WO2001075124A1 - Novel polypeptide -- a human regulatory transcript factor 9 and polynucleotide encoding it - Google Patents

Abstract

The invention concerns a human regulatory transcript factor 9 and polynucleotide encoding it. The invention also concerns the process of producing the polypeptide by recombinant DNA technique. The methods for treating many diseases e.g. malignant tumor, hemopathy, disorder of embryo development, infection of HIV, immunological diseases and a variety of inflammations etc. utilizing the polypeptide are disclosed. The invention discloses the antagonist against the polypeptide and therapeutics thereof. The invention also discloses the uses of the polynucleotide, which encodes a human regulatory transcript factor 9.

Description

 A new polypeptide one-on-one regulates transcription factor 9 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a human-regulated transcription factor 9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide. Background technique

 Pax is a family of genes. The proteins encoded by Pax genes play the role of transcription factors during cell differentiation and embryonic development, and such genes are highly conserved in spinal thrusters and lower organisms. The Pax gene is characterized by a paired box domain, which encodes a protein domain to help identify specific D sequences. The paired box domain has DNA binding activity and has an alpha helix at its amino terminus, which is of great significance for its binding to DNA. (Genes Dev 1991 Apr; 5 (4): 594-604)

 Existing studies have found that the paired box domain is composed of 124 amino acid residues and is found in many proteins in many organisms, including the mammalian PAX protein family. Although the function of the paired box functional domain is not clear at present, it is mostly located at the N-terminus of proteins such as PAX, which has extremely important regulatory significance for the normal function of PAX proteins.

 All paired box domains contain a conserved region that contains the following consistent sequence fragments: R-P-C-x (ll) -CV-S, which is found in PAX proteins in many different organisms Sequence fragment, this structural motif plays a very important role in the process of the protein's normal physiological function. For the specific structure of the paired box domain of the PAX protein and its chromosomal location, please refer to the related literature. (Nat Genet 1993 Apr; 3 (4): 292-8) PAX protein can bind to DNA, which depends on the paired box domain's DNA binding activity. Pax gene expression plays an important role in the development of organisms. Recent studies have also shown that Pax gene is also present in human tumor tissue, and experimental results in vivo and in vitro have demonstrated that Pax gene is a possible oncogene. (Adv Clin Path 1997 Oct; 1 (4): 243-255) Studies have also shown that Pax gene expression is extremely important for regulating the early formation of organisms. (Cancer Res 1999 Apr 1; 59 (7 Suppl): 1707s-1709s; discussion 1709s-1710s) In addition, studies have shown that PAX-3 and PAX-6 are related to the occurrence and treatment of Waardenburg's syndrome. (Nat Genet 1993 Apr; 3 (4): 292-8)

Gene chip analysis revealed that in the thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cells Strain, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetus In the brain, fetal lung, and fetal heart, the expression profile of the polypeptide of the present invention is very similar to the expression profile of human Pax protein 12, so their functions may also be similar. The invention is named human regulatory transcription factor 9.

 As mentioned above, the human regulatory transcription factor 9 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes. Human regulatory transcription factor 9 protein, especially the amino acid sequence of this protein is identified. Isolation of the genes encoding the transcription factor 9 protein by newcomers also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic agents for disease 1 and it is therefore important to isolate its coding DNA. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human-regulated transcription factor 9 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human regulatory transcription factor 9.

 Another object of the invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human regulatory transcription factor 9.

 Another object of the present invention is to provide a method for producing human regulatory transcription factor 9.

 Another object of the present invention is to provide an antibody against the polypeptide of the present invention, which regulates transcription factor 9 in humans.

 Another object of the present invention is to provide analog compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, which regulate transcription factor 9.

 Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities in regulating transcription factor 9 in humans.

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2; (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 488-763 in SEQ ID NO: 1; and (b) a sequence having 1-3769 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human regulating transcription factor 9 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of a human regulatory transcription factor 9 protein in vitro, comprising detecting a mutation in the polypeptide or a coding polynucleotide sequence thereof in a biological sample, or detecting a biological sample. The amount or biological activity of a polypeptide of the invention.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human transcription factor 9.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

 The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of Leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

 An "agonist" refers to a molecule that, when combined with human regulatory transcription factor 9, can cause changes in the protein and thereby regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human regulatory transcription factor 9.

 An "antagonist" or "inhibitor" refers to a molecule that, when combined with human regulatory transcription factor 9, can block or regulate the biological or immunological activity of human regulatory transcription factor 9. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human regulatory transcription factor 9.

 "Regulation" refers to a change in the function of human regulatory transcription factor 9, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immunological changes in human regulatory transcription factor 9.

 By "substantially pure" is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human regulatory transcription factors 9 using standard protein purification techniques. Essentially pure human regulatory transcription factor 9 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human regulatory transcription factor 9 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

"Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. Inhibition of such hybridization can be detected by performing hybridization (Southern blot or Nort hern blot, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require two sequences Columns are bound to each other as specific or selective interactions.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percentage identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). _{0 The} Cluster method arranges groups of sequences by checking the distance between all pairs. Into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A B is a spacer sequence of residues may be measured as Jotun Hein percent identity between nucleic acid sequences or by using Cluster method known in the art (Hein J., (1990) methods in emzumology 183: 625-645) 0 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to an intact antibody molecules and fragments thereof, such as _{Fa, F (a b ')} 2 and F _V, which specifically binds to human transcription factor 9 antigen determinants.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is in the same or all of the natural systems. Separation of matter that coexists with it is separation. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated human regulatory transcription factor 9" means that human regulatory transcription factor 9 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human regulatory transcription factors 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human regulatory transcription factor 9 polypeptide can be analyzed by amino acid sequence analysis.

 The present invention provides a novel polypeptide-to-human regulatory transcription factor 9, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of human regulatory transcription factor 9. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human regulatory transcription factor 9 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such One, wherein the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It packs The polynucleotide sequence is 3769 bases in length and its open reading frames 488-763 encode 91 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to human Pax protein 12, and it can be deduced that the human regulatory transcription factor 9 has a similar function to human Pax protein 12.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) A denaturant was added during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi co ll, 42. C, etc .; or (3) hybridization occurs only when the identity between the two sequences is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human regulatory transcription factor 9. The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human regulatory transcription factor 9 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The D fragment sequence of the present invention can also be obtained by the following methods: 1) separating a double-stranded DNA sequence from genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cD sequences. The standard method for isolating the cDM of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. Various methods have been developed for mRNA extraction, and kits are also commercially available (Qiagene :). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human transcripts that regulate transcription factor 9; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products that regulate human transcription factor 9 gene expression.

A method of amplifying DNA / RNA by PCR (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis. The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, a host cell produced by genetic engineering using the vector of the present invention or directly using a human regulatory transcription factor 9 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.

 In the present invention, a polynucleotide sequence encoding a human regulatory transcription factor 9 may be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human regulatory transcription factor 9 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the replication initiation point, polyoma enhancers and adenoviral enhancers on the late side of the replication initiation point.

In addition, the expression vector preferably contains one or more selectable marker genes to provide for selection The phenotypic traits of transformed host cells, such as dihydrofolate reductase, neomycin resistance and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding a human regulatory transcription factor 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l ₂ method used in steps well known in the art. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 By conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human regulatory transcription factor 9 (Scence, 1 984; 224: 14 31). Generally there are the following steps:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding human-human regulatory transcription factor 9 of the present invention, or a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

FIG. 1 is a comparison diagram of gene chip expression profiles of the inventors regulating transcription factor 9 and human Pax protein 12. FIG. The upper graph is a graph of the expression profile of human regulatory transcription factor 9, and the lower graph is the graph of the expression profile of human Pax protein 12. Among them, 1 indicates fetal kidney, 2 indicates fetal large intestine, 3 indicates fetal small intestine, 4 indicates fetal muscle, 5 indicates fetal brain, 6 indicates fetal bladder, 7 indicates non-starved L02, 8 indicates L02 +, lhr, As ³⁺ , and 9 indicates ECV304 PMA-, 10 means ECV304 PMA +, 11 means fetal liver, 12 means normal liver, 13 means thyroid, 14 means skin, 15 means fetal lung, 16 means lung, 17 means lung cancer, 18 means fetal spleen, 19 means spleen, 20 Indicates the prostate, 21 indicates the fetal heart, 22 indicates the heart, 23 indicates muscle, 24 indicates testes, 25 indicates fetal thymus, and 26 indicates thymus.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human regulatory transcription factor 9.

9kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

 Example 1: Cloning of human regulatory transcription factor 9

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. A Smart cDNA cloning kit (purchased from Clontech) was used to orient the 00 ^ fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5α, and the bacteria formed a cDNA library. Dye terminate cycle reaction sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0648e 02 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results showed that the full-length cDNA contained in the 0648e02 clone was 3769bp (as shown in Seq IDN0: 1), and there was a 275bp open reading frame (0RF) from 488bp to 763bp, encoding a new protein (such as Seq ID NO: 2). We named this clone pBS-0648e02, the encoded protein The name is human regulatory transcription factor 9. Example 2: Cloning of a gene encoding human regulatory transcription factor 9 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:

 Primerl: 5'- GTACAGCAGGTCCAAGGGAGGAGG-3 '(SEQ ID NO: 3)

 Primer2: 5'- CGACTCCCAAACTGGCAGAGATAG-3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

 Priraer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

 Amplification conditions: 50 mmol / L KC1, 10 mmol / L Tris- in a reaction volume of 50 μ1

CI, (pH 8.5), 1.5 mmol / L MgCl ₂ , 200 μmol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min. During RT-PCR, set β-act in as a positive control and template blank as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit. The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of l-3769bp shown in SEQ ID NO: 1. Example 3: Northern blot analysis of the expression of human regulatory transcription factor 9 gene:

Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH: 4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added. ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ^{32 Ρ-} DNA probe labeled with ot- ³² P dATP by random priming method. The DNA probe used was the PCR amplified human regulatory transcription factor 9 coding region sequence (488bp to 763bp) shown in FIG. 1. A 32P-labeled probe (approximately 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H ₂ P0 ₄ (pH 7.4) -5 x SSC-5 x Denhardt's solution and 200 μg / ml salmon sperm DNA. After hybridization, the filter was placed at lx SSC-0.1 ° /. Wash in SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 4: In vitro expression, isolation and purification of recombinant human regulatory transcription factor 9 According to SEQ ID NO: 1 and the coding region sequence shown in FIG. 1, a pair of specific amplification primers is designed, and the sequences are as follows:

Primer3: 5, -CATGCTAGCATGATTTTCCTTTCTTTCCAATCT- 3, (Seq ID No: 5) Primer4: 5'-CATGGATCCTTAAGCAGCATAAGTTCCACAAGA-3 '(Seq ID No: 6) These two primers contain Ndel and BamHI restriction sites, respectively. The coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively. The Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site. The pBS-0648e02 plasmid containing the full-length target gene was used as a template for the PCR reaction. The PCR reaction conditions were as follows: 10 pg of _P BS-0648e02 plasmid, primers Primer-3 and Primer-4 in a total volume of 50 μ1; lOpmol, Advantage polymerase Mix (Clontech) 1 μ1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on an LB plate containing kanamycin (final concentration 30 g / ml), positive clones were selected by colony PCR and sequenced. A positive clone (pET-0648e02) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In LB liquid medium containing kanamycin (final concentration 30 g / ml), the host bacteria BL21 (pET-0648e02) was cultured at 37 ° C to logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L. , Continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidines (6His-Tag). Purified the target protein human regulatory transcription factor 9. After SDS-PAGE electrophoresis, a single band was obtained at 9 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of anti-human regulatory transcription factor 9 antibodies

 The following peptides specific for human regulatory transcription factor 9 were synthesized using a peptide synthesizer (product of PE):

NH2-Met-Ile-Phe-Leu-Ser-Phe-Gln-Ser-His-Leu-Gln-Pro-Leu-Tyr-Phe-C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For the method, see: Avrameas, et al. I Jean Unochemi Stry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column and Anti-peptide antibodies were isolated from total I gG by chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human regulatory transcription factor 9. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2.The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

3. There should be no complementary regions inside the probe;

4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements Region for homology comparison, if the homology with non-target molecular region is greater than 85% After 15 consecutive bases are identical, the primary probe should not be used in general;

5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'-TGATTTTCCTTTCTTTCCAATCTCACCTTCAGCCACTTTAC-3 '(SEQ ID NO: 8)

 Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):

 5'- TGATTTTCCTTTCTTTCCAACCTCACCTTCAGCCACTTTAC-3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not listed in the following specific experimental steps, please refer to the literature: DM PROBES GH Keller; MMManak; Stockton Press, 19890JSA) and More commonly used manuals of molecular cloning experiments such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambruck et al., Science Press.

 Sample Preparation:

1. Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the precipitate (about 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mmol / LnaCl; 25 mmol / L MgCl ₂ ). 4) at 4. C Homogenize the tissue suspension at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1 to 5 ml per 0.1 g of the original tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add lnil per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, phenol extraction method for DNA

Steps: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1,000 g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (lxl ° 8 cells / ml) and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 1 ^β 7 cells. 4) Add protease K to a final concentration of 200 ug / ml. ) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. Purification of D was followed by ethanol precipitation.

3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DM solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, every 1- 5 χ 10 ⁶ cells extracted about plus lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DM solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase, re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1), and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, force P 1/10 volume 2mol / L sodium acetate and 2.5 volume cold ethanol, mix well and let stand at -20 ° C for 1 hour. 13) Wash the precipitate with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-5. 14) Determine A ₂₆ . And A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20 ° (after packaging). Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number lightly with a pencil. Two NC membranes are required for each probe, so that it can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH and 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.1 IOD / Ιθμ 1), add 2 μ IKinase buffer, 8-10 uCi γ- ³² P- dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

3) Add 1/5 volume of bromophenol blue indicator (BPB 4) Pass through a Sephadex G-50 column.

5) Start to collect the first peak before ³² P-Probe washes out (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) The combined solution after the first peak was collected as ³² P-Probe (second peak to prepare the desired free γ- ³² Ρ- dATP).

 Pre-hybridization

 Put the sample film in a plastic bag, add 3-10 mg of pre-hybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).), Seal the bag, and shake at 68 ° C for 2 hours in a water bath .

 Cross

Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ^Q C in water overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 55 ° C for 30 minutes (twice), and dry at room temperature.

 Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

 X-ray auto-development:

 -70. C, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

 Experimental results:

 的 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger To the radioactive intensity of the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Microarray

Gene microarrays or DNA microarrays are currently used in many national laboratories and pharmaceutical companies. The companies are starting to develop and develop a new technology. It refers to arranging a large number of target gene fragments in an orderly and high density on a carrier such as glass and silicon, and then using fluorescence detection and computer software to compare and analyze the data. In order to achieve the purpose of fast, efficient and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, refer to the literature DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Sc ience 278, 680-686. And the literature Hel le, RA, Schema , M., Cha i, A., Sha lom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification. The spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μ ηι. The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Ki t (purchased from QiaGen). Cy3dUTP (5-Amino-propargyl-2--deoxyur idine 5 '-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino-propargy) was used. 2'-deoxyur idine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification. For specific steps and methods, see: Schena,

 M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614- 10619. Schena, M., Shalon, Dari., Davis, RW (1995) Science .270. (20): 467-480. (3) Hybridization

 Combine the probes from the two tissues with the chips in UniHyb ™ Hybridization

Solution (purchased from TeleChem) was used for hybridization for 16 hours, and washed with a washing solution (lx SSC, 0.2 SDS) at room temperature, and then scanned with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images were imagene The software (Biodiscovery, USA) performs data analysis and calculation, and calculates the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart. Draw a graph based on these 26 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profiles of human regulatory transcription factor 9 and human Pax protein 12 according to the present invention are very similar. Industrial applicability

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.

 Pax is a family of genes. The proteins encoded by Pax genes act as transcription factors during cell differentiation and embryonic development. The specific paired box domains on Pax genes encode a protein domain that helps identify specific DNA sequences . Paired box domains are found in many proteins in many organisms, mainly in the PAX protein family in mammals.

 Pax gene expression plays an important role in the development of organisms. Recent studies have also shown that Pax gene is still present in human tumor tissue, and experimental results in vivo and in vitro have proved that Pax gene is a possible oncogene. (Adv Clin Path 1997 Oct; 1 (4): 243-255). Studies have also shown that Pax gene expression is extremely important for regulating the early formation of organs in organisms. (Cancer Res 1999 Apr 1; 59 (7 Suppl): 1707s- 1710s). In addition, studies have shown that PAX-3 and PAX-6 are related to the occurrence and treatment of Waardenburg's syndrome. (Nat Genet 1993 Apr; 3 (4): 292-8)

Therefore, abnormal expression of a polypeptide containing a pair of box domain sequences will make the Pax protein family functionally different Often, it can cause embryonic developmental disorders, growth disorders, tumors, and Waardenburg syndrome.

 It can be seen that the abnormal expression of the human-regulated transcription factor 9 of the present invention will produce various diseases, especially Waardenburg syndrome, embryonic developmental disorders, growth disorders, and tumors. These diseases include, but are not limited to:

 Fetal developmental disorders: congenital abortion, cleft palate, facial oblique fissure, limb absentness, limb differentiation disorder, gastrointestinal atresia or stenosis, hyaline membrane disease, pulmonary insufficiency, polycystic kidney disease, ectopic kidney, double ureter, crypto, Congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract , Congenital glaucoma or cataract, congenital deafness

 Tumors of various tissues: gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon Cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, pleural mesothelioma, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma

 Growth and development disorders: mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation

 Abnormal expression of the human-regulated transcription factor 9 of the present invention will also produce certain hereditary, hematological and immune system diseases.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human regulatory transcription factor 9. Agonists increase human regulatory transcription factor 9 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or a membrane preparation expressing human regulatory transcription factor 9 can be cultured with a labeled human regulatory transcription factor 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human regulatory transcription factor 9 include antibodies, compounds, receptor deletions and analogs that have been screened. Antagonists of human regulatory transcription factor 9 can bind to human regulatory transcription factor 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

When screening compounds as antagonists, human regulatory transcription factor 9 can be added to bioanalytical assays Determine whether a compound is an antagonist by measuring its effect on the interaction between human regulatory transcription factor 9 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human regulatory transcription factor 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, human regulatory transcription factor 9 molecules should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against human regulatory transcription factor 9 epitopes. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.

The production of polyclonal antibodies can be obtained by direct injection of human regulatory transcription factor 9 into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. . Techniques for preparing monoclonal antibodies that regulate human transcription factor 9 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cells Hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morri et al, PNAS, 1985, 81: 6851). ₀ Existing techniques for producing single-chain antibodies (US Pa t No. 4946778) can also be used to produce single chain antibodies against human regulatory transcription factor 9.

 Anti-human regulatory transcription factor 9 antibodies can be used in immunohistochemical techniques to detect human regulatory transcription factor 9 in biopsy specimens.

 Monoclonal antibodies that bind to human regulatory transcription factor 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human monoclonal antibodies that regulate transcription factor 9 have high affinity and can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through exchange of disulfide bonds. This hybrid antibody can be used to kill human regulatory factor 9 positive cells.

 The antibodies in the present invention can be used to treat or prevent diseases related to human regulatory transcription factor 9. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human regulatory transcription factor 9.

The invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human regulatory transcription factor 9. These tests are well known in the art and include FI SH assays and radioimmunoassays. Tested during the test Human regulatory transcription factor 9 levels can be used to explain the importance of human regulatory transcription factor 9 in various diseases and to diagnose diseases in which human regulatory transcription factor 9 plays a role.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 Polynucleotides encoding human regulatory transcription factor 9 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the absence or abnormal / inactive expression of human regulatory transcription factor 9. Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human regulatory transcription factor 9 to inhibit endogenous human regulatory transcription factor 9 activity. For example, a variant human regulatory transcription factor 9 may be a shortened human regulatory transcription factor 9 lacking a signaling domain, which, although binding to downstream substrates, lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal regulation of transcription factor 9 expression or activity in humans. Expression vectors derived from viruses such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding human regulatory transcription factor 9 into cells. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a human regulatory transcription factor 9 can be found in the existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human regulatory transcription factor 9 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human transcription factor 9 mRNA regulation are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.

The polynucleotide encoding human regulatory transcription factor 9 can be used for the diagnosis of diseases related to human regulatory transcription factor 9. Polynucleotides encoding human regulatory transcription factor 9 can be used to detect the expression of human regulatory transcription factor 9 or the abnormal expression of human regulatory transcription factor 9 in disease states. Human regulatory transcription factor The DNA sequence of 9 can be used to hybridize biopsy specimens to determine the expression of human regulatory transcription factor 9. Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissue. Human-regulated transcription factor 9 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect the transcription products of human-regulated transcription factor 9.

 Detection of mutations in the human regulatory transcription factor 9 gene can also be used to diagnose human regulatory transcription factor 9-related diseases. Human regulatory transcription factor 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human regulatory transcription factor 9 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available through contact with Johns Hopkins University Welch Medical L i brary online). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cD sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human regulatory transcription factor 9 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human regulatory transcription factor 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Claim

1. An isolated polypeptide-human regulatory transcription factor 9, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, further comprising a polypeptide having an amino acid sequence represented by SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: (a) encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, or an analog thereof; Polynucleotides of derivatives;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence at positions 488 to 763 in SEQ ID NO: 1 or a sequence at positions 1-3769 in SEQ ID NO: 1. .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human regulatory transcription factor 9 activity, characterized in that the method includes:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing human regulatory transcription factor 9;

 (b) Isolating a polypeptide having human regulatory transcription factor 9 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human regulatory transcription factor 9.

1 1. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human regulatory transcription factor 9.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

1 3. A use of the compound according to claim 11, characterized in that the compound is used for regulating a method of regulating the activity of human transcription factor 9 in vitro and in vivo.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of the polypeptide according to any one of claims 1 to 3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human regulatory transcription factor 9; or for peptide fingerprinting Atlas identification.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormal regulation of transcription factor 9 in humans.

18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that the polypeptide, polynucleotide or compound is used for preparing a treatment such as a malignant tumor, Hematology, H IV infection and immune diseases and various types of inflammation drugs.

Sequence table

 (1) General information:

 (ii) Title of Invention: Human regulatory transcription factor 9 and its coding sequence

 (iii) Number of sequences: 9

(2) Information of SEQ ID NO: 1:

 (i) Sequence characteristics:

 (A) Length: 3769bp

 (B) Type: Nucleic acid

 (C) Chain: double strand

 (D) Topological structure: linear

 (ii) Molecular type: cDNA

 (xi) Sequence description: SEQ ID NO: 1:

301 GTGCATACGCCCTGGAGCTGCACAGCTGTGTTTGGCTTCAGCTTTGTACGCATCTGTCTA 361 TGTGACCCTTTTGACCTCTTGGAGCCCTGGTTTTCATGCCTGTAAGATATGGCTTACAGG

V0IV0010000V0I0V0D0VV310091D00V01V33D00100VV3VV00VDI10101I10 ΐΟΟ £

I0IV0III0101VV000VV0VV133390VVV30V0VI330DVV0D30VV000VV300V3 ΐ Z

0IVVIVD1101D911I001D1IV1I3V010VVVVI0VII0ID00VVI01I03VVVV3VI0 1081

CCOO / TON3 / X3d 3121

3181

 3241 GAAAGCATAGTAGGAGGCCTGTTAGCACAGCGAGCCCCAACCTTTTTGGCACCAGGGTAC

 3721 AGCCCCCAGATAGCTTGACTCCAATCTATCTCTGCCAGTTTGGGAGTCG

(3) Information of SEQ ID NO: 2:

 (i) Sequence characteristics:

 (A) Length: 91 amino acids

 (B) Type: Amino acid

 (D) Topology linear

 (Π) Molecular type Peptide

 (xi) Sequence description SEQ ID NO: 2:

 Met lie Phe Leu Ser Phe Gin Ser His Leu Gin Pro Leu Tyr Phe Arg Val Leu Pro Gly His Tyr lie Thr Lys Thr Val Cys Phe Leu Ser Leu Ser Phe Ser Gly Gly Leu Tyr Leu Pro Leu Cys Pro Gly Asn Pro Thr lie Thr Ser Arg Ser Gly Pro Ser Lys Gly Val Pro Gin Ser Pro Thr Ala Pro Met Pro Lys Ser Thr Leu Met Lys Ser lie Leu Pro lie Asn Asp Asp lie Ser Cys Gly Thr Tyr Ala Ala

(4) Information of SEQ ID NO: 3

 (i) Sequence characteristics

 (A) Length: 24 bases

(B) Type: Nucleic acid (c) Chain property: single chain

 (D) Topological structure: linear

 (Π) Molecular type: Oligonucleotide

 (x i) Sequence description: SEQ ID NO: 3: GTACAGCAGGTCCAAGGGAGGAGG

(5) Information of SEQ ID NO: 4

 (i) Sequence characteristics

 (A) Length: 24 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (Π) Molecular type: Oligonucleotide

 (x i) Sequence description: SEQ ID NO: 4: CGACTCCCAAACTGGCAGAGATAG

(6) Information of SEQ ID NO: 5

 (i) Sequence characteristics

 (A) Length: 33 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (Π) Molecular type: Oligonucleotide

 (x i) Sequence description: SEQ ID NO: 5:

CATGCTAGCATGATTTTCCTTTCTTTCCAATCT

(7) Information of SEQ ID NO: 6

 (i) Sequence characteristics

 (A) Length: 33 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

(D) Topological structure: linear

s OsoAVϋυ / υ 8ζ1¾

S