WO2001081535A2 - A novel polypeptide, a human pax protein 9.9 and the polynucleotide encoding the polypeptide - Google Patents
A novel polypeptide, a human pax protein 9.9 and the polynucleotide encoding the polypeptide Download PDFInfo
- Publication number
- WO2001081535A2 WO2001081535A2 PCT/CN2001/000595 CN0100595W WO0181535A2 WO 2001081535 A2 WO2001081535 A2 WO 2001081535A2 CN 0100595 W CN0100595 W CN 0100595W WO 0181535 A2 WO0181535 A2 WO 0181535A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- pax protein
- human pax
- protein
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/82—Translation products from oncogenes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human Pax protein 9.9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide. Background technique
- Pax is a family of genes.
- the proteins encoded by Pax genes play the role of transcription factors during cell differentiation and embryonic development, and such genes are highly conserved in spinal thrusters and lower organisms.
- the Pax gene is characterized by a paired box domain (Paired Box domain), which encodes a protein domain to help identify specific DM sequences.
- the paired box domain has DNA binding activity and has an alpha helix at its amino terminus, which is of great significance for its binding to DNA. (Genes Dev 1991 Apr; 5 (4): 594-604)
- the paired box domain is composed of 124 amino acid residues and is found in many proteins in many organisms, including the mammalian PAX protein family. Although the function of the paired box functional domain is not clear at present, it is mostly located at the N-terminus of proteins such as PAX, which has extremely important regulatory significance for the normal function of PAX proteins.
- All paired box domains contain a conserved region that contains the following consistent sequence fragments: R- P- C- x (ll)-C- V- S, which are contained in PAX proteins in many different organisms This sequence fragment, this structural motif plays a very important role in the process of the protein's normal physiological function.
- PAX protein can bind to DNA, which depends on the paired box domain's DNA binding activity. Pax gene expression plays an important role in the development of organisms.
- Pax gene is also present in human tumor tissue, and experimental results in vivo and in vitro have demonstrated that Pax gene is a possible oncogene.
- PAX-3 and PAX-6 are related to the occurrence and treatment of Waardenburg's syndrome.
- the human Pax protein 9.9 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more involved in these processes
- the human Pax protein 9.9 protein, especially the amino acid sequence of this protein is identified. Isolation of the new Pax protein 9.9 gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human Pax protein 9.9.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human Pax protein 9.9.
- Another object of the present invention is to provide a method for producing human Pax protein 9.9.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human Pax protein 9.9.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human Pa) (protein 9.9).
- Another object of the present invention is to provide a method for diagnosing and treating a disease associated with a human Pax protein 9.9 abnormality.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- polynucleotide complementary to polynucleotide (a);
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human Pax protein 9.9 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human Pa) (protein 9.9 protein), comprising detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
- human Pa protein 9.9 protein
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease, or other diseases caused by abnormal expression of human Pax protein 9.9.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with human Pax protein 9.9, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human Pax protein 9.9.
- Antagonist refers to a molecule that, when combined with human Pax protein 9.9, can block or regulate the biological or immunological activity of human Pax protein 9.9.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human Pax protein 9.9.
- Regular refers to a change in the function of human Pax protein 9.9, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human Pax protein 9.9. .
- substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human Pax protein 9.9 using standard protein purification techniques.
- the substantially pure human Pax protein 9.9 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of the human Pax protein 9.9 peptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Perfect identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
- the MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P.M. Sharp (1988) Gene 73: 237-244).
- the Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
- the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence B
- the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Cluster method or using methods known in the art such as Jotun He in. J., (1990) Methods in emzumology 183: 625-645) "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- negatively charged amino acids can include aspartic acid and glutamic acid; positively charged amino acids can include lysine and arginine; amino acids with similarly hydrophilic head groups that have no charge can Including leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 15 ') 2 and 1 ⁇ , which can specifically bind to the epitope of human Pax protein 9.9.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a vector, It is also possible that such a polynucleotide or polypeptide is part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human Pax protein 9.9 means that human Pax protein 9.9 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human Pax protein 9.9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human Pa x protein 9.9 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human Pax protein 9. 9, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives, and analogs of human Pax protein 9.9.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human Pax protein 9.9 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (in) such One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 744 bases in length and its open reading frames 354-629 encode 91 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to human Pa x protein 12 It can be concluded that the human Pax protein 9.9 has a similar function to human Pax protein 12.
