WO2001075013A2 - Nouveau polypeptide, kinase humaine cycline-dependante 14, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, kinase humaine cycline-dependante 14, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001075013A2
WO2001075013A2 PCT/CN2001/000322 CN0100322W WO0175013A2 WO 2001075013 A2 WO2001075013 A2 WO 2001075013A2 CN 0100322 W CN0100322 W CN 0100322W WO 0175013 A2 WO0175013 A2 WO 0175013A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
dependent kinase
human cyclin
sequence
Prior art date
Application number
PCT/CN2001/000322
Other languages
English (en)
Chinese (zh)
Other versions
WO2001075013A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU50239/01A priority Critical patent/AU5023901A/en
Publication of WO2001075013A2 publication Critical patent/WO2001075013A2/fr
Publication of WO2001075013A3 publication Critical patent/WO2001075013A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, namely a human cyclin-dependent kinase 14, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Background technique
  • the cyclin family and the cyclin-dependent kinase (Cdk) family are two important, related cycle-regulating enzyme families. Cdks and cyclins combine to form a heterodimer complex with protein kinase activity. It consists of catalytic subunit and modulating Yao. Cyclin is a regulatory subunit and Cdk is a catalytic subunit. Only after binding to the corresponding cyclin, some protein kinases such as weel / mikl, CAK (Cdk-act ivating kinase) and phosphatase p80 etk25 participate in phosphorylation and dephosphorylation to show kinase activity. Cdk-cyclin complex can be involved in phosphorylation of many proteins to regulate many molecular events related to DNA replication and mitosis.
  • Cdk family members include Cdkl, Cdk2, Cdk3, Cdk4, Cdk5, Cdk6, Cdk7 and so on.
  • Each CDk combines a different type of cyclin.
  • the coordination between the Cdk family and members of the cyclin family regulates the various processes of cells from Gl-S, G2-M, and exit mitosis.
  • complexes such as Cdk4 and D-type cyclins mainly function at the R point of G1 phase.
  • Cdk2 binds to cyclin D and cyclin E in G1 and early S, respectively, and acts on the onset of G1 / S and S.
  • CDK8 is a new CDK protein found in humans. Experiments show that CDK8 can combine with cyclinC to form a protein complex similar to SRBIO-SRB11.
  • the CDK-cyclin complex, SRB10-SRB11 is part of the total enzyme of RNA polymerase II in yeast. Therefore, it can be considered that human CDK8 may play a certain role in transcription and a certain role in the transmission of growth factor-regulatory signals.
  • the human cyclin-dependent kinase 1 4 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so the identification of more involved in these has been required in the art.
  • the process of the human cyclin-dependent kinase 1 4 protein in particular, identifies the amino acid sequence of this protein.
  • the isolation of new human cyclin-dependent kinase 1 4 protein-coding genes also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human cyclin-dependent kinase 1 4.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human cyclin-dependent kinase 14.
  • Another object of the present invention is to provide a method for producing human cyclin-dependent kinase 14.
  • Another object of the present invention is to provide an antibody against the polypeptide-human cyclin-dependent kinase 1 4 of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of human cyclin-dependent kinase 14 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human cyclin-dependent kinase 1 4.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • polynucleotide complementary to polynucleotide (a);
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 291 to 680 in SEQ ID NO: 1; and (b) a sequence having 1 to 988 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human cyclin-dependent kinase 14 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of a human cyclin-dependent kinase 14 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of malignant tumors, hematological diseases, developmental disorders, HIV infection and immune diseases and various types of inflammation or other abnormal expressions due to human cyclin-dependent kinase 14. Use of medicines that cause disease.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human cyclin-dependent kinase 14, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human cyclin-dependent kinase 14.
  • Antagonist refers to a molecule that blocks or regulates the biological or immunological activity of human cyclin-dependent kinase 14 when combined with human cyclin-dependent kinase 14.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human cyclin-dependent kinase 14.
  • Regular refers to a change in the function of human cyclin-dependent kinase 14, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune changes in human cyclin-dependent kinase 14 .
  • Those skilled in the art can purify human cyclin-dependent kinase 14 using standard protein purification techniques. Basically Pure human cyclin-dependent kinase 14 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human cyclin-dependent kinase 14 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require two sequences Columns are bound to each other as specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100
  • the number of residues in sequence A-the number of spacer residues in sequence A B is a spacer sequence of residues may be measured as Jotun Hein percent identity between nucleic acid sequences or by using Cluster method known in the art (Hein J., (1990) methods in emzumology 183: 625-645) 0 "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It specifically binds to the epitope of human cyclin-dependent kinase 14.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is in the same or all of the natural systems. Separation of matter that coexists with it is separation.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human cyclin-dependent kinase 1 4" is that human cyclin-dependent kinase 14 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated.
  • Those skilled in the art can purify human cyclin-dependent kinases using standard protein purification techniques. Substantially pure peptides produce a single main band on a non-reducing polyacrylamide gel. The purity of the human cyclin-dependent kinase 14 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human cyclin-dependent kinase 14, which basically consists of the amino acid sequence shown in SEQ ID D0: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human cyclin-dependent kinase 14.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human cyclin-dependent kinase 1 4 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes SEQ ID NO: 1 Nucleotide sequence.
  • Polynucleotides of the invention are found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 988 bases, and its open reading frames 291-680 encode 129 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to human CDK8, and it can be deduced that the human cyclin-dependent kinase 14 has similar functions to human CDK8.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 ° /.
  • hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ T D NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 1 00 nucleotides or more.
  • Nucleic acid fragments can also be used for nucleic acid amplification Addition techniques (such as PCR) to identify and / or isolate polynucleotides encoding human cyclin-dependent kinase 14.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human cyclin-dependent kinase 14 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect multinucleated clones with common scab characteristics Nucleotide fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sanibrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) determining the level of human cyclin-dependent kinase 14 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human cyclin-dependent kinase 14 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method of amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human cyclin-dependent kinase 14 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .
  • a polynucleotide sequence encoding human cyclin-dependent kinase 14 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • An expression vector for DNA sequences and appropriate transcriptional / translational regulatory elements include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
  • Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancement on the late side of the origin of replication And adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human cyclin-dependent kinase 14 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS, or Bowes s melanoma cells, etc. .
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human cyclin-dependent kinase 14 (Scence, 1 984; 224: 1 431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Cultivate under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include but Not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmosis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmosis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High performance liquid chromatography (HPLC
  • Fig. 1 is a comparison diagram of gene chip expression profiles of human cyclin-dependent kinase and human CDK8 of the present invention.
  • the upper graph is a graph of the expression profile of human cyclin-dependent kinase 14, and the lower graph is the graph of the expression profile of human CDK8.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human cyclin-dependent kinase 14.
  • 14KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band. The best way to implement the invention
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragments into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5 cx. The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0513h02 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5,-GTACTATTATCTGATATTTATATT-3, (SEQ ID NO: 3)
  • Primer2 5,-TACCCTTGATTTATTAAAATTCAT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l reaction volume in 50 ⁇ l containing 50 ol / L KC1, 10mmol / L Tris-CI, (pH8.5), 1.5mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol Primer, 1U of Taq DNA polymerase (C 1 on Tech).
  • the reaction was performed on a PE 9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-988bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human cyclin-dependent kinase 14 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA probes were the PCR amplified human cyclin-dependent kinase 14 coding region sequence (291bp to 680bp) shown in FIG. 1.
  • a 32P-labeled probe (approximately 2 ⁇ 10 6 cpm / ml) and a nitrocellulose membrane to which RNA was transferred were placed in a solution at 42 ° C. C hybridization overnight, this solution contains 50% formamide-25 mM KH 2 P0 4 (pH 7.4)-5 x SSC-5 x Denhardt's solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DNA. After hybridization, place the filter at 1 x SSC-0.1 ° /. Wash in SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human cyclin-dependent kinase 14
  • Primer3 5 a CCCCATATGATGCTCTCGACAGATGCTGTCTTC G- 3, (Seq TD No: 5)
  • Priraer4 5,-CATGGATCCTCAGTTAACCCTCAATACTCTGTA -3, (Seq ID No: 6)
  • Ndel and BamHI restriction sites correspond to the selectivity on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Endonuclease site.
  • PCR was performed using the pBS-0513h02 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing pBS- 0513h02 plasmid 10pg,
  • the ligation product was transformed into coliform bacteria DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR method and sequenced. A positive clone (pET-0513h02) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) by the calcium chloride method.
  • the host BUI pET-0513h02
  • IPTG was added to a final concentration of 1 mmol / L, and continued Incubate for 5 hours.
  • the cells were collected by centrifugation, and the supernatant was collected by centrifugation.
  • the supernatant was collected by centrifugation.
  • the purified human cyclin-dependent kinase 14 was purified.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human cyclin-dependent kinase 14-specific peptides: NH2-Met-Leu-Ser-Thr-Asp-A 1 a-Va 1-Phe-A 1 aG 1 yA 1 a- Me t- Pr o- Thr- Me t-COOH
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods, etc. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • the preferred range of probe size is 1 8-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • DNA purification and ethanol precipitation Steps 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol.
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • pre-hybridization solution 10xDenhardt-s; 6xSSC, 0.1mg / ml CT DNA (calf thymus DNA).
  • Gene microarrays or DNA microarrays are currently used by many national laboratories and pharmaceutical companies.
  • the companies are starting to develop and develop a new technology. It refers to arranging a large number of target gene fragments in an orderly and high density on a carrier such as glass and silicon, and then using fluorescence detection and computer software to compare and analyze the data.
  • a carrier such as glass and silicon
  • fluorescence detection and computer software to compare and analyze the data.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian, USA). The distance is 280 ⁇ . The spotted slide was hydrated, dried, and cross-linked in a UV cross-linker. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spotting processing steps of this embodiment are:
  • the probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (lx SSC, 0.2% SDS) at room temperature and scanned with ScanArray 3000.
  • the instrument purchased from General Scanning Company, USA
  • the scanned images were analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these Cy3 / Cy5 ratios, a bar graph is drawn. (figure 1 ) . It can be seen from the figure that the expression profiles of human cyclin-dependent kinase 14 and human CDK8 according to the present invention are very similar. Industrial applicability
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Cyclins combine with cyclin-dependent kinases to form complexes with protein kinase activity. This complex can be involved in phosphorylation of many proteins to regulate many molecular events related to DNA replication and mitosis.
  • CDK8 may play a role in transcription and a role in the transmission of growth factor-regulatory signals.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human cyclin-dependent kinase (Cdk), and the two have similar biological functions. It is involved in the phosphorylation of a variety of proteins in the body to regulate many molecular events related to DNA replication and mitosis. Its abnormal expression is usually associated with some related disorders of material metabolism disorders, diseases of protein metabolism disorders and related tissue tumors and cancers. The occurrence is closely related and produces related diseases.
  • Cdk human cyclin-dependent kinase
  • the abnormal expression of the human cyclin-dependent kinase 14 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, disorders of growth and development, inflammation, and immune diseases. These diseases include, but are not limited to:
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • Abnormal expression of the human cyclin-dependent kinase 1 4 of the present invention will also produce certain hereditary, hematological diseases, and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, immunity Sexual diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) the human cycle protein dependent kinase 1 4.
  • Agonists enhance human cyclin-dependent kinases to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human cyclin-dependent kinase 1 4 can be cultured with labeled human cyclin-dependent kinase 1 4 in the presence of a drug. The ability of the drug to increase or suppress this interaction is then determined.
  • Antagonists of human cyclin-dependent kinase 14 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human cyclin-dependent kinase 14 can bind to human cyclin-dependent kinase 1 4 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions . When screening compounds as antagonists, human cyclin-dependent kinase 14 can be added to bioanalytical assays to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human cyclin-dependent kinase 14 and its receptor .
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human cyclin-dependent kinase 14 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human cyclin-dependent kinase 14 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the human cyclin-dependent kinase 14 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human cyclin-dependent kinase 14 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
  • Techniques for preