride channel protein 12 activity from culture

10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human chloride channel protein 1 2.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human chloride channel protein 12.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

13. The use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human chloride ion channel protein 12 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human chloride channel protein 12; or for peptides Fingerprint identification.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormality of human chloride channel protein 12.

18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.