- the polynucleotide of the present invention may be in the form of DM or RNA.
- DNA forms include cDNA, genomic DM, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization L% Ficoll, 42 with a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1%.
- hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human Pax protein 9.9.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human Pax protein 9.9 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sambrook, et al.,
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of the human Pax protein 9.9 transcript; (4) passing Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by human Pa) (protein 9.9 gene).
- the RACE method RACE-rapid cDNA end rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human Pax protein 9.9 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
- a polynucleotide sequence encoding a human Pax protein 9.9 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human Pax protein 9.9 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, floating synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP Fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human Pax protein 9.9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as insect cells such as Fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote, such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human Pax protein 9.9 (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
- FIG. 1 is a comparison chart of gene chip expression profiles of human Pax protein 9.9 and human Pax protein 12 of the present invention.
- the upper graph is a graph of the expression profile of human Pa (protein 9.9, and the lower graph is the graph of expression profile of human Pax protein 12.
- 1 represents the fetal kidney
- 2 represents the fetal large intestine
- 3 represents the fetal small intestine
- 4 represents fetal muscle.
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates non-starved L02
- 8 indicates L02 +
- lhr As 3+
- 9 indicates ECV304 PMA +
- 10 indicates ECV304 PMA +
- 11 indicates fetal liver
- 12 indicates normal liver
- 13 indicates Thyroid
- 14 for skin, 15 for fetal lung, 16 for lung, 17 for lung cancer, 18 for fetal spleen, 19 for spleen, 20 for prostate, 21 for fetal heart, 22 for heart, 23 for muscle, 24 for testis, 25
- Indicates fetal thymus 26 indicates thymus.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human Pax protein 9.9.
- lOkDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from ontech). The 0 ⁇ fragment was inserted into the multiple cloning site of the pBSK (+) vector (Clontech), and transformed into DH5 ⁇ . The bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0429e02 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
- Primer2 5,-AGGCAGGATAATGGCCCCCAAGAT- 3, (SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 ⁇ l reaction volume containing 50 ol / L C1, 10ramol / L Tris-Cl, (pH8.5), 1.5mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer , 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
- ⁇ -act in was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen). DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-744bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human Pax protein 9.9 gene expression:
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (H7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
- the DNA probe used was the PCR amplified human Pax protein 9.9 coding region sequence (354bp to 629bp) shown in FIG. 1.
- a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) and an RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C overnight hybridization, the solution containing 50% formamide - 25raM ⁇ 2 ⁇ 0 4 ( ⁇ 7.4 ) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filters were placed in 1 x SSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human Pax protein 9.9
- a pair of specific amplification primers was designed, and the sequences are as follows: Primer3: 5, — CCCCATATGATGGTGACTACACAAAACCTCAGG— 3, (Seq ID No: 5) Primer 4: 5,-CCCGAGCTCTTAAAGCTTGAGAGCCTTTCCTGC-3, (Seq ID No: 6)
- the 5 ′ ends of these two primers contain Ndel and Sacl restriction sites, respectively.
- the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
- the Ndel and Sacl restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat.
- the PCR reaction was performed using the pBS-0429e02 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of plasmid pBS-0429e02, primer Primer-3, and? ! ⁇ ! ! ⁇ -Douban points are ⁇ Advantage, Advantage polymerase Mix (Clontech) 1 ⁇ 1.
- Ndel and Sacl were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into coliform bacteria DH5 CC using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0429e02) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- the host bacteria BL21 (pET-0429e02) was cultured at 37 ° C to the logarithmic growth phase, IPTG was added to a final concentration of 1mmol / L, and the culture was continued. 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidines (6His-Tag). The purified human protein Pax protein 9.9 was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 10 kDa ( Figure 2).
- a peptide synthesizer (product of PE company) was used to synthesize the following human Pax protein 9.9-specific peptides:
- NH2-Met-Val-Thr-Thr-Gln-Asn-Leu-Arg-Leu-Thr-Ile-Val-Glu-Val-Arg-C00H SEQ ID NO: 7
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et a 1. Immunochemi stry, 1969; 6: 43. Rabbits were immunized with 4 mg of the above-mentioned cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.
- a titer plate coated with 15 ⁇ g / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum.
- Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
- the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
- the immunoprecipitation method proved that the purified antibody could specifically bind to human Pax protein 9.9.
- Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Sou thern imprinting, Northern blotting, and copying methods, etc., all of which are used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention;
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- the preferred range of probe size is 1 8-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when the GC content is exceeded;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared after the collection solutions of the first peak are combined.
- the sample membrane was placed in a plastic bag, and 3- 10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml) was added.
- CT DNA (calf thymus DNA).
- Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as Targeting DNA for gene chip technology for high-throughput research on new gene functions; finding and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases.
- the specific method steps have been reported in the literature. For example, see DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And Helle, RA, Schema, M. Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ ! . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP 5— Amino— propargy Bu 2′— deoxyuridine 5′— triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech Company) labeled niRNA of human mixed tissue
- fluorescent reagent Cy5dUTP 5- Amino- propargy Bu 2'- deoxyuridine 5 --tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
- Probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
- Scanner purchased from General Scanning Company, USA
- the scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
- polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
- Pax is a family of genes.
- the proteins encoded by Pax genes act as transcription factors during cell differentiation and embryonic development.
- the specific paired box domains on Pax genes encode a protein domain that helps identify specific DNA sequences. . Paired box domains are found in many proteins in many organisms, mainly in the PAX protein family in mammals.
- Pax gene expression plays an important role in the development of organisms. Recent studies have also shown that Pax gene is still present in human tumor tissue, and experimental results in vivo and in vitro have proved that Pax gene is a possible oncogene. (Adv Clin Path 1997 Oct; 1 (4): 243-255). Studies have also shown that Pax gene expression is extremely important for regulating the early formation of organs in organisms. (Cancer Res 1999 Apr 1; 59 (7 Suppl): 1707s- 1710s). In addition, studies have shown that PAX-3 and PAX-6 are related to the occurrence and treatment of Waardenburg's syndrome. (Nat Genet 1993
- abnormal expression of a polypeptide containing a pair of box domain sequences will cause abnormal function of the Pax protein family, and may cause embryonic developmental disorders, growth disorders, tumors, and Waardenburg syndrome.
- the abnormal expression of the human Pax protein 9.9 of the present invention will cause various diseases, especially Waa rdenburg syndrome, embryonic disorders, growth disorders, tumors, these diseases include but are not limited to:
- Fetal developmental disorders congenital abortion, cleft palate, facial oblique fissure, limb absentness, limb differentiation disorder, gastrointestinal atresia or stenosis, hyaline membrane disease, pulmonary insufficiency, polycystic kidney disease, ectopic kidney, double ureter, crypto, Congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract , Congenital glaucoma or cataract, congenital deafness
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon Cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, pleural mesothelioma, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebellar dysplasia, strabismus, skin, fat and muscular dysplasia such as congenital skin sagging, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
- the abnormal expression of the human Pa) (protein 9.9) of the present invention will also cause certain hereditary, hematological and immune system diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human Pax protein 9.9.
- Agonists enhance human Pax protein 9.9 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or a membrane preparation expressing human Pax protein 9.9 can be cultured with labeled human Pax protein 9.9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human Pa x protein 9.9 include antibodies, compounds, receptor deletions and analogs that have been screened.
- the antagonist of human Pax protein 9.9 can bind to human Pax protein 9.9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
- human Pax protein 9.9 When screening compounds as antagonists, human Pax protein 9.9 can be added to a bioanalytical assay to determine whether the compound is antagonistic by measuring the effect of the compound on the interaction between human Pax protein 9.9 and its receptor. Agent. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human Pa x protein 9.9 can be selected from each by screening A possible combination of amino acids was obtained by binding to a random peptide library composed of a solid phase. In screening, the human Pax protein 9.9 molecule should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the human Pax protein 9.9 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human Pax protein 9.9 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies against human Pax protein 9.9 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridoma Technology, etc.
- Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0
- Existing techniques for producing single-chain antibodies US Pat No. .4946778) can also be used to produce single chain antibodies against human Pax protein 9.9.
- Antibodies against human Pax protein 9.9 can be used in immunohistochemistry to detect human Pax protein 9.9 in biopsy specimens.
- Monoclonal antibodies that bind to human Pax protein 9.9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human Pax protein 9.9 high affinity monoclonal antibody can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human Pax protein 9.9 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to human Pax protein 9.9. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human Pax protein 9.9.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human Pax protein 9.9 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human Pax protein 9.9 detected in the test can be used to explain the importance of human Pax protein 9.9 in various diseases and to diagnose diseases in which human Pax protein 9.9 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis. Analysis.
- the polynucleotide encoding human Pax protein 9.9 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human Pax protein 9.9.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human Pax protein 9.9 to inhibit endogenous human Pax protein 9.9 activity.
- a mutated human Pax protein 9.9 may be a shortened human Pax protein 9.9 lacking a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human Pax protein 9.9.
- Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding human Pax protein 9.9 into cells.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding the human Pax protein 9.9 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human Pax protein 9.9 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human Pax protein 9.9 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
- This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
- the polynucleotide encoding human Pax protein 9.9 can be used for the diagnosis of diseases related to human Pax protein 9.9.
- the polynucleotide encoding human Pax protein 9.9 can be used to detect the expression of human Pax protein 9.9 or the abnormal expression of human Pax protein 9.9 in a disease state.
- the DNA sequence encoding human Pax protein 9.9 can be used to hybridize biopsy specimens to determine the expression of human Pax protein 9.9.
- Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human Pax protein 9.9 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the human Pax protein 9.9 transcription product Thing.
- Human Pax protein 9.9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human Pax protein 9.9 DNA sequence. Mutations can be detected using existing techniques such as Southern imprinting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian
- Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, The cDNA of the disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution and one gene per 20 kb).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human Pax protein 9.9 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human Pax protein 9.9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Oncology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU73798/01A AU7379801A (en) | 2000-04-27 | 2001-04-23 | A novel polypeptide, a human pax protein 9.9 and the polynucleotide encoding thepolypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115464 CN1320624A (en) | 2000-04-27 | 2000-04-27 | Polypeptide-human Pax protein 9.9 and polynucleotide for coding it |
CN00115464.8 | 2000-04-27 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001081535A2 true WO2001081535A2 (en) | 2001-11-01 |
WO2001081535A3 WO2001081535A3 (en) | 2002-03-14 |
Family
ID=4584910
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000595 WO2001081535A2 (en) | 2000-04-27 | 2001-04-23 | A novel polypeptide, a human pax protein 9.9 and the polynucleotide encoding the polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1320624A (en) |
AU (1) | AU7379801A (en) |
WO (1) | WO2001081535A2 (en) |
-
2000
- 2000-04-27 CN CN 00115464 patent/CN1320624A/en active Pending
-
2001
- 2001-04-23 AU AU73798/01A patent/AU7379801A/en not_active Abandoned
- 2001-04-23 WO PCT/CN2001/000595 patent/WO2001081535A2/en active Application Filing
Non-Patent Citations (3)
Title |
---|
B.W. SCHAFER ET AL.: 'Molecular cloning and characterization of a human PAX-7 cDNA expressed in normal and neoplastic myocytes' NUCLEIC ACIDS RES. vol. 22, no. 22, 11 November 1994, pages 4574 - 4582 * |
M. GERARD ET AL.: 'PAX-genes expression during human embryonic development, a preliminary report' C.R. ACAD. SCI. III vol. 318, no. 1, January 1995, pages 57 - 66 * |
P. SANYANUSIN ET AL.: 'Genomic structure of the human PAX2 gene' GENOMICS vol. 35, no. 1, 01 July 1996, pages 258 - 261 * |
Also Published As
Publication number | Publication date |
---|---|
WO2001081535A3 (en) | 2002-03-14 |
CN1320624A (en) | 2001-11-07 |
AU7379801A (en) | 2001-11-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001079432A2 (en) | A novel polypeptide, a human cell differentiation transcription factor 58 and the polynucleotide encoding the polypeptide | |
WO2001081535A2 (en) | A novel polypeptide, a human pax protein 9.9 and the polynucleotide encoding the polypeptide | |
WO2001081594A1 (en) | A novel polypeptide, a human pax protein 17 and the polynucleotide encoding the polypeptide | |
WO2001072796A1 (en) | A novel polypeptide, a human cell differentiation transcription factor 11 and the polynucleotide encoding the polypeptide | |
WO2001075101A1 (en) | A novel polypeptide- human transcription regulator 8 and the polynucleotide encoding said polypeptide | |
WO2001070965A1 (en) | A novel polypeptide, a human regulatory transcription factor 15 and the polynucleotide encoding the polypeptide | |
WO2001075048A2 (en) | A novel polypeptide, human ribosomal protein s11 23 and the polynucleotide encoding the polypeptide | |
WO2001046409A1 (en) | A novel polypeptide- ribosome s7 protein 9 and the polynucleotide encoding said polypeptide | |
WO2001072801A1 (en) | A novel polypeptide - human ribosomal s11 protein 12 and a polynucleotide sequence encoding the same | |
WO2001079434A2 (en) | A novel polypeptide, a human signal peptidase 10 and the polynucleotide encoding the polypeptide | |
WO2001079423A2 (en) | A novel polypeptide, human bcr protein 10 and the polynucleotide encoding said polypeptide | |
WO2001079437A2 (en) | Novel polypeptide a human cell differential transcriptional factor 14 and polynucleotide encoding it | |
WO2001081399A1 (en) | A novel polypeptide, a human pax protein 14 and the polynucleotide encoding the polypeptide | |
WO2001081386A1 (en) | A novel polypeptide - human pax protein 12.5 and the polynucleotide encoding said polypeptide | |
WO2001075124A1 (en) | Novel polypeptide -- a human regulatory transcript factor 9 and polynucleotide encoding it | |
WO2001074893A1 (en) | A novel polypeptide - human regulatory transcription factor 11.8 and a polynucleotide sequence encoding the same | |
WO2001079436A2 (en) | A novel polypeptide - human cell differentiation transcription factor 10 and the polynucleotide encoding said polypeptide | |
WO2001081395A1 (en) | A novel polypeptide - dna topoisomerase i-15 and a polynucleotide sequence encoding the same | |
WO2001087959A1 (en) | A new polypeptide-human pax protein 11.9 and the polynucleotide encoding it | |
WO2001072809A1 (en) | A novel polypeptide-human cell differentiational transcription factor 9 and a polynucleotide sequence encoding the same | |
WO2001074891A1 (en) | A novel polypeptide - human regulatory transcription factor 17 and a polynucleotide sequence encoding the same | |
WO2001075018A2 (en) | A novel polypeptide, a human regulation factor of transcription 31 and the polynucleotide encoding the polypeptide | |
WO2001055419A1 (en) | Novel polypeptide---s1 rna binding region 27 and polynucleotide encoding it | |
WO2001072806A1 (en) | A novel polypeptide - human cell differentiational transcription factor 8 and a polynucleotide sequence encoding the same | |
WO2001073008A1 (en) | A novel polypeptide, a human tumor relative nucleoprotein 13 and the polynucleotide encoding the polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |