WO2001064721A1 - A NOVEL POLYPEPTIDE-HUMAN ATPase 30 AND THE POLYNUCLEOTIDE ENCODING SAID POLYPEPTIDE - Google Patents

Abstract

The invention discloses a new kind of human ATPase 30 and the polynucleotide encoding said polypeptide and a process for producing the polypeptide by recombinant methods. It also discloses the method of applying the polypeptide for the treatment of various kins of diseases, such as Menkes diseaseoccipital horn syndrome, other neurodegeneration diseases, different kinds of cancer, embryogenesis disorder, dysgenopathy diseases, immune diseases, inflammation, hemopathy, HIV infection. The antagonist of the polypeptide and therapeutic use of the same are also disclosed. In addition, it refers to the use of polynucleotide encoding said human ATPase 30.

Description

 A new polypeptide-human adenosine triphosphatase 30 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, namely human adenosine triphosphatase 30, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide. Background technique

 P-type ATPases are a ubiquitous family of proteins that assist in the active transport of charged substances across the membrane. The most prominent feature of this family is the formation of a phosphorylated intermediate during the reaction, which is called p-type (phosphorylated). Different members of the P-type ATPase family have different substrate specificities and can transport K +, Na +, H +, Mg2 +, Ca2 +, Cu2 +, Cd2 +, and phospholipids. The role of these enzymes in transporting ions in animals is the basis for action potentials, kidney secretion and reabsorption, gastric acid secretion, intestinal nutrient absorption, muscle relaxation, and calcium-dependent signaling. [Biochim. Biophys. Acta (1998) 1365, 37-45]

 ATP7A is a member of the P-type ATPase family found in humans. Studies have found that this protein can bind to copper ions. Northern blot analysis found that the mRNA of this gene was found in many cell types and many tissues, but its expression was found to be low or absent in the liver. [Nat Genet 1993 Jan; 3 (1): 7-13]

 Mutations in ATP7A cause Menkes disease. This is an X-chromosome-linked copper transport disorder. Its symptoms are progressive neurodegeneration and premature dysentery. Monks' disease does not occur in the liver. This is consistent with the low or missing expression of the ATP7A gene in the liver. [Nat Genet 1993 Jan; 3 (1): 7-13]

 In addition, mutations in ATP7A can cause occipital horn syndrome (OHS), and cause "variable mutations" in mice. [Am. J. Hum. Genet. 56: 570-576] The analysis revealed that in the thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, and non-starved L02 cell line, the expression profile of the polypeptide of the present invention is similar to that of human The expression profile of adenosine triphosphatase is very similar, so the functions of the two may also be similar. The invention is named human adenosine triphosphatase 30.

As mentioned above, the human adenosine triphosphatase 30 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so the identification of more involved Processes the human adenosine triphosphatase 30 protein, specifically identifying the amino acid sequence of this protein. The isolation of the novel human adenosine triphosphatase 30 protein encoding gene has also been confirmed for the study. It provides a basis for determining the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic agents for disease 1 and it is therefore important to isolate its coding DNA. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human adenosine triphosphatase 30 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human adenosine triphosphatase 30.

 Another object of the invention is to provide a genetically engineered host cell containing a polynucleotide encoding human adenosine triphosphatase 30.

 Another object of the present invention is to provide a method for producing human adenosine triphosphatase 30.

 Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human adenosine triphosphatase 30.

 Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human adenosine triphosphatase 30.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormal human adenosine triphosphatase 30.

 The present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID D. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1172-1990 in SEQ ID NO: 1; and (b) a sequence having 1-2004 in SEQ ID NO: 1 Sequence of bits.

 The invention further relates to a vector, in particular an expression vector, containing a polynucleotide of the invention: a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

The invention also relates to a screened protein that mimics, activates, antagonizes or inhibits human adenosine triphosphatase 30 protein. A method of active compounds, which comprises utilizing a polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human adenosine triphosphatase 30 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the polypeptides and / or polynucleotides of the present invention prepared for the treatment of Monks' disease, occipital process syndrome, other neurodegenerative diseases, various tumors, embryonic developmental disorders, growth and development disorders Use of disease, inflammation, immune disease, blood disease, HIV infection or other diseases caused by abnormal expression of human adenosine triphosphatase 30.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated otherwise:

"Nucleic acid sequence" refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

"Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" means that natural, recombinant, or synthetic proteins and fragments thereof Ability to induce a specific immune response in a substance or cell and to bind to specific antibodies.

 An "agonist" refers to a molecule that, when combined with human adenosine triphosphatase 30, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human adenosine triphosphatase 30.

 An "antagonist" or "inhibitor" refers to a molecule that, when combined with human adenosine triphosphatase 30, can block or regulate the biological or immunological activity of human adenosine triphosphatase 30. Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates or any other component that binds human adenosine triphosphatase 30.

"Regulation" refers to a change in the function of human adenosine triphosphatase 30, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human adenosine triphosphatase 30 change.

 "Substantially pure '" means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human adenosine triphosphatase 30 using standard protein purification techniques. Basic The pure human adenosine triphosphatase 30 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the human adenosine triphosphatase 30 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Soiit heni print or Nor thern blot, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percentage of identity can be determined electronically, such as through the MEGALI GN program (La sergene s of tware package, DNASTAR, Inc., Mad Son Wis.). The MEGAL I GN program can be compared according to different methods such as the Cluster method. Two or more sequences (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The C l us ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues matching between sequence A and sequence x 100 Number of residues in sequence A-number of spacer residues in sequence A-number of spacer residues in sequence B

The percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as: Tot un He in (He in J., (1990) Me thod s in emzumo l ogy 18 3: 625 -645) ₀ "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') ₂ and Fv, which can specifically bind to the epitope of human adenosine triphosphatase 30.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

As used herein, "isolated human adenosine triphosphatase 30" means that human adenosine triphosphatase 30 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Person skilled in the art Human adenosine triphosphatase 30 can be purified using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reduced polypropanthamide gel. The purity of the human adenosine triphosphatase 30 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, human adenosine triphosphatase 30, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, or a particularly preferred recombinant polypeptide. The polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of human adenosine triphosphatase 30. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human adenosine triphosphatase 30 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (Π Ι) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence) as explained herein. Such fragments, 00 derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2004 bases, and its open reading frame 1 172-1990 encodes 272 amino acids: According to the comparison of gene chip expression profiles, it was found that this polypeptide has similar expression to human adenosine triphosphatase Spectrum, it can be deduced that the human adenosine triphosphatase 30 has a similar function to human adenosine triphosphatase.

The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used in the present invention, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention. The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences The hybridization occurs only when the identity between them is at least 95%, and more preferably 97%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 and Active.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human adenosine triphosphatase 30.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human adenosine triphosphatase 30 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or Phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al .. Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human adenosine triphosphatase 30 transcripts; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides-preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The gene itself or the fragment of the present invention can of course be used as a probe. The label of the DNA probe can be a radioisotope, luciferin, or an enzyme (such as alkaline phosphatase).

 In the method (4), immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human adenosine triphosphatase 30 gene.

 A method using PCR to amplify DNA / RNA (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467): Nucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human adenosine triphosphatase 30 coding sequence, and a recombinant technology for producing the polypeptide of the present invention. method.

In the present invention, a polynucleotide sequence encoding human adenosine triphosphatase 30 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, reverse transcription, as is well known in the art. Virus or other vector. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human adenosine triphosphatase 30 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding human adenosine triphosphatase 30 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as Fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, it can Competent cells that take up DNA can be harvested after the exponential growth phase and treated with the CaCl ₂ method. The steps used are well known in the art. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 The polynucleotide sequence of the present invention can be used to express or produce recombinant human adenosine triphosphatase 30 by conventional recombinant DNA technology (Scence, 1984; 224: 14 31). Generally there are the following steps:

(1) using the polynucleotide (or variant) encoding human human adenosine triphosphatase 30 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of gene chip expression profiles of human adenosine triphosphatase 30 and human adenosine triphosphatase of the present invention. The upper figure is a graph of the expression profile of human adenosine triphosphatase 30, and the lower sequence is the graph of the expression profile of human adenosine triphosphatase 30.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human adenosine triphosphatase 30. 30KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. Experimental methods without specific conditions indicated in the following examples The method is usually in accordance with conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.

 Example 1: Cloning of human adenosine triphosphatase 30

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Using Quik fflRNA Isolation Kit

(Qiegene product) Isolate poly (A) mRNA from total RNA. 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA cloning kit (purchased from Clontech) to insert the 00 ^ fragment into the multi-cloning site of pBSK (ten) vector (Clontech), transform DH5 cx, and form a CDM library with bacteria: Dye terminate cycle reaction sequencing The kit (Perkin-Elmer) and the ABI 377 automatic sequencer (Perkin-Elmer) determined the sequences at the 5 'and 3' ends of all clones. Comparing the determined cDNA sequence with the existing public DNA sequence database (Genebank), it was found that the cDNA sequence of one small clone 0093c 12 was new DNA. The inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers. The results showed that the full-length cDNA contained in the 0093cl2 clone was 2004bp (as shown in Seq IDN0: 1), and there was an 819bp open reading frame (0RF) from 1172bp to 1990bp, encoding a new protein (such as Seq ID NO: 2). We named this clone pBS-0093cl2 and the encoded protein was named human adenosine triphosphatase 30. Example 2: Cloning of a gene encoding human adenosine triphosphatase 30 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:

 Primer 1: 5'- CATGACACTAATTCTTATATAGAG -3 '(SEQ ID NO: 3)

 Primer2: 5,-CTGAGCAGAAAAATCTAAAAAGGC _3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

 Amplification conditions: 50 mmol / L KC1, 10 mmol ZL Tris-

Cl, (pH 8.5), 1.5 mmol / L MgCl ₂ , 200 μmol / L dNTP, 10pmoi primer, 1U Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min ₀ β-actin was set as a positive control at the same time during RT-PCR And template blank is negative control. The amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l-2004bp shown in SEQ ID NO: 1. Example 3: Northern blot analysis of human adenosine triphosphatase 30 gene expression: Total RNA was extracted by a one-shot method [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA- 2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation cx- ³² P dATP with ³² P- DNA probe labeled by the random primer method. The DNA probe used was the PCR amplified human adenosine triphosphatase 30 coding region sequence (1172bp to 1990bp) shown in FIG. 1. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH7.4)-5 x SSC-5 x Denhardt's solution and 200 μg / ml salmon sperm DNA. After hybridization, the filter was washed in 1><SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 4: In vitro expression, isolation and purification of recombinant human adenosine triphosphatase 30

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Primer3: 5,-CCCCATATGATGTTACAGGATGAATCTGGTTAT -3, (Seq ID No: 5) Primer4: 5'- CCCGAATTCCTAAAAAGGCTCTCCAAAATCTTG -3, (Seq ID No: 6) The 5 'ends of these two primers contain Ndel and EcoRI restriction sites, respectively. The coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively. The Ndel and EcoRI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site. The pBS-0093cl2 plasmid containing the full-length target gene was used as a template for the PCR reaction. The PCR reaction conditions were as follows: 10 pg of _P BS-0093cl2 plasmid, Primer-3, and Primer- 4 in a total volume of 50 μ1 [J is lOpmol, Advantage polymerase Mix (Clomech)) 1 μ1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into the colibacillus DH5 CX by the calcium chloride method. After being cultured on an LB plate containing kanamycin (final concentration 30 g / ml) overnight, positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0093C12) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In a LB liquid medium containing kanamycin (final concentration 30 μg / ml), the host bacteria BL21 (pET-0093cl2) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mol / L. Continue incubation for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidine (6His-Tag). The purified protein adenosine triphosphatase 30 was purified. through SDS-PAGE electrophoresis yielded a single band at 30 KDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of anti-human adenosine triphosphatase 30 antibody

 A peptide synthesizer (product of PE company) was used to synthesize the following human adenosine triphosphatase 30-specific peptides: NH2-Met-Leu-G ln-Asp-G l u-Ser-G l y-Tyr-Arg-Trp -Thr-Arg-Asp-Asp-H i s- C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6:43. Immunize the patient with 4 mg of the hemocyanin peptide complex and complete Freund's adjuvant. After 15 days, use the hemocyanin peptide complex and incomplete Freund's adjuvant to boost the immunity once. A 15 g / ml bovine serum albumin peptide complex-coated titer plate was used for ELI SA to determine antibody titers in rabbit serum. Protein A-Sepharose was used to isolate total IgG from antibody-positive home-immunized serum. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from total I gG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody specifically binds to human adenosine triphosphatase 30. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in pathological tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods. They all use the same stepwise hybridization after fixing the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; A needle is an oligonucleotide fragment that is partially identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;

 3. There should be no complementary regions inside the probe;

4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology if the homology with non-target molecular regions is greater than 85 »/. Or if more than 15 consecutive bases are identical, the primary probe should not be used in general;

5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'- TGTTACAGGATGAATCTGGTTATAGATGGACAAGAGACGAT -3 '(SEQ ID NO: 8) Probe 1 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:

 5'- TGTTACAGGATGAATCTGGTCATAGATGGACAAGAGACGAT -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods related to the following specific experimental procedures, please refer to the literature: PROBES GHKeller; MMManak; Stockton Press, 1989 (USA ) And more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the precipitate (approximately 10 ml / g λ 4) at 4 ° C with cold homogenization buffer (0.25mol / L sucrose; 25mmol / L Tris-HCl, pH7.5; 25mmol / LnaCl; 25mmol / L MgCl ₂ ) Use an electric homogenizer to homogenize the tissue suspension at full speed until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1 to 5 ml per 0.1 _{g of the} original tissue sample), and centrifuge at 1000 _g 10 minutes. 7) Resuspend the pellet in lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Steps: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1,000 g for 10 minutes. 2) Resuspend the pelleted cells (1 X 10 ⁸ cells / ml) with cold cell lysate and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 0) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DNA to a new tube. Purification of DM and ethanol precipitation were then performed.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the MA solution and mix well. At -20. C Leave for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Use 70 »/. Wash the pellet with cold ethanol 500ui and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, ¹⁰⁶ cells per 1-5 χ extracted plus about lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100 ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to final concentrations of 0.5% and 100 ug / ml, respectively. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 10 volumes of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well-20 ° C for 1 hour. 13) Wash the precipitate with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid, the process is the same as step 3-5. 14) Measure A ₂₆ . And A _2S . To detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing. Preparation of sample film:

1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number lightly with a pencil. Two NC membranes are needed for each probe for subsequent experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively. 2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Caught in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μ IProbe (0.10D / 10 μ 1), add 2 μ IKinase buffer, 8-10 uCi γ- ³² P- dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) After combining the collection solutions of the first peak, the ³² P-Probe (the second peak is free γ ³² P-dATP) is prepared.

 Pre-hybridization

 Put the sample film in a plastic bag, add 3-10 mg of pre-hybridization solution (10xDenhardfs; 6xSSC, 0.1mg / ral CT DNA (calf thymus DNA).), Seal the bag, and shake at 68 ° C for 2 hours in a water bath .

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 D Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 SDS, wash at 40 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, 40. C wash for 15 minutes (twice).

 4) 0.1xSSC, 0.1 ° /. Wash in SDS at 55 ° C for 30 minutes (twice) and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0, 1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) In 0.1xSSC, 0.1¾SDS, wash at 37 ° C for 1 minute (twice).

4) In 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice), and dry at room temperature. X-ray auto-development:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger. Radioactivity in another probe hybridization class. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1.

Example Ί DNA Microarray

 Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, refer to the literature DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And the literature Helle, RA, Schema, M ., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of different full-length cDNAs were prepared as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 μηι. The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic apparatus. After elution, the slides were fixed on a glass slide to prepare chips. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

6. Wash with 0.2% SDS for 1 minute; 7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (2) Probe marking

They were extracted from the body with a one-step mixing with body tissue specific tissue (or cell line after stimulation) total mRNA, and treated with Oligotex raRNA Midi Kit (available from QiaGen Inc.) purified mRNA, the other points ¹ J fluorescence by reverse transcription Reagent CySdUTP (5-Araino-propar gy 1-2 '-deoxyuri dine 5'-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino- Propargyl-2--deoxyuridine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe. For specific steps and methods, see:

Schena.

 M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614- 10619. Schena, M., Shalon, Dar i., Davis, RW (1995) Science.270. (20): 467-480. (3) Hybridization

 The probes from the two types of tissues and the chips were hybridized in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1> <SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray. The 3000 scanner (purchased from General Scanning Company, USA) was used for scanning. The scanned images were analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA- Ecv304 cell line, and non-starved L02 cell line. Draw a graph based on these 11 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profiles of human adenosine triphosphatase 30 and human adenosine triphosphatase according to the present invention are very similar. Industrial applicability

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases-for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections, and immune diseases.

Human P-ATPase is a ubiquitous family of proteins that helps charged substances to actively transport across the membrane, such as transporting K +, Na +, H +, Mg2 +, Ca2 +, Cu2 +, Cd2 +, and phospholipids. This effect is the basis for action potentials, kidney secretion and reabsorption, gastric acid secretion, intestinal nutrient absorption, muscle relaxation, and calcium-dependent signaling. ATP7A is a member of the P-type ATPase family. It is found in many cell types and many tissues, but its expression is found to be low or absent in the liver. Mutations in ATP7A cause Menke sdis eas e, an X-linked copper transport disorder. Its symptoms are progressive neurodegeneration and premature dysentery. In addition, ATP7A mutations can cause occipital process syndrome (occ ip ital horn syndrome, OHS).

 The expression profile of the polypeptide of the present invention is consistent with the expression profile of human ATP7A, and both have similar biological functions. It assists in the active transport of charged substances across the membrane in the body, and regulates physiological processes such as action potentials, kidney secretion and reabsorption, gastric acid secretion, intestinal nutrient absorption, muscle relaxation, and calcium-dependent signaling. Abnormalities will cause physiological disorders in the above tissues and cells, especially the degenerative function of nerve cells, and cause related diseases.

 It can be seen that the abnormal expression of the human adenosine triphosphatase 30 of the present invention will produce various diseases, especially Monks' disease, occipital process syndrome, other neurodegenerative diseases, various tumors, and embryonic developmental disorders. , Growth disorders, inflammation, immune diseases, these diseases include, but are not limited to: degenerative neurological diseases: Alzheimer's disease, Parkinson's disease, chorea, depression, amnesia, Huntington's disease, epilepsy Disease, migraine, dementia, multiple sclerosis

 Tumors of various tissues: stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma, embryonic developmental disorders Symptoms: Congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital hearing loss

 Growth and developmental disorders: mental retardation, brain developmental disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic deficiencies, dysentery, Clinic syndrome This sign, sexual retardation

 Inflammation: chronic active hepatitis, polymyositis, sarcoidosis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, various Infectious inflammation

 Immune diseases: myasthenia gravis, post-infection myocarditis, systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, scleroderma, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome

 Abnormal expression of the human adenosine triphosphatase 30 of the present invention will also cause certain hereditary, hematological diseases and the like.

The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, For example, it can treat various diseases, especially Monks' disease, occipital process syndrome, other neurodegenerative diseases, various tumors, embryonic disorders, growth disorders, inflammation, immune diseases, and some Hereditary, hematological diseases, etc. The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human adenosine triphosphatase 30. Agonists enhance biological functions such as human adenosine triphosphatase 30, which stimulates cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human adenosine triphosphatase 30 can be cultured together with labeled human adenosine triphosphatase 30 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human adenosine triphosphatase 30 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human adenosine triphosphatase 30 can bind to human adenosine triphosphatase 30 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.

 When screening compounds as antagonists, human adenosine triphosphatase 30 can be added to the bioanalytical assay to determine whether the compound is an Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human adenosine triphosphatase 30 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 30 molecules of human adenosine triphosphatase should be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against human adenosine triphosphatase 30 epitopes. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.

 Polyclonal antibodies can be produced by injecting human adenosine triphosphatase 30 directly into immunized animals (such as home immunity, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait. Techniques for preparing monoclonal antibodies to human adenosine triphosphatase 30 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc. Chimeric antibodies that combine human constant regions with non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human adenosine triphosphatase 30.

Anti-human adenosine triphosphatase 30 antibody can be used in immunohistochemistry for detection in biopsy specimens Of human adenosine triphosphatase 30.

 Monoclonal antibodies that bind to human adenosine triphosphatase 30 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. Human adenosine triphosphate

30 High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human adenosine triphosphatase 30 positive cell.

 The antibodies in the present invention can be used to treat or prevent diseases related to human adenosine triphosphatase 30. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human adenosine triphosphatase 30.

 The invention also relates to a diagnostic test method for quantitative and localized detection of human adenosine triphosphatase 30 levels. These tests are well known in the art and include FI SH assays and radioimmunoassays. The level of human adenosine triphosphatase 30 detected in the test can be used to explain the importance of human adenosine triphosphatase 30 in various diseases and to diagnose diseases in which human adenosine triphosphatase 30 functions.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 The polynucleotide encoding human adenosine triphosphatase 30 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human adenosine triphosphate 30. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human adenosine triphosphatase 30 to inhibit endogenous human adenosine triphosphatase 30 activity. For example, a variant human adenosine triphosphatase 30 may be a shortened human adenosine triphosphatase 30 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human adenosine triphosphatase 30. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer a polynucleotide encoding human adenosine triphosphatase 30 into cells. Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human adenosine triphosphatase 30 can be found in the existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human adenosine triphosphatase 30 can be packaged into liposomes and transferred into cells.

Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on. Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human adenosine triphosphatase 30 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding human adenosine triphosphatase 30 can be used for the diagnosis of diseases related to human adenosine triphosphatase 30. The polynucleotide encoding human adenosine triphosphatase 30 can be used to detect the expression of human adenosine triphosphatase 30 or abnormal expression of human adenosine triphosphatase 30 in a disease state. For example, a DNA sequence encoding human adenosine triphosphatase 30 can be used to hybridize biopsy specimens to determine the expression of human adenosine triphosphatase 30. Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genes in tissues diagnosis. Human adenosine triphosphatase 30 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human adenosine triphosphatase 30 transcripts.

 Detecting mutations in the human adenosine triphosphatase 30 gene can also be used to diagnose human adenosine triphosphatase 30-related diseases: Human adenosine triphosphatase 30 mutations include forms similar to normal wild-type human adenosine triphosphatase 30 DNA. Sequence comparison of point mutations, translocations, deletions, recombinations, and any other abnormalities. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nort Hern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

In short, the PCR primers (preferably 15-35 bp) are prepared according to cMA, which can locate the sequence on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments. PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in a single step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing diseased and diseased individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human adenosine triphosphatase 30 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human adenosine triphosphatase 30 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

 Right request book

I. An isolated polypeptide-human adenosine triphosphatase 30, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, further comprising a polypeptide having an amino acid sequence represented by SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: (a) encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, or an analog thereof; Polynucleotides of derivatives;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of said polynucleotide comprises the sequence of positions 1172-1990 in SEQ ID NO: 1 or the sequence of positions 1-2004 in SEQ ID NO: 1 .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is a host cell selected from the group consisting of:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human adenosine triphosphatase 30 activity, characterized in that the method comprises:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing human adenosine triphosphatase 30;

 (b) A polypeptide having human adenosine triphosphatase 30 activity is isolated from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human adenosine triphosphatase 30.

II. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they mimic, promote, A compound that antagonizes or inhibits the activity of human adenosine triphosphatase 30.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

 13. Use of a compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human adenosine triphosphatase 30 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of the polypeptide according to any one of claims 1 to 3, characterized in that it is used for screening a mimetic, agonist, antagonist or inhibitor of human adenosine triphosphatase 30; or Identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormal human adenosine triphosphatase 30.

 18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that the polypeptide, polynucleotide or compound is used for preparing a treatment such as a malignant tumor, Hematological diseases, HIV infection and immune diseases and various types of inflammation drugs.