WO2001081394A1 - A novel polypeptide, human insulin-like growth factor-binding protein 9 and the polynucleotide encoding thereof - Google Patents

Abstract

The invention discloses a novel polypeptide, human insulin-like growth factor-binding protein 9, the polynucleotide encoding the same and the method of producing thereof by DNA recombinant techniques. Methods of using the polypeptide for treating various diseases such as fetation disorder, bone and joint hypogenesis, neuropathy, hypotrophy, various tumors, inflammation, immune diseases, hematopathy, HIV infection are also disclosed. Furthermore, the invention discloses the antagonists of the polypeptide and the effects thereof. The use of the polynucleotide encoding the novel human insulin-like growth factor binding protein 9 is also disclosed.

Description

 A new peptide-human insulin-like growth factor binding protein 9

 And a polynucleotide encoding such a polypeptide

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, namely human insulin-like growth factor binding protein 9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique

 Insulin-like growth factor (UGF) is a low-molecular-weight peptide hormone that has high homology in structure with proinsulin. Two different insulin-like growth factors have been found in organisms: IGFI and IGFII. As a mitogenic factor, they are expressed in various tissues and cells of the organism. IGFI plays an important regulatory role in cartilage development and bone formation during individual growth; IGFII plays an important regulatory role in embryonic and neurodevelopmental growth. Studies have found that insulin-like growth factor not only plays an important role in skeletal development, it also plays an important regulatory role in tissue reconstruction such as red blood cell formation, growth hormone-deficient body growth, and liver and kidney development . Mutations or abnormal expression of this protein are often closely related to the occurrence of diseases such as osteoporosis in the body.

 The role of insulin-like growth factor in the body requires the coordination of at least one IGF-binding protein. IGF-binding protein in the body may mediate the correct localization and expression of insulin-like growth factor in specific tissues. Such binding proteins can be used in the body to treat diseases such as excessive tissue growth caused by excessive expression of growth factors. It works synergistically with corresponding growth factors to regulate the normal development and growth of relevant tissues and cells in the body.

The earliest cloned insulin-like growth factor binding protein is IGFBP-3. This protein is a glycoprotein that is about 150KDa in size and consists of multiple subunits. It is a growth hormone-dependent binding protein. Regulation of hormone content. In 1984, Povoa et al. Cloned a new insulin-like growth factor binding protein IGFBP-1 from human and mouse amnion tissues, which are two different biologically derived binding proteins with high homology in amino acid sequences. [Povoa G. et al., 1984, Eur J. Biochem, 144: 199]. In 1988, Lee et al. Cloned an insulin-like growth factor binding protein from a human hepatoma G2 cell line. The binding protein consists of about 234 amino acid residues and contains a cysteine-rich residue. Sequence fragment, the amino acid sequence of the protein has high homology with several known insulin-like growth factor binding proteins, and the protein is also involved in the body Regulate the corresponding insulin-like growth factors to exert their normal physiological activities to promote the growth, development and function of related tissues and cells [Lee YL, Hintz RL et al., 1988, Mol Endocrinol, 2: 404-411].

 It can be known from the above that the insulin-like growth factor binding protein and the corresponding growth factors cooperate in vivo to regulate the normal expression and function of insulin-like growth factor in tissues and cells. The mutation or abnormal expression of this protein will cause abnormal expression and action of insulin-like growth factor in the body, and then cause various metabolic and developmental disorders related to it. The protein is closely related to the occurrence of metabolic disorders, osteoporosis, osteoporosis, tumors and cancers of related tissues in various organisms in vivo. It can also be used to diagnose and treat various diseases mentioned above.

 Gene chip analysis revealed that in thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, arsenic stimulation L02 L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, fetal lung, and fetal heart The expression profile of the polypeptide of the present invention is very similar to the expression profile of human insulin-like growth factor binding protein, so their functions may also be similar. The invention is named human insulin-like growth factor binding protein 9.

 As mentioned above, the human insulin-like growth factor binding protein 9 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more participation in the field These processes of the human insulin-like growth factor binding protein 9 protein, in particular, identify the amino acid sequence of this protein. Isolation of the new human insulin-like growth factor binding protein 9 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate their coding DNA. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human insulin-like growth factor binding protein 9 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 It is another object of the present invention to provide a recombinant vector containing a polynucleotide encoding a human insulin-like growth factor binding protein 9.

Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human insulin-like growth factor binding protein 9. Another object of the present invention is to provide a method for producing human insulin-like growth factor binding protein 9. Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human insulin-like growth factor binding protein 9.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human insulin-like growth factor binding protein 9.

 Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of human insulin-like growth factor binding protein 9.

 The present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID D0: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID D. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 497-754 in SEQ ID NO: 1; and (b) a sequence having 1-939 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human insulin-like growth factor binding protein 9 protein, which comprises using the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human insulin-like growth factor binding protein 9 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

The present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of embryonic developmental disorders, bone and joint dysplasia, neurological diseases, growth disorders, various tumors, inflammation, and immunity. Diseases, blood diseases, HIV infection or other human insulin-like growth factor binding proteins Use of a medicine for diseases caused by abnormal expression of white 9.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

 The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

 An "agonist" refers to a molecule that, when combined with human insulin-like growth factor binding protein 9, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human insulin-like growth factor binding protein 9.

 An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of human insulin-like growth factor binding protein 9 when combined with human insulin-like growth factor binding protein 9. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human insulin-like growth factor binding protein 9.

"Regulation" refers to a change in the function of human insulin-like growth factor binding protein 9, including an increase or decrease in protein activity, a change in binding characteristics, and any Changes in other biological, functional or immune properties.

 By "substantially pure" is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human insulin-like growth factor binding protein using standard protein purification techniques.

9. Essentially pure human insulin-like growth factor binding protein 9 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human insulin-like growth factor binding protein 9 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percentage identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). _{0 The} Cluster method divides each group of sequences by checking the distance between all pairs. Arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by the Cluster method or by a method known in the art such as Jotun Hein. The percent identity between nucleic acid sequences (Hein J., (1990) Methods in emzumology 183: 625-645).

"Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids for conservative substitutions For example, negatively charged amino acids may include Aspartic acid and glutamic acid; Positively charged amino acids can include lysine and arginine; Amino acids with uncharged head groups that have similar hydrophilicity can include leucine, isoleucine And valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to an intact antibody molecules and fragments thereof, such as _{Fa, F (a b ')} 2 and F _V, which specifically binds to human insulin-like growth factor binding protein antigenic determinants 9.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated human insulin-like growth factor binding protein 9" means that human insulin-like growth factor-binding protein 9 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human insulin-like growth factor binding protein 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human insulin-like growth factor binding protein 9 polypeptide can be analyzed by amino acid sequence.

The present invention provides a new polypeptide, human insulin-like growth factor binding protein 9, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may It is glycosylated or may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of human insulin-like growth factor binding protein 9. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human insulin-like growth factor binding protein 9 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such One, wherein the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, 00 derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 939 bases, and its open reading frames 497-754 encode 85 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to human insulin-like growth factor binding protein, and it can be deduced that the human insulin-like growth factor-binding protein 9 has a similar function as human insulin-like growth factor-binding protein.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

The term "polynucleotide encoding a polypeptide" is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences. The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring 'variants'. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, more preferably 97% or more hybridization occurs. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human insulin-like growth factor binding protein 9.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human insulin-like growth factor binding protein 9 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1 989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Cl on Tech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (D DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determination of the level of the transcript of human insulin-like growth factor binding protein 9; ( 4) Detecting the protein product of gene expression through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably Is at least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2,000 nucleotides, and preferably within 1,000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, the protein product of human insulin-like growth factor binding protein 9 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (EL I SA). .

 A method (Saiki, et al. Sc; 1985; 230: 1 350-1 354) using DNA technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger e t al. PNAS, 1977, 74: 546 3-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human insulin-like growth factor binding protein 9 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.

In the present invention, a polynucleotide sequence encoding a human insulin-like growth factor binding protein 9 may be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as Virus, retrovirus or other vector. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human insulin-like growth factor binding protein 9 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pairs of the SV40 enhancer at the late side of the origin of replication, polyoma enhancers and adenovirus enhancers at the late stage of the origin of replication.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding a human insulin-like growth factor binding protein 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. . The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells Cell etc.

Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of DNA uptake can be harvested after exponential growth phase, with (Treatment 1 ₂ ^, with steps well known in the art. Alternative is MgC l ₂ If necessary, transformation can also be performed by electroporation. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipids. Body packaging, etc.

 By using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human insulin-like growth factor binding protein 9 (Science, 1 984; 224: 1 4 31). Generally speaking, there are the following steps:

 (1) using the polynucleotide (or a variant) encoding the human human insulin-like growth factor binding protein 9 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

FIG. 1 is a comparison diagram of gene chip expression profiles of human insulin-like growth factor binding protein 9 and human insulin-like growth factor binding protein according to the present invention. The upper graph is a graph of the expression profile of human insulin-like growth factor binding protein 9, and the lower graph is the graph of the expression profile of human insulin-like growth factor binding protein. Among them, 1 indicates fetal kidney, 2 indicates fetal large intestine, 3 indicates fetal small intestine, 4 indicates fetal muscle, 5 indicates fetal brain, 6 indicates fetal bladder, 7 Indicates non-starved L02, 8 indicates L02 +, lhr, As ³⁺ , 9 indicates ECV304 PMA-, 10 indicates ECV304 PMA +, 11 indicates fetal liver, 12 indicates normal liver, 13 indicates thyroid, 14 indicates skin, and 15 indicates fetal lung, 16 indicates lung, 17 indicates lung cancer, 18 indicates fetal spleen, 19 indicates spleen, 20 indicates prostate, 21 indicates fetal heart, 22 indicates heart, 23 indicates muscle, 24 indicates testis, 25 indicates fetal thymus, and 26 indicates thymus.

 Figure 2 is a polyacrylamide gel electrophoresis image of isolated human insulin-like growth factor binding protein 9

(SDS-PAGE). 9KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as those described in Sanibrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

 Example 1: Cloning of human insulin-like growth factor binding protein 9

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Using Quik mRNA Isolation Kit

(Qiegene) Isolate poly (A) mRNA from total RNA. 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 ^ fragment was inserted into the multiple cloning site of pBSK (+) vector (Clontech), and transformed into DH5cc. The bacteria formed a cDNA library. Dye terminate cycle reaction ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one clone 0499cl2 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results showed that the full-length cDNA contained in the 0499cl2 clone was 939bp (as shown in Seq IDN0: 1), and there was a 258bp open reading frame (0RF) from 497bp to 754bp, encoding a new protein (such as Seq ID NO: 2). We named this clone _P BS-0499cl2 and the encoded protein was named human insulin-like growth factor binding protein 9. Example 2: Cloning of a gene encoding human insulin-like growth factor binding protein 9 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:

 Primerl: 5'— TTAAAATTTTTATTCATAATAAGA —3, (SEQ ID NO: 3)

Primer2: 5'- GAGGTGGGAGTGGTCTCACTATGT -3 '(SEQ ID NO: 4) Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 P mer2 is the 3′-end reverse sequence in SEQ ID NO: 1.

Amplification conditions: 50 μl reaction volume containing 50 μl / L C1, 10 mmol / L Tris-Cl, (pH8.5), 1.5 mmol / L MgCl ₂ , 200 μ mol / L dNTP, lOpmol Primer, 1U Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-939bp shown in SEQ ID NO: 1. Example 3: Northern blot analysis of human insulin-like growth factor binding protein 9 gene expression:

Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH 4, 0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 μ _§ RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ³² P- DNA probe labeled with ex- ³² P dATP by random priming method. The DNA probe used was the PCR amplified human insulin-like growth factor binding protein 9 coding region sequence (497bp to 754bp) shown in FIG. 1. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH7.4)-5 x SSC- 5 x Denhardt, s solution and 200 yg / ml salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 4: In vitro expression, isolation and purification of recombinant human insulin-like growth factor binding protein 9

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Primer3: 5,-CCCCATATGATGAGGCTGGGAGCAGGGAGCCCC -3, (Seq ID No: 5) Priraer 4: 5,-CATGGATCCTCAACACCGATTACAGAGAACAGC -3 '(Seq ID No: 6) The 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively. The coding sequences of the 5 'and 3' ends of the gene of interest are followed, and the Nde.I and BamHI restriction sites correspond to the selection on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Sex endonuclease site. PBS- The 0499cl2 plasmid was used as a template for the PCR reaction. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of pBS-0499cl2 plasmid, primers Primer-3 and Primer- 4 points, and ¹ J was lOpmol, Advantage polymerase Mix (Clontech) 1 μ1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into the colibacillus DH5α by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0499C12) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. The host strain BL21 (pET-0499cl2) was 37 in LB liquid medium containing kanamycin (final concentration 30 _g / ml). C. Cultivate to logarithmic growth phase, add IPTG to a final concentration of 1 ol / L, and continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidine (6His-Tag). The purified human insulin-like growth factor binding protein 9 was purified. After SDS-PAGE electrophoresis, a single band was obtained at 9 KDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of antibodies against human insulin-like growth factor binding protein 9

 The following peptides specific to human insulin-like growth factor binding protein 9 were synthesized using a peptide synthesizer (product of PE):

 NH2-Met-Arg-Leu-G 1 y-A 1 a-G 1 y-Ser-Pro-Me t-Arg-G 1 y-Cys-A la-Gly-Gl y-

C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit sera. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method demonstrated that the purified antibody specifically binds to human insulin-like growth factor binding protein 9. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

Selecting suitable oligonucleotide fragments from the polynucleotides of the present invention has various uses as hybridization probes, such as using the probes to hybridize to genomic or cDNA libraries of normal tissues or pathological tissues from different sources. In order to identify whether it contains a polynucleotide sequence of the present invention and detect a homologous polynucleotide sequence, the probe may further be used to detect the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof in normal tissue or Whether the expression in pathological tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Sou thern imprinting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

 1. The size of the probe is selected from 18 to 50 nucleotides;

 2.The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

5'- TGAGGCTGGGAGCAGGGAGCCCCATGAGGGGATGTGCAGGA -3 '(SEQ ID NO: 8) Probe 1 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:

 5'- TGAGGCTGGGAGCAGGGAGCCCCATGAGGGGATGTGCAGGA -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods related to the following specific experimental procedures, please refer to the literature: DNA PROBES GH Kel ler; MM Manak; Stockton Press, 1989 ( USA) and more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" (U998 Second Edition) [US] Sambrook et al., Science Press.

 Sample Preparation:

 1.Extract DN A from fresh or frozen tissue

 Steps: 1) Place fresh or freshly thawed normal liver tissue in ice and hold phosphate buffered saline

(PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the pellet (about 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 2 mmol / LnaCl; 25 mol / L MgCl ₂ ). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1 to 5 ml per 0.1 g of the original tissue sample), and centrifuge at 1000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1 x 10 ⁸ cells / ml). Use a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DNA to a new tube. The DNA was then purified and ethanol precipitated.

 3.Purification and ethanol precipitation of DM

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then Turn upside down to drain residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, every 1- 5 χ 10 ⁶ cells extracted about plus lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100 ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K, the final concentrations are 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 10 volumes of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well-20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A _28fl to detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing. Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and gently mark the spotting position and sample number on them with a pencil. Two NC membranes are required for each probe for subsequent experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

 2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 "C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.10D / 10 μ 1), add 2 μ I inase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of bromophenol blue indicator (BPB).

 4) Pass Sephadex G-50 column.

5) Start to collect the first peak before ³² P-Probe washes out (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) After combining the collection solutions of the first peak, the ³² P-Probe (the second peak is free γ- ³² P-dATP) is prepared. Pre-hybridization

 Put the sample film in a plastic bag, add 3-10mg of pre-hybridization solution (lOxDenhardt-s; 6xSSC, 0.1mg / ml CT DNA (calf thymus DNA).), After sealing the bag, 68 ° C water Luo Shake for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, 40. C Wash for 15 minutes (twice).

 4) In 0.1xSSC, 0.1% SDS, wash at 55 ° C for 30 minutes (twice), and dry at room temperature.

 Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 ° /. Wash in SDS at 37 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, 37. C Wash for 15 minutes (twice).

 4) In 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice), and dry at room temperature.

 X-ray autoradiography:

 -70 ° C, X-ray autoradiography (compression time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than that of hybridization spots. The radioactive intensity of the hybridization spot of the other probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Microarray

Gene microarray or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature, for example, see the literature DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And Helle, RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 μη !. The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

 Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) using a one-step method, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen). The fluorescent reagent Cy3dUTP ( 5- Amino — propargy 2 2 — deoxyuridine 5'- triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5 — Amino- propargy 2 2 — deoxyuridine 5 '-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe. For specific steps and methods, see:

Schena,

 M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614- 10619. Schena, M., Shalon, Dari., Davis, RW (1995) Science .270. (20): 467-480. (3) Hybridization

The probes from the above two tissues and the chips were respectively hybridized in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours. The washing solution (1 x SSC, 0.2% SDS) After washing, scan with a ScanArray 3000 scanner (purchased from Genera Scanning, USA). The scanned images are analyzed and processed with Imagene software (Biodi scovery, USA) to calculate the data for each point. Cy3 / Cy5 ratio.

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart. Draw a graph based on these 26 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profiles of human insulin-like growth factor binding protein 9 and human insulin-like growth factor binding protein according to the present invention are very similar. Industrial applicability

 The polypeptides of the present invention, as well as the antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, H IV infection, and immune diseases.

 Insulin-like growth factor (IGF) is a polypeptide hormone. Known insulin-like growth factors include I GFI and IGFI I. As a mitogenic factor, they are expressed in various tissues and cells of the body. I GFI mainly plays an important regulatory role in the cartilage development and bone formation of an individual's growth; IGFI I mainly plays an important regulatory role in the development of embryos and nerves. Studies have found that insulin-like growth factor not only plays an important role in skeletal development, it also plays an important regulatory role in tissue reconstruction such as red blood cell formation, growth hormone-deficient body growth, and liver and kidney development . Mutations or abnormal expression of this protein are often closely related to the occurrence of diseases such as osteoporosis in the body.

 The role of insulin-like growth factor in the body requires the coordination of at least one IGF-binding protein. Insulin-like growth factor-binding protein in the body may mediate the correct localization and expression of insulin-like growth factor in specific tissues. Such binding proteins can be used in the body to treat diseases such as excessive tissue growth caused by excessive expression of growth factors. It works synergistically with corresponding growth factors to regulate the normal development and growth of relevant tissues and cells in the body.

The expression profile of the polypeptide of the present invention is consistent with the expression profile of human insulin-like growth factor binding protein, and both have similar biological functions. It works synergistically with the corresponding insulin-like growth factors in vivo and regulates the normal expression and role of insulin-like growth factors in tissues and cells. It is of great significance for embryonic development, neural development, cartilage development, bone formation, and tissue reconstruction. Its abnormal expression will cause pathological phenomena in the above-mentioned tissue cells and cause related diseases. It can be seen that the abnormal expression of the human insulin-like growth factor binding protein 9 of the present invention will produce various diseases, especially embryonic developmental disorders, bone and joint dysplasia, neurological diseases, growth and development disorders, various Tumor, inflammation, immune diseases, these diseases include but are not limited to:

 Fetal developmental disorders: congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, androgynous Malformation, Atrial septal defect, Ventricular septal defect, Pulmonary stenosis, Arterial duct occlusion, Neural tube defect, Congenital hydrocephalus, Iris defect, Congenital glaucoma or cataract, Congenital deafness

 Bone and joint dysplasia: cartilage hypoplasia, epiphyseal dysplasia, metabolic bone disease, rickets, chondrosis

 Neurological diseases: Alzheimer's disease, Parkinson's disease, chorea, depression, amnesia, Huntington's disease, epilepsy, migraine, multiple sclerosis, glioma, meningiomas, neurofibromas, Pituitary adenoma, intracranial granuloma, neuromuscular disease, neurocutaneous syndrome, schizophrenia, neural tube insufficiency, brain developmental malformations, neuronal migration disorders

 Growth and development disorders: mental retardation, cerebral palsy, brain development disorders, mental retardation, strabismus, skin, fat and muscular dysplasia such as congenital skin sagging, albinism, presenile, congenital keratosis, Various metabolic defects such as various amino acid metabolic defects, dwarfism, Cushing syndrome, sexual retardation

 Tumors of various tissues: gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, astrocytoma, ependymal tumor, endometrial cancer, colon cancer, nasopharynx Cancer

 Inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations

 Immune diseases: Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome

 Abnormal expression of the human insulin-like growth factor-binding protein 9 of the present invention will also produce certain hereditary, bloody diseases, and the like.

The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially embryonic developmental disorders, bone and joint dysplasia, neurological diseases, growth Developmental disorders, various tumors, inflammation, immune diseases, certain hereditary, blood diseases, etc. The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human insulin-like growth factor binding protein 9. Agonists enhance human insulin-like growth factor binding protein 9 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers. For example, mammalian cells or a membrane preparation expressing human insulin-like growth factor binding protein 9 can be cultured with labeled human insulin-like growth factor-binding protein 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human insulin-like growth factor binding protein 9 include selected antibodies, compounds, receptor deletions, and the like. Antagonists of human insulin-like growth factor binding protein 9 can bind to human insulin-like growth factor binding protein 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.

 When screening compounds as antagonists, human insulin-like growth factor binding protein 9 can be added to the bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between human insulin-like growth factor binding protein 9 and its receptor. Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human insulin-like growth factor binding protein 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human insulin-like growth factor binding protein 9 molecule should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against human insulin-like growth factor binding protein 9 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

 Polyclonal antibodies can be produced by injecting human insulin-like growth factor binding protein 9 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc. Techniques for preparing monoclonal antibodies to human insulin-like growth factor binding protein 9 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human insulin-like growth factor binding protein 9.

Antibodies against human insulin-like growth factor binding protein 9 can be used in immunohistochemical techniques to detect human insulin-like growth factor binding protein 9 in biopsy specimens. Monoclonal antibodies that bind to human insulin-like growth factor binding protein 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human insulin-like growth factor binding protein 9 High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through disulfide exchange. This hybrid antibody can be used to kill human insulin-like growth factor binding protein 9 positive Cell.

 The antibodies of the present invention can be used to treat or prevent diseases related to human insulin-like growth factor binding protein 9. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human insulin-like growth factor binding protein 9.

 The invention also relates to a diagnostic test method for quantitative and localized detection of human insulin-like growth factor binding protein 9 levels. These tests are well known in the art and include F I SH assays and radioimmunoassays. The levels of human insulin-like growth factor binding protein 9 detected in the test can be used to explain the importance of human insulin-like growth factor binding protein 9 in various diseases and to diagnose the role of human insulin-like growth factor binding protein 9 disease.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

Polynucleotides encoding human insulin-like growth factor binding protein 9 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human insulin-like growth factor binding protein 9. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human insulin-like growth factor-binding protein 9 to inhibit endogenous human insulin-like growth factor-binding protein 9 activity. For example, a mutated human insulin-like growth factor binding protein 9 may be a shortened human insulin-like growth factor-binding protein 9 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human insulin-like growth factor binding protein 9. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human insulin-like growth factor binding protein 9 into a cell. A method for constructing a recombinant viral vector carrying a polynucleotide encoding human insulin-like growth factor binding protein 9 can be found in the existing literature (Sambrook, etal.). In addition, a recombinant polynucleotide encoding human insulin-like growth factor binding protein 9 can be packaged into liposomes and transferred into cells. Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human insulin-like growth factor binding protein 9 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RM, DNA and ribozymes can be obtained by any existing RNA or DNA synthesis technology. For example, solid-phase phosphoramidite chemical synthesis technology has been widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding human insulin-like growth factor binding protein 9 can be used for the diagnosis of diseases related to human insulin-like growth factor binding protein 9. The polynucleotide encoding human insulin-like growth factor-binding protein 9 can be used to detect the expression of human insulin-like growth factor-binding protein 9 or abnormal expression of human insulin-like growth factor-binding protein 9 in a disease state. For example, the DNA sequence encoding human insulin-like growth factor binding protein 9 can be used to hybridize biopsy specimens to determine the expression of human insulin-like growth factor-binding protein 9. Hybridization techniques include Soutern blotting, Norternern blotting, in situ hybridization, and the like. These techniques and methods are all mature and open technologies, and related kits are commercially available. A part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray (Mic roa rr ay) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and Genetic diagnosis. Human insulin-like growth factor binding protein 9 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human insulin-like growth factor binding protein 9 transcription products.

 Detection of mutations in the human insulin-like growth factor-binding protein 9 gene can also be used to diagnose human insulin-like growth factor-binding protein 9-related diseases. Human insulin-like growth factor binding protein 9 mutant forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human insulin-like growth factor binding protein 9 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, the mutation may affect the expression of the protein. Therefore, the Nort Hern blotting and Wet Stern blotting can be used to indirectly determine whether the gene is mutated.

The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Only few chromosome markers based on actual sequence data (repeat polymorphisms) are available For marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceuticals or biological products, which instructions reflect production, use Or a government agency that sells it allows it to be administered to humans. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human insulin-like growth factor binding protein 9 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of human insulin-like growth factor-binding protein 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Claim

1. An isolated polypeptide-human insulin-like growth factor binding protein 9, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID D NO: 2, or an active fragment, analog, or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, further comprising a polypeptide having an amino acid sequence represented by SEQ ID NO: 2.

4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) a polynucleotide that is at least 70% identical to) or (b).

5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 497-754 in SEQ ID NO: 1 or the sequence of positions 1-939 in SEQ ID NO: 1. .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human insulin-like growth factor binding protein 9 activity, characterized in that the method includes:

 (a) culturing the engineered host cell of claim 8 under the condition of expressing human insulin-like growth factor binding protein 9;

 (b) A polypeptide having human insulin-like growth factor binding protein 9 activity is isolated from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that the antibody is capable of binding to human insulin-like growth factors. An antibody that specifically binds to daughter protein 9.

 1 1. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human insulin-like growth factor binding protein 9.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

 1 3. A use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human insulin-like growth factor binding protein 9 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of the polypeptide according to any one of claims 1 to 3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human insulin-like growth factor binding protein 9; or For identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 1 1, characterized in that said polypeptide, polynucleotide or mimetic, agonist, The antagonist or inhibitor is composed of a safe and effective dose and a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormality of human insulin-like growth factor binding protein 9

 18. Use of the polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that the polypeptide, polynucleotide or compound is used for preparing a treatment such as a malignant tumor Drugs for blood diseases, H IV infection and immune diseases and various types of inflammation.