WO2001055184A1 - A new polypeptide-human zinc finger protein 19 and the polynucleotide encoding it - Google Patents

Abstract

The present invention discloses a new polypeptide-human zinc finger protein 19, the polynucleotide encoding it and a method producing the polypeptide by DNA recombinant technology. The present invention further discloses a method treating various disorders, e.g. malignant neoplasm, hematopathy, HIV infection and immunological disease and various inflammations etc. The present invention also disclose an agonist of the polypeptide and its therapeutic use. The present invention further discloses the use of the polynucleotide encoding the new human zinc finger protein 19.

Description

 A new polypeptide-human zinc finger protein 19 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, namely human zinc finger protein 19, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. Background technique

 Zinc finger proteins are members of a multi-gene family encoding zinc ion-mediated nucleotide binding proteins. The zinc finger structures of zinc finger proteins mainly have the following types: C2H2 configuration, C2C2 configuration, C2HC configuration, C2HC4C configuration , C3H configuration, C3HC4 configuration (Da i KS et al., 1998). Members of the zinc finger protein family are expressed in various tissues in different organisms. These tissues include hematopoietic cells, brain, nervous system, various tumor-related tissues, and tissues of immortalized cell lines. Both transcription and expression play an extremely important role. Zinc finger proteins of various configurations have been isolated from a variety of organisms such as yeast, fruit fly, rat and human. Among them, the zinc finger protein genes containing the C2H2 configuration constitute the largest family of genes in the human genome (Berker et a l., 1995), and relatively late research on CCHC zinc finger protein and CCCH zinc finger protein [Kama l Chowdhury, He id i Rohdewoh ld et a l., Nuc le ic Ac ids Research, 1988, 16: 9995- 10011].

 Recent studies on members of the CCHC-type zinc finger protein family have found that CCHC-type zinc finger proteins all contain a conserved CCHC-type zinc finger domain, which was first cloned from a retroviral multimeric protein. Various eukaryotic organisms, including yeasts, protozoa, and mammals, are found in a variety of proteins containing this domain. In 1995, Yehuda Tzfa ti et al. Cloned and obtained a set of UMS-binding proteins. This group of proteins is an independent class of cellular proteins. The protein sequence of these proteins contains multiple adjacent CCHC zinc finger motifs [Yehuda Tzfa ti, Haga i Abe l iovich et al., J biol Chem, 1995, 270: 21339-21345].

A variety of intracellular nucleic acid binding proteins have been isolated from a variety of organisms, including humans and mice. These proteins have single-stranded sequences of glutamic acid residues that are rich in CCHC zinc finger domains and some sterol regulatory factors in vivo. Fragments bind to regulate the transcription and expression of related genes. The CCHC zinc finger structure motif consists of the following consensus sequence fragments: The consensus sequence fragment: Cys- X2-Cys-X4- H i s-X4-Cys; the three cysteine in this sequence fragment The residue and a histidine residue are combined with zinc ions to form a stable hydrogen bond, so that the protein has a spatial conformation rich in activity, and is combined with various single-chain regulatory factors to exert normal regulatory functions. This conserved sequence motif is an important site for the protein to exert normal physiological activity. Mutations in this structural motif will lead to inactivation of the protein, which will affect the progress of various related metabolic processes in the body. The structural motif is usually related to the organism ' The occurrence of various immune system diseases, immunodeficiency diseases, tumors of related tissues and cancer in vivo is closely related. The novel human zinc finger protein of the present invention also contains the CCHC zinc finger structural motif as described above, which is a new member of the CCHC zinc finger protein and has similar physiological functions to other members of the protein family. The protein is involved in many important physiological processes in the body, such as various immune system responses, lipid metabolism, and so on. The abnormal expression of this protein is usually closely related to the occurrence of some diseases such as immunodeficiency diseases, immune metabolic disorders, tumors of related tissues and cancer. The protein can also be used for the diagnosis and treatment of various related diseases mentioned above.

 Since the human zinc finger protein 19 protein plays an important role in important functions in the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more human zinc finger protein 19 proteins involved in these processes. In particular, the amino acid sequence of this protein is identified. The isolation of the new human zinc finger protein 19 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human zinc finger protein 19 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human zinc finger protein 19. Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human zinc finger protein 19.

 Another object of the present invention is to provide a method for producing human zinc finger protein 19.

 Another object of the present invention is to provide an antibody against the polypeptide-human zinc finger protein 19 of the present invention. Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human zinc finger protein 19.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human zinc finger protein 19. The present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

(b) a polynucleotide complementary to polynucleotide (a); (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 62 to 574 in SEQ ID NO: 1; and (b) a sequence having 1 to 1799 in SEQ ID NO: 1 Sequence of bits.

 The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human zinc finger protein 19 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human zinc finger protein 19 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological sample. The amount or biological activity of a polypeptide of the invention.

 The present invention also relates to a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human zinc finger protein 19.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated otherwise:

 "Nucleic acid sequence" refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and a fragment or part thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acid or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

"Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with human zinc finger protein 19, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human zinc finger protein 19.

 An "antagonist" or "inhibitor" refers to a molecule that, when combined with human zinc finger protein 19, can block or regulate the biological or immunological activity of human zinc finger protein 19. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human zinc finger protein 19.

 "Regulation" refers to a change in the function of human zinc finger protein 19, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human zinc finger protein 19.

¹¹ Substantially pure '' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human zinc finger protein 19 using standard protein purification techniques. The substantially pure human zinc finger protein 19 produces a single main band on a non-reducing polyacrylamide gel. The purity of human zinc finger protein 19 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of a polynucleotide by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits the hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that two sequences bind to each other as a specific or selective interaction.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). MEGALIGN program can be based on different methods such as Clus ter Comparing two or more sequences (H igg ins, DG and PM Sharp (1988) Gene 73: 237-244) Method ₀ Cl us ter method by examining the distances between all pairs of each set of sequence arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of matching residues between sequence A and sequence X 100

(Residue number in sequence A-number of interval residues in sequence A-number of interval residues in sequence B)

 The percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun He in (Hein J., (1990) Methods in emzumo logy 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the primary biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^) ₂ and?, Which can specifically bind to the epitope of human zinc finger protein 19.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. . As used herein, "isolated human zinc finger protein 19" means that human zinc finger protein 19 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human zinc finger protein 19 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human zinc finger protein 19 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, human zinc finger protein 19, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of human zinc finger protein 19. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially retains the same biological function or activity of the human zinc finger protein 19 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1799 bases in length and its open reading frames 62-574 encode 170 amino acids. This polypeptide has the characteristic sequence of members of the CCHC type zinc finger protein family, and it can be deduced that the human zinc finger protein 19 has the structure and function represented by the members of the CCHC type zinc finger protein family.

The polynucleotide of the present invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used in the present invention, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention. The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that encodes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi col 1, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%, and the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2 .

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human zinc finger protein 19.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human zinc finger protein 19 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage. Cell cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). CDM libraries are also commonly used (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human zinc finger protein 19 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, the protein product of human zinc finger protein 19 gene expression can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

 A method for amplifying DNA / RNA using PCR technology (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-cDNA terminal rapid amplification method) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be separated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human zinc finger protein 19 coding sequence, and a method for producing a polypeptide according to the present invention by recombinant technology.

In the present invention, a polynucleotide sequence encoding human zinc finger protein 19 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to a bacterial plasmid, Bacterial body, yeast plasmid, plant cell virus, mammalian cell virus such as adenovirus, retrovirus or other vectors. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Na thans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human zinc finger protein 19 and suitable transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Mo l ecu l ar Cloning, a Labora tory Manua l, co ld Spring Harbor Labora tory. New York, 1989) . The DNA sequence [J can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, and the early and late SV40 promoters Promoters, retroviral LTRs, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding human zinc finger protein 19 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

The host cell can be transformed with the DM sequence of the present invention or a recombinant vector containing the DNA sequence. The conventional techniques are well known to those skilled in the art. When the host is a prokaryote such as E. coli, it can absorb

Competent cells of DNA can be harvested after the exponential growth phase and treated with CaCl, using procedures well known in the art. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 By conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human zinc finger protein 19 (Scence, 1984; 224: 1431). Generally there are the following steps:

 (1) using the polynucleotide (or variant) encoding human human zinc finger protein 19 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 Fig. 1 is a comparison diagram of amino acid sequences of functional domains of human zinc finger protein 19 and CCHC type zinc finger protein family members of the present invention.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human zinc finger protein 19 isolated. 19KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

The present invention is further described below with reference to specific embodiments. It should be understood that these embodiments are only used to illustrate the present The invention is not intended to limit the scope of the invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as Sambrook et al., Molecular Cloning: The conditions described in the laboratory manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions. Example 1: Cloning of human zinc finger protein 19

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. The Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragments into the multicloning site of the pBSK (+) vector (Clontech) to transform DH5 cc. The bacteria formed a cDNA library. The Dye terminate cycle reaction sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. Comparing the determined cDNA sequence with the existing public DNA sequence database (Genebank), it was found that the cDNA sequence of one of the clones 0140a01 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results show that the full-length cDNA contained in the 0140a01 clone is 1799bp (as shown in Seq ID NO: 1), and there is a 513bp open reading frame (0RF) from 62bp to 574bp, which encodes a new protein (such as Seq ID N0 : 2)). We named this clone _P BS-0140a01 and the encoded protein was named human zinc finger protein 19. Example 2: Domain analysis of cDNA clones

 The sequence of the human zinc finger protein 19 of the present invention and the protein sequence encoded by the same were used in a profile scan program (Basiclocal Alignment search tool) in GCG [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403- 10], perform domain analysis in databases such as prosite. The human zinc finger protein 19 of the present invention is homologous to members of the domain CCHC type zinc finger protein family. The results of the homology are shown in FIG. 1. Example 3: Cloning of a gene encoding human zinc finger protein 19 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.

After purification of Qiagene's kit, PCR amplification was performed with the following primers:

 Primerl: 5'- ACGGCTGCGAGAAGACGAAGCTTA -3 '(SEQ ID NO: 3)

 Primer2: 5'- TTTAAAAACCTATATTTAACCCAA -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification conditions: 50 μl / L KC1, 10 mmol / L Tris- in a reaction volume of 50 μ 1 CI, (pH8. 5), 1. 5mmol / L MgCl 2, 200 μ mol / L dNTP, l Opmol primer, 1U Taq DNA polymerase (C 1 on t ech Co.). The reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min. During RT-PCR, β-ac tin was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen) using a TA cloning kit. The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1799bp shown in SEQ ID NO: 1. Example 4: Nor thern blot analysis of human zinc finger protein 19 gene expression:

Extraction of total RM in one step [Ana l. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) Centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2.2 M formaldehyde. It was then transferred to a nitrocellulose membrane. A " ² P dATP was used to prepare ³² P-labeled DNA probes by random primers. The DNA probe used was the PCR amplified human zinc finger protein 19 coding region sequence (62bp to 574bp) shown in FIG. 1. The 3 ² P- labeled probes (about 2 xl 0 ⁶ cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution containing 50 ° /. Formamide-25mM KH ₂ P0 ₄ (pH7.4)-5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, place the filter at 1 x SSC-0. 1 ° /. Wash in SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 5: In vitro expression, isolation and purification of recombinant human zinc finger protein 19

 Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers were designed. The sequences are as follows:

 Pr imer3: 5'- CCCCATATGATGGCGACTCCCATGCATCGGCTA -3 '(Seq ID No: 5)

Pr iraer4: 5'- CATGGATCCCTATTTCTTTTTCTTCTTCTTTGG -3 '(Seq ID No: 6) The 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively, followed by the coding sequences of the 5 'and 3, ends of the target gene, respectively. The Ndel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET 28b (+) (product of Novagen, Cat. No. 69865. 3). The PCR reaction was performed using the pBS-0140a01 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of pBS- 0140a01 plasmid, primers Primer-3 and Primer-4 were added!] Is 1 Opmol, Advantage po lymerase Mix (Clontech) 1 μ1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, 25 cycles Ring. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR and sequenced. A positive clone (pET-0140a01) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In containing kanamycin (final concentration of 30 μ g / ml) of LB liquid medium, host strain BL21 _(P ET-0140a01) incubated at 37 ° C to logarithmic phase, IPTG was added to a final concentration of lmmol / L , Continue to cultivate for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation, and the layers were layered with an affinity column His s. Bind Quick Cartr idge (product of Novagen) capable of binding to 6 histidines (6His-Tag). Analysis to obtain purified human zinc finger protein 19. After SDS-PAGE electrophoresis, a single band was obtained at 19 KDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Production of anti-human zinc finger protein 19 antibody

 A peptide synthesizer (product of PE company) was used to synthesize the following human zinc finger protein 19-specific peptides:

NH2- Met- Ala- Thr- Pro- Met- Hi s- Arg- Leu- lie- Ala- Arg-Arg-Gln- Ala- Glu- C00H (SEQ ID NO: 7). The peptide was coupled to hemocyanin and bovine serum albumin to form a complex. For the method, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43 ₀ 4 mg of the above hemocyanin polypeptide complex plus complete Freund's After 15 days, rabbits were immunized with the drug, and the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human zinc finger protein 19. Example 7: Use of a polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Sour Sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;

 3, there should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'- TGGCGACTCCCATGCATCGGCTAATAGCCCGGAGACAAGCT -3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1

5'- TGGCGACTCCCATGCATCGGCTAATAGCCCGGAGACAAGCT -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental steps, please refer to the literature: DNA PROBES GH Keller; MM Manak; Stockton Pres s, 1989 (USA) and more commonly used points Books on subcloning experiment manuals such as "Molecular Cloning Experiment Guide" (Second Edition, 1998) [US] Sambrook and others, Science Press.

 Sample Preparation:

 1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Use cold homogenization buffer (0.25mol / L sucrose; 25mmol / L Tris-HCl, pH7.5; 25mmol / LnaCl; 25mmol / L MgCl ₂ ) suspension pellet (about 10ml / g) 4) at 4 ° C homogenize the tissue suspension at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1-5ml per 0.1 g of the original tissue sample), and then Centrifuge at 1000g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add 1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, D phenol extraction

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells (1 × 10 ⁸ cells / nil) with cold cell lysate and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to D solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or suck with a dropper while gradually increasing TE, mix until the DNA is fully dissolved, and add approximately 1 ul for each 1-5 χΐθ ⁶ cells.

The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly. 8) Add RNase A to the DNA solution to a final concentration of 100 ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K, the final concentrations are 0.5 ° /. And 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of benzoic acid: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase, re-extract with an equal volume of chloroform: isoamyl alcohol ( _24: 1), and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 10 volumes of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well at -20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Determine A _26Q and A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing.

Preparation of sample film:

 1) Take 4x 2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are required for each probe, so that it can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.1 IOD / Ιθμ 1), add 2 μ IKinase buffer, 8-10 uCi γ- ³² P- dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 1 hour.

 3) Add 1/5 volume of bromophenol blue indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Collect the first peak before ³² P-Probes are washed out (monitorable).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) After combining the collection solutions of the first peak, the ³² P-Probe (the second peak is free γ- ³² P-dATP) is prepared. Pre-hybridization

 Place the sample membrane in a plastic bag, add 3-10 mg of prehybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).), Seal the bag, and shake at 68 ° C for 2 hours in a water bath .

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight.

 Wash film:

High-intensity washing film: 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice).

 4) 0.1 x SSC, 0.1% SDS, wash at 55 ° C for 30 minutes (twice), and dry at room temperature.

 Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 37 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

 X-ray auto-development:

 -70, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger To the radioactive intensity of the hybridization spot of another probe. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues. Example 8 DNA Microarray

 Gene chip or gene microarray (DM Microarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature, for example, see the literature DeRi s i, J. L., Lyer, V. & Brown, P. 0.

 (1997) Sc ience 278, 680-686. And Hell, R. A., Schema, M., Cha i, A., Sha lom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartes i an 7500 spotter (purchased from Cartesian Company, USA). The distance between the points is 280 μ η. The spotted slides are hydrated, dried, and exposed to UV light. Cross-link in the instrument and dry after elution to fix the DNA on a glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2 ° /. Wash with SDS for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 "6. 0.2% SDS was washed for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 C in the dark for future use.

 (Two) probe marking

 Total mRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen). Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5) '-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech company) labeled mRNA of normal liver tissue, using Cy5dUTP (5-Ami no-propargy 1-2' -deoxyur idine 5'-triphate coupled to Cy5 fluorescent Dye (purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification. For specific steps and methods, see:

 Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 9.3: 10614- 10619. Schena, M., Shalon, Dari., Davis, RW (1995 ) Science. 270. (20): 467-480.

(Three) cross

 The probes from the two types of tissues and the chips were hybridized in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000. Scanner (purchased from General Scanning Company, USA) for scanning. The scanned image was analyzed by Imagene software (Biodiscovery Company, USA), and the Cy3 / Cy5 ratio of each point was calculated. The points with the ratio less than 0.5 and greater than 2 were considered. Genes with differential expression.

The experimental results show that Cy3 signal = 3763.1 (average of four experiments), Cy5signal = 3989.64 (average of four experiments), Cy3 / Cy5 = 0.9432, the polynucleotide of the present invention in the above two tissues No significant difference in expression. Industrial applicability The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.

 Zinc-binding proteins are usually involved in gene expression and regulation as transcription factors and signal transduction molecules. Zinc-finger proteins are expressed in different tissues such as hematopoietic cells, brain, nervous system, various tumor-related tissues, and tissues of immortalized cell lines. CCHC zinc finger structural motif proteins are mostly intracellular nucleic acid binding proteins. They bind to glutamate-rich single-stranded sequence fragments of some sterol regulators through CCHC zinc finger domains to regulate transcription of related genes And expression.

 Studies have found that some zinc finger proteins are closely related to solid tumors, neurological diseases, hematological malignancies, developmental disorders, and other tumors such as neuroblastoma, colon cancer, breast cancer, and so on.

 The polypeptide of the present invention has a characteristic CCHC zinc finger structure, which is a zinc finger protein of the CCHC configuration, whose abnormal expression will cause obstacles in gene transcription and expression regulation, and cause related diseases.

 It can be seen that the abnormal expression of human zinc finger protein 19 of the present invention will produce various diseases, especially various tumors, neurological diseases, hematological malignant diseases, and development disorders. These diseases include, but are not limited to:

 Tumors of various tissues: thyroid tumors, uterine fibroids, neuroblastomas, ependymoma, colon cancer, breast cancer, leukemia, lymphoma, malignant histiocytosis, melanoma, sarcoma, myeloma, teratoma , Adrenal cancer, bladder cancer, bone cancer, bone marrow cancer, brain cancer, uterine cancer, gallbladder cancer, liver cancer, lung cancer, thymic tumor

 Nervous system diseases: neural tube insufficiency, abnormal brain development, abnormal formation of the brain gyrus, aqueduct malformation, cerebellar dysplasia, Down syndrome, congenital hydrocephalus, congenital cerebral nucleus hypoplasia syndrome, glial cells Tumors, meningiomas, neurofibromas, pituitary adenomas, intracranial granulomas, Alzheimer's disease, Parkinson's disease, chorea, depression, amnesia, Huntington's disease, epilepsy, migraine, dementia, Multiple sclerosis, schizophrenia, depression, paranoia, anxiety, obsessive-compulsive disorder, phobia, neurodegeneration

 Developmental disorders: extrapyramidal dysfunction, teratology, Wi ll iams syndrome, Alagi l le syndrome, cleft foot and cleft foot disease and Bayesian syndrome, congenital abortion, cleft palate, limb loss, limb Disorders of differentiation, polycystic kidney, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, iris defect, congenital glaucoma or cataract, congenital deafness

 Hematological malignancies: Leukemia, non-Hodgkin's lymphoma

 Abnormal expression of the human zinc finger protein 19 of the present invention will also cause certain genetic diseases, such as endocrine system diseases such as endocrine adenoma, and immune system diseases.

The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, nervous system diseases, hematological malignant diseases, and development disorders. Disorders, certain genetic diseases, endocrine system diseases such as endocrine adenoma, immune system diseases, etc. The present invention also provides screening compounds to identify those that increase (agonist) or suppress (antagonist) human zinc finger proteins.

1 method of medicament. Agonists enhance biological functions such as human zinc finger protein 19 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human zinc finger protein 19 can be cultured with labeled human zinc finger protein 19 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human zinc finger protein 19 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human zinc finger protein 19 can bind to human zinc finger protein 19 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

 When screening compounds as antagonists, human zinc finger protein 19 can be added to the bioanalytical assay, and the effect of the compound on the interaction between human zinc finger protein 19 and its receptor can be determined to determine whether the compound is an antagonist. In the same manner as described above for screening compounds, receptor deletions and analogs that act as antagonists can be screened. Polypeptide molecules capable of binding to human zinc finger protein 19 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human zinc finger protein 19 molecule should generally be labeled.

 The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against human zinc finger protein 19 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

 Polyclonal antibodies can be produced by injecting human zinc finger protein 19 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. . Techniques for preparing monoclonal antibodies to human zinc finger protein 19 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al., PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human zinc finger protein 19.

 Anti-human zinc finger protein 19 antibodies can be used in immunohistochemical techniques to detect human zinc finger protein 19 in biopsy specimens.

Monoclonal antibodies that bind to human zinc finger protein 19 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis. Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human zinc finger protein 19 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human zinc finger protein 19-positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to human zinc finger protein 19. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human zinc finger protein 19.

 The invention also relates to a diagnostic test method for quantitative and localized detection of human zinc finger protein 19 levels. These tests are well known in the art and include F I SH assays and radioimmunoassays. The level of human zinc finger protein 19 detected in the test can be used to explain the importance of human zinc finger protein 19 in various diseases and to diagnose diseases in which human zinc finger protein 19 plays a role.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.

 The polynucleotide encoding human zinc finger protein 19 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human zinc finger protein 19. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human zinc finger protein 19 to inhibit endogenous human zinc finger protein 19 activity. For example, a mutated human zinc finger protein 19 may be a shortened human zinc finger protein 19 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human zinc finger protein 19. Virus-derived expression vectors such as retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer the polynucleotide encoding human zinc finger protein 19 into cells. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a human zinc finger protein 19 can be found in existing literature (Sambrook, et al.). In addition, a polynucleotide encoding human zinc finger protein 19 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human zinc finger protein 19 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA and DNA and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology of solid phase phosphate amide synthesis of oligonucleotides has been widely used. Antisense RNA molecules can be expressed in vivo by a DNA sequence encoding the RNA Obtained in vitro or in vivo. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding human zinc finger protein 19 can be used for the diagnosis of diseases related to human zinc finger protein 19. The polynucleotide encoding human zinc finger protein 19 can be used to detect the expression of human zinc finger protein 19 or abnormal expression of human zinc finger protein 19 in a disease state. For example, the DNA sequence encoding human zinc finger protein 19 can be used to hybridize biopsy specimens to determine the expression of human zinc finger protein 19. Hybridization techniques include Souter hern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are available commercially. Part or all of the polynucleotides of the present invention can be used as probes on microarrays (Microcroix) or DNA chips (also known as "gene chips") for analyzing differential expression analysis of genes in tissues. And genetic diagnosis. Human zinc finger protein 19 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human zinc finger protein 19 transcription products.

 Detection of mutations in the human zinc finger protein 19 gene can also be used to diagnose human zinc finger protein 19-related diseases. Human zinc finger protein 19 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild type human zinc finger protein 19 DNA sequence. Mutations can be detected using existing techniques such as Sou thern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nort Hern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 1-35 bp) are prepared based on the cDNA, and the sequence can be mapped on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells containing human genes corresponding to the primers will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.

Fluorescent in situ hybridization (FI SH) of cDNA clones and metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manua l of Bas ic Techniques, Pergamon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckus i ck, Mende l ian Inher i tance in Man (available online with Johns Hopkins Univers i ty Welch Med ica l Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them. In addition, the polypeptide of the present invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human zinc finger protein 19 is administered in an amount effective to treat and / or prevent a particular indication. The amount and dosage range of human zinc finger protein 19 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Claim

1. An isolated polypeptide-human zinc finger protein 19, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 62 to 574 in SEQ ID NO: 1 or the sequence of positions 1-1799 in SEQ ID NO: 1. .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having human zinc finger protein 19 activity, characterized in that the method includes:

(a) culturing the engineered host cell of claim 8 under the condition of expressing human zinc finger protein 19;

(b) A polypeptide having human zinc finger protein 19 activity is isolated from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human zinc finger protein 19.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human zinc finger protein 19.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

13. Use of a compound according to claim 11, characterized in that said compound is used for regulating human zinc finger eggs Method for White 19 Activity in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. Use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human zinc finger protein 19; or for peptide fingerprinting Atlas identification.

16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human zinc finger protein 19 abnormality.

 18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Diseases, HIV infection and immune diseases and drugs of various inflammations.