WO2001064727A1 - A novel polypeptide, mouse soluble adenylyl cyclase 25 and the polynucleotide encoding thereof - Google Patents

Abstract

The invention discloses a novel polypeptide, mouse soluble adenylyl cyclase 25, the polynucleotide encoding such polypeptide and the method of production thereof by DNA recombinant techniques. Methods of using the polypeptide for treating various diseases such as spermic diseases, various tumors, embryonic developmental disorder, growth developmental disturbance, inflammations, immune diseases, hemopathy, HIV infection and the like are also disclosed. Furthermore, the invention discloses the antagonists of the polypeptide and the effects thereof. The use of the polynucleotide encoding the novel mouse soluble adenylyl cyclase 25 is also disclosed.

Description

 A new polypeptide-mouse soluble adenylate cyclase 25 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a mouse soluble adenylate cyclase 25, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique

 Adenylate cyclase (AC) is a regulatory protein effector that is most commonly used in a signaling pathway. Its product, cAMP, mediates cellular responses to nutritional conditions and extracellular signals in mammals. There are nine differentially tunable isoform G protein responses or forskolin (a cAMP enzyme inhibitor) -regulated transmembrane gland. Nucleotide cyclases (tmACs). Their catalytic activity can be differentially regulated by G proteins and other signaling molecules that respond to stimuli such as hormones and neurotransmitters. Recently, it has been found that soluble adenylate cyclase is present in the testes of mammals, and its activity is different from that of transmembrane adenylate cyclase and soluble guanylyl cyclase in testis in terms of biochemistry and chromatography.

The biochemical activity of soluble adenylyl cyclase (sAC) depends on the divalent cation Mn ²⁺ and is not sensitive to the regulation of G protein and forskolin. Its affinity for the substrate ATP is better than transmembrane adenylate cyclization Enzymes are nearly 10 times lower, so higher ATP concentrations are needed. The soluble form of adenylate cyclase defines a new way to generate cAMP, and states that a second messenger can be produced some distance from the membrane to get closer to the required site of action: soluble adenylate cyclization The active form of the enzyme is a fragment derived from the full-length protein, so the protein has a proteolytic activation mechanism. Soluble adenylate cyclase is preferentially expressed in the testis, and is also expressed in post-meiotic germ cells. These tissues all have a high concentration of endogenous ATP that can maintain the activity of soluble adenylate cyclase. sAC contains a consensus P-loop or nucleotide binding sequence, but does not contain the sequence in its active form, which is not necessary for catalytic activity. There is a leucine zipper domain or a coiled-coil domain in the C-terminal part of s AC, which is not necessary for catalytic activity, but is a protein-protein domain, which makes sAC 'a specific position in the cell and the cytoskeleton. Stuck. The 50-kDa N-terminus of soluble adenylyl cyclase is related to the catalytic activity of the enzyme.

The limited positioning of sAC indicates that it is related to male fertility. cAMP mediates sperm functions including maturation, swimming, and acrosome response. Although a variety of transmembrane adenylate cyclases are also expressed in the testis, only soluble adenylate cyclases provide Ability to generate cAMP. Two different cAMP-dependent protein kinase anchoring proteins (AKAPs) are located on the sperm flagella, one in the mitochondrial sheath and the other in the fibrous sheath. Unlike the transmembrane adenylate cyclase located on the plasma membrane, the cytoplasm s AC can produce straight A second messenger of cAMP-dependent protein kinase located at these AKAP localizations. The cAMP generated by s AC and tmAC s can coordinate on a single signal or can propagate their respective signals.

 The soluble adenylate cyclase of the present invention and the mouse soluble adenylate cyclase have 34% identity and 51% similarity at the protein level, and they are shared by other members of the mouse soluble adenylate cyclase family. The various characteristic sequence fragments have similar biological functions, so the protein is considered to belong to the mouse soluble adenylate cyclase, and is named mouse soluble adenylate cyclase 25. This protein regulates various functions of sperm in the body, including maturation, swimming, and acrosome response. Abnormal expression of this protein will lead to impaired or lost male fertility. The protein is usually closely related to some related fertility diseases in men.

 As mentioned above, the mouse soluble adenylate cyclase 25 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, the identification of Most of the mouse soluble adenylate cyclase 25 proteins involved in these processes, especially the amino acid sequence of this protein was identified. Isolation of the new mouse soluble adenylate cyclase 25 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic agents for diseases, and is therefore isolated Its coding DNA is very important: the disclosure of the invention

 It is an object of the present invention to provide isolated novel polypeptides-mouse soluble adenylate cyclase 25 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a murine soluble adenylate cyclase 25.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a murine soluble adenylate cyclase 25.

 Another object of the present invention is to provide a method for producing a mouse soluble adenylate cyclase 25.

 Another object of the present invention is to provide antibodies against the polypeptide of the present invention-mouse soluble adenylate cyclase 25

 Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the mouse-soluble adenylate cyclase 25, which are polypeptides of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormality of murine soluble adenylate cyclase 25.

The present invention relates to an isolated polypeptide, which is of human origin, which comprises: SEQ ID No. 2 Amino acid sequence of a polypeptide, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID D. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 988-1677 in SEQ ID NO: 1; and (b) a sequence having 1-2355 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of murine soluble adenylate cyclase 25 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of a mouse soluble adenylate cyclase 25 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of murine soluble adenylate cyclase 25.

Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule When listed, such a "polypeptide" or "protein" is not meant to limit the amino acid sequence to the complete natural amino acid associated with the protein molecule.

A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, where the substituted amino acid has similar structural or chemical properties as the original amino acid, such as replacing isoleucine _t with leucine, and variants can also have non-conservative changes, such as color Glycine.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

 An "agonist" refers to a molecule that, when combined with a murine soluble adenylate cyclase 25, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to soluble adenylate cyclase 25.

 An "antagonist" or "inhibitor" refers to a molecule that can block or modulate the biological or immunological activity of mouse soluble adenylate cyclase 25 when combined with mouse soluble adenylate cyclase 25 . Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to murine soluble adenylyl cyclase 25.

 "Regulation" refers to a change in the function of the mouse soluble adenylate cyclase 25, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties and functions of the mouse soluble adenylate cyclase 25 Or changes in immune properties.

 "Substantially pure" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify murine soluble adenylate cyclase 25 using standard protein purification techniques. Basically pure mouse soluble adenylate cyclase 25 produces a single main band on a non-reducing polyacrylamide gel. The purity of the mouse soluble adenylate cyclase 25 polypeptide can be analyzed by amino acid sequence.

"Complementary" or "complementary" refers to polynucleotides that naturally bind through base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "CTGA" can be combined with the complementary sequence "GACT". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands The efficiency and strength of hybridization between nucleic acid strands has a significant effect.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.

 "Percent identity" refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P.M. Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A Number of interval residues in a sequence B

The percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645). ₀ "Similarity" refers to the amino acid sequence The degree of identical or conservative substitutions of amino acid residues at corresponding positions when aligning between them. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine:

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (& 13 ') ₂ and? ^ Its specific Antigenic determinants of sex-binding II soluble adenylyl cyclase 25.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated murine soluble adenylate cyclase 25" means that murine soluble adenylate cyclase 25 is substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify murine soluble adenylate cyclase 25 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the murine soluble adenylyl cyclase 25 polypeptide can be analyzed by amino acid sequence analysis.

 The present invention provides a new polypeptide, a mouse soluble adenylate cyclase 25, which is basically composed of SEQ

It is composed of the amino acid sequence shown in ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.

The invention also includes fragments, derivatives and analogs of murine soluble adenylate cyclase 25. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially retains the same biological function or activity of the mouse soluble adenylate cyclase 25 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic codon; or (II) such one, or A group on multiple amino acid residues is substituted by other groups to include substituents; or (in) a type in which the mature polypeptide is with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol) Fusion: or (IV) a polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) formed by fusion of an additional amino acid sequence into a mature polypeptide, as described herein, such that Fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2355 bases, and its open reading frame 988-1677 encodes 229 amino acids. Based on the amino acid sequence homology comparison, it was found that this polypeptide has 34% homology with the mouse soluble adenylate cyclase. It can be concluded that the soluble adenylate cyclase 25 is similar to the mouse soluble adenylate cyclase. Structure and function.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. This polynucleotide variant may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The present invention particularly relates to the present invention under strict conditions. The polynucleotide is a polynucleotide that can hybridize. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization L ° /。 Using denaturants, such as 50% (v / v) formamide, 0.1% calf serum / 0. l ° /. Ficoll, 42 ° C, etc .; or (3) Hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding murine soluble adenylyl cyclase 25.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the mouse soluble adenylate cyclase 25 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2.) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of the mouse soluble adenylate cyclase 25 transcript (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.

In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleosides Acid, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the method (4), the protein product of the mouse soluble adenylate cyclase 25 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

 A method of applying a PCR technique to amplify DNA / RNA (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by conventional methods such as dideoxy chain termination (Sanger et al. PNAS, 1977, 74: 5463-5467). Acid sequencing can also be performed using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a mouse soluble adenylate cyclase 25 coding sequence, and the recombinant technology to produce the Said method of polypeptide.

 In the present invention, the polynucleotide sequence encoding the mouse soluble adenylate cyclase 25 can be inserted into the vector to form a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125): pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a mouse soluble adenylate cyclase 25 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.

 Furthermore, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding a mouse soluble adenylate cyclase 25 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector. cell. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells: insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells, etc.-used Transformation of a host cell by a DNA sequence of the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the method of _{< 2} &_gt;. The steps used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 The polynucleotide sequence of the present invention can be used to express or produce recombinant mouse soluble adenylate cyclase 25 by conventional recombinant DNA technology (Science, 1984; 224: 1431). Generally there are the following:

(1) Using the polynucleotide (or variant) encoding human mouse and mouse soluble adenylate cyclase 25 of the present invention Body), or transform or transduce a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 Fig. 1 is a comparison diagram of the amino acid sequence homology between the mouse soluble adenylate cyclase 25 and the mouse soluble adenylate cyclase of the present invention. The upper sequence is mouse soluble adenylate cyclase 25 and the lower sequence is mouse soluble adenylate cyclase. Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated mouse soluble adenylate cyclase 25. 25KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

 Example 1: Cloning of mouse soluble adenylate cyclase 25

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Using Quik mRNA Isolation Kit (Qiegene product) Isolate poly (A) mRNA from total RNA _c . 2ug poly (A) raRNA is reverse transcribed to form cDNA. A Smart cDNA cloning kit (purchased from Clontech) was used to insert the 00 ^ fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 α. The bacteria formed a cDNA library: Dye terminate cycle react ion Sequencing kit (Perk in-Elmer) and ABI 377 automatic sequencer (Perk in-Elmer) determined the sequences at the 5 'and 3' ends of all clones. The cDNA sequence of the foot was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0691all was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results show that the 0691all clone contains a full-length cDNA of 2355bp (as shown in Seq IDN0: 1), and a 690bp open reading frame (0RF) from 988bp to 1677bp, encoding a new protein (such as Seq ID NO: 2). We named this clone pBS-0691all, and the encoded protein was named mouse soluble adenylate cyclase 25. Example 2: Homologous search of cDNA clones

 The sequence of the mouse soluble adenylate cyclase 25 of the present invention and the protein sequence encoded by the same are applied using the Blast procedure if (Basiclocal Alignment search tool) [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], perform homology search in databases such as Genbank Swissport. The gene with the highest homology to the mouse soluble adenylate cyclase 25 of the present invention is a known mouse soluble adenylate cyclase 25, and its encoded protein has the accession number of AF08194L in Genbank. Shown in Figure 1, the two are highly homologous, their identity is 34%; similarity is 51%. Example 3: Cloning of the gene encoding the mouse soluble adenylate cyclase 25 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:

 Primerl: 5'- GGAAAAAGACATTTGGCAAGAAAG -3 '(SEQ ID NO: 3)

 Primer2: 5-AAAAAATAGTCTTTTATTTTGATA-3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp at the 5 'end of SEQ ID NO: 1;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification reaction conditions: 50 ol / L KC1, 10mmol / L Tris-Cl, (pH8.5), 1.5mmol / L MgCi 200 μmol / L dNTP, lOpmol primer, 1U in 50 μ 1 reaction volume Taq DNA polymerase (product of C 1 on tech), 25 cycles on the PE 9600 DN A thermal cycler (Perki n-E 1 me r) under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 C 2min. During RT-PCR, β-actin was set as a positive control and template blank was set as a negative control. Amplification products were purified using QIAGEN kits and TA The cloning kit was ligated to a pCR vector (Invitrogen). DNA sequence analysis showed that the DNA sequence of the PCR product was exactly the same as that of 1-2355bp shown in SEQ ID NO: 1. Example 4: Northern blot analysis of mouse soluble adenylate cyclase 25 gene expression:

Total RNA was extracted by a one-step method [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ), After mixing, aspirate the aqueous phase layer by centrifugation, add isopropyl alcohol (0.8 vol) and centrifuge the mixture to obtain RNA pellet. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. With 20 μ ₈ RNA containing 20mM 5- (N- morpholino) propanesulfonic acid (pH7.0) - ImM EDTA-2.2M performed on a 1.2% agarose formaldehyde gel electrophoresis - 5mM sodium acetate. It was then transferred to a nitrocellulose membrane. Using a- ³² P dATP to prepare labeled DNA probes by random primer method ₌ The DNA probe used is the PCR-amplified mouse soluble adenylate cyclization § | 25 coding region sequence (988bp to 1677bp) shown in Figure 1 . A 32P-labeled probe (approximately 2 x 10 ⁶ cpm / ml) and an RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM KH ₂ PO, (pH7.4)-5 x SSC-5 x Denhardt's solution and 200 μ _§ / ιη1 salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 5: In vitro expression, isolation and purification of recombinant mouse soluble adenylate cyclase 25

 According to SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers was designed, the sequence is as follows:

Primer3: 5'- CCCCATATGATGGTCTGTTTCAACATGGGACGT -3 '(Seq ID No ::) Primer4: 5'- CATGGATCCTTAAACAGGTCCCACTGTGATTCC -3, (Seq ID No: 6) The 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively. The coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively. The Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site. The pBS-0691all plasmid containing the full-length target gene was used as a template for the PCR reaction. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of pBS-0691all plasmid, primers Primer-3 and Primer- 4 points, and ¹ J was lOpmol, Advantage polymerase Mix (Cloruech) 1 μ1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min. A total of 25 cycles. Nd e I and BamH I were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into the colibacillus DH5α by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 μ _§ / ηι1), positive clones were selected by colony PCR method and sequenced. Select positive clones with correct sequence (pET-0691all) to transform the recombinant plasmid into the large intestine by calcium chloride method Bacterium BL21 (DE3) plySs (product of Novagen). In LB liquid medium containing kanamycin (final concentration 30 μg / ml), the host bacteria BL21 (pET-0691all) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L. Continue incubation for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidine (6His-Tag). Purified the target protein of mouse soluble adenylate cyclase 25. After SDS-PAGE electrophoresis, a single band was obtained at 25 KDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Production of anti-mouse soluble adenylyl cyclase 25 antibody

 Polypeptide synthesizer (product of PE company) was used to synthesize the following mouse soluble adenylate cyclase 25-specific peptides:

 NH2-Met-Val-Cys-Phe-Asn-Met-Gly-Arg-I le-Thr-Leu-Ala-Lys-Lys-Leu- C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. In Li nochemistry, 1969; 6: 43. Immunize the patient with 4 mg of the hemocyanin peptide complex and complete Freund's adjuvant. After 15 days, use the hemocyanin peptide complex and incomplete Freund's adjuvant to boost the immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in serum-free serum. Protein A-Sepharose was used to isolate total IgG from antibody-positive home-immunized serum. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody specifically binds to murine soluble adenylyl cyclase 25. Example 7: Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in pathological tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Soutliern blotting, Northern blotting, and copying methods, etc., all of which fix the polynucleotide sample to be tested on the filter Substantially identical step-hybridization was applied after membrane. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washes. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

2.The GC content is 30½-70%, and the non-specific hybridization will increase if it exceeds;

 3, there should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their The complementary regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used in general;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5-TGGTCTGTTTCAACATGGGACGTATCACTTTAGCCAAAAAA -3 '(SEQ ID NO: 8) Probe 1 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):

5'- TGGTCTGTTTCAACATGGGACGTATCACTTTAGCCAAAAAA -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not listed in the following specific experimental steps, please refer to the literature: PROBES GH Keller; MM Manak; Stockton Pres s , 1989 0JSA) and more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press. Sample Preparation:

1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the precipitate (about 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mmol / LnaCl; 25 mmol / L MgCl ₂ ). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1-5ml per 0.1 g of the original tissue sample), and centrifuge at 1000g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add 1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, phenol extraction method for DNA

Steps: 1) Wash the cells with 1-10ml cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells (1 X 10 ⁸ cells / ml) with cold cell lysate and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 0) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DNA to a new tube. The DNA was then purified and ethanol precipitated.

3. Purification of DNA and ethanol precipitation

 Steps: 1) Add 1/10 volume of 2moL / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Store at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the precipitate to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or suck with a dropper while gradually increasing TE, mix until the DNA is fully dissolved, every 1-5 x 10. Approximately lul was extracted from the cells.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution. The final concentration is 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K, the final concentrations are 0.5% and 100ug / ml. Incubate at 37 C for 30 minutes. 10) use An equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) was used to extract the reaction solution and centrifuged for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the water phase, mix 1/10 volume of 2mol / L sodium acetate and 2.5 volume of cold ethanol, and mix well at -20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A _2S . To detect the purity and yield of DNA. 15) Store at -20 after packing. C. Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number lightly with a pencil. Two NC membranes are needed for each probe for subsequent experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

 2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5raol / L Tris-HCl (pH7.0), 3raol / LNaCl Allow to dry for 5 minutes (twice).

 4) Caught in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.10D / 10 μ 1), add 2 μ IKinase buffer, 8-10 uCi γ- ³² P- dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) 37 Ό Incubate for 2 hours.

 3) Add 1Z5 volume of bromophenol blue indicator (BPB I

 4) Pass through a Sephadex G-50 column.

5) Start to collect the first peak before ³² P-Probe washes out (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) After combining the collection solutions of the first peak, the ³² P-Probe (the second peak is free γ--dATP) is prepared.

 Pre-hybridization

 Put the sample membrane in a plastic bag, add 3-10 mg of pre-hybridization solution (lOxDenhardfs; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).), Seal the bag, and shake at 68 ° C for 2 hours in a water bath .

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

High-intensity washing film: 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 4) In 0.1xSSC, 0.1% SDS, wash at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 4) 0.1xSSC, 0.1 ° /. In SDS, wash at 40 ° C for 15 minutes (twice) and dry at room temperature.

X-ray autoradiography:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

 釆 The hybridization experiments performed under low-intensity membrane washing conditions did not differ significantly in the radioactivity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of hybridization spots of probe 1 was obvious Stronger in radioactivity than the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1.

Example 8 DNA Microarray

 Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and acupoint pharmaceutical companies. They refer to the orderly and high-density arrangement of large numbers of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific steps of this method have been reported in the literature. For example, see the literature DeRisi, JL, Lyer, V. & Brown. P.0. M., Chai, A., Shalom. D .. (1997) PNAS 94: 2150-2155.

 (A) spotting

Prepare a total of 4,000 polynucleotide sequences of different full-length cDNAs as target DNA, including the present invention Polynucleotide. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 μπι. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. Q.2% SDS wash for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (2) Probe marking

 Total mRNA was extracted from normal liver and liver cancer by one-step method, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen). The fluorescent reagent Cy3dUTP (5-Amino-propargy 1-2 · -deoxyuri) was separately reverse-transcribed. dine 5'-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech company) labeled mRNA of normal liver tissue, using a fluorescent reagent Cy5dUTP (5-Araino-propargy 1-2 · -deoxyur i dine 5'-tr iphate coupled to Cy5 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification. For specific steps and methods, see:

Schena,

 M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614- 10619. Schena, M., Shalon, Dar i., Davi s, RW (1995 ) Science. 270. (20): 467-480.

(Three) cross

 The probes from the two types of tissues and the chips were hybridized in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000. Scanner (purchased from General Scanning Company, USA) for scanning. The scanned image was processed by Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point. The point where the ratio is less than 0.5 and greater than 2 is considered. Genes with differential expression.

The experimental results show that Cy3signal = 2949.65 (take the average of four experiments Value), Cy5 si gna l = 3880. 18 (average of four experiments), Cy3 / Cy5 = 0. 76018, there is no significant difference in the expression of the polynucleotide of the present invention in the above two tissues. Industrial applicability

 The polypeptides of the present invention, as well as the antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.

 Soluble adenylyl cyclase is found in mammalian testes, and its activity is different from that of transmembrane adenylyl cyclase and soluble guanylyl cyclase in testes in terms of biochemistry and chromatography. Soluble adenylyl cyclase is preferentially expressed in the testis, and is also expressed in post-meiotic germ cells. These tissues have a high concentration of endogenous ATP that maintains the activity of soluble adenylyl cyclase.

 The study found that the limitation of s AC localization indicates that it is related to male fertility, such as various functions of sperm, including maturation, swimming, and acrosome response.

 The polypeptide of the present invention and the mouse soluble adenylyl cyclase are homologous proteins, and contain characteristic sequences of the soluble adenylyl cyclase family, both of which have similar biological functions. It has a variety of important functions in the body, regulating the normal transmission of the signal system in the body, especially regulating the functions of sperm, including maturation, swimming, and acrosome response. Abnormal expression will cause a variety of physiological disorders, especially Sperm dysfunction and associated diseases.

 It can be seen that the abnormal expression of the mouse soluble adenylate cyclase 25 of the present invention will produce various diseases, especially sperm disease, various tumors, embryonic developmental disorders, growth and development disorders, inflammation, and immune diseases. These diseases include, but are not limited to:

 Sperm disease: seminoma, male infertility

 Tumors of various tissues: stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma, embryonic developmental disorders Symptoms: Congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital hearing loss

 Growth and development disorders: mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation

Inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebral spinal cord Multiple sclerosis, Glomerulonephritis, Myocarditis, Cardiomyopathy, Atherosclerosis, Gastric ulcer, Cervicitis, Various infectious inflammations

 Immune diseases: Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome

 Abnormal expression of the mouse soluble adenylate cyclase 25 of the present invention will also produce certain hereditary, hematological diseases, etc.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially sperm diseases, various tumors, embryonic development disorders, growth disorders, Inflammation, immune diseases, some hereditary, blood diseases, etc. The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) mouse soluble adenylate cyclase 25. Agonists increase biological functions such as mouse soluble adenylate cyclase 25, which stimulates cell proliferation, and antagonists prevent and treat disorders related to cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing murine soluble adenylate cyclase 25 can be cultured with labeled murine soluble adenylate cyclase 25 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of murine soluble adenylate cyclase 25 include antibodies, compounds, receptor deletions, and the like that have been screened. An antagonist of murine soluble adenylate cyclase 25 can bind to murine soluble adenylate cyclase 25 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the Peptides cannot perform biological functions.

 When screening compounds as antagonists, murine soluble adenylate cyclase 25 can be added to the bioanalytical assay by measuring the effect of the compound on the interaction between murine soluble adenylate cyclase 25 and its receptor. Determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to mouse soluble adenylate cyclase 25 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the mouse soluble adenylyl cyclase 25 molecule should generally be labeled.

The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against a murine soluble adenylyl cyclase 25 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries. Polyclonal antibodies can be produced by injecting mouse soluble adenylate cyclase 25 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on. Techniques for preparing monoclonal antibodies to mouse soluble adenylate cyclase 25 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta cell hybridoma technology , EBV-hybridoma technology, etc. Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). ₀ Existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against mouse soluble adenylate cyclase 25.

 Antibodies against mouse soluble adenylate cyclase 25 can be used in immunohistochemical techniques to detect I soluble adenylate cyclase 25 in biopsy specimens.

 Monoclonal antibodies that bind to murine soluble adenylyl cyclase 25 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. Such as mouse soluble adenylate cyclase 25 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill mouse soluble adenylate cyclase 25 Positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to murine soluble adenylate cyclase 25. Administration of an appropriate dose of antibody can stimulate or block the production or activity of murine soluble adenylate cyclase 25.

 The invention also relates to a diagnostic test method for quantitatively and locally detecting the level of mouse soluble adenylate cyclase 25. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of mouse soluble adenylate cyclase 25 detected in the test can be used to explain the importance of mouse soluble adenylate cyclase 25 in various diseases and to diagnose mouse soluble adenylate cyclase 25 A working disease.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

Polynucleotides encoding murine soluble adenylyl cyclase 25 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by non-expression or abnormal / inactive expression of murine soluble adenylate cyclase 25. Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant murine soluble adenylate cyclase 25 to inhibit endogenous murine soluble adenylate cyclase Ase 25 activity. For example, a variant murine soluble adenylate cyclase 25 may be a shortened murine soluble adenylate cyclase 25 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signal transduction. active. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of soluble adenylate cyclase 25 in mice. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding a mouse soluble adenylate cyclase 25 into a cell. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a murine soluble adenylate cyclase 25 can be found in the existing literature (Sambrook, eta l.). In addition, a recombinant polynucleotide encoding murine soluble adenylate cyclase 25 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit murine soluble adenylate cyclase 25 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DM, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

 Polynucleotides encoding murine soluble adenylate cyclase 25 can be used to diagnose diseases related to murine soluble adenylate cyclase 25. Polynucleotides encoding murine soluble adenylate cyclase 25 can be used to detect the expression of murine soluble adenylate cyclase 25 or abnormal expression of murine soluble adenylate cyclase 25 in disease states. For example, a DNA sequence encoding mouse soluble adenylate cyclase 25 can be used to hybridize biopsy specimens to determine the expression of mouse soluble adenylate cyclase 25. Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array (Mic roa rray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genes in tissues diagnosis. RM-polymerase chain reaction (RT-PCR) in vitro amplification with mouse-specific adenylate cyclase 2 5 specific primers can also detect the transcripts of mouse soluble adenylate cyclase 25.

Detection of murine soluble adenylate cyclase 25 mutations can also be used to diagnose murine soluble adenylate cyclase 25 related diseases. The forms of murine soluble adenylate cyclase 25 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type murine soluble adenylate cyclase 25 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in cDNA or genomic sequences between the affected and the affected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technology, the c.DNA that is accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping capability and every 20 kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Murine soluble adenylyl cyclase 25 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of mouse soluble adenylate cyclase 25 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Claim

1. An isolated polypeptide-mouse soluble adenylate cyclase 25, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or an active fragment, analog or derivative of a polypeptide thereof .

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 1, further comprising a polypeptide having an amino acid sequence represented by SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: (a) encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, or an analog thereof; Polynucleotides of derivatives;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 988-1677 in SEQ ID NO: 1 or the sequence of positions 1-2355 in SEQ ID NO: 1. .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having mouse soluble adenylate cyclase 25 activity, characterized in that the method includes:

 (a) culturing the engineered host cell according to claim 8 under conditions that express mouse soluble adenylate cyclase 25;

 (b) A polypeptide having murine soluble adenylyl cyclase 25 activity is isolated from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to murine soluble adenylate cyclase 25.

1 1. A class of compounds that mimic or regulate the activity or expression of polypeptides, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of murine soluble adenylate cyclase 25.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

1 3. A use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of murine soluble adenylate cyclase 25 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of murine soluble adenylate cyclase 25; or For identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or used to make a gene Chip or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormality of murine soluble adenylate cyclase 25.

18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that the polypeptide, polynucleotide or compound is used for preparing a treatment such as a malignant tumor, Hematological diseases, HIV infection and immune diseases and drugs of various inflammations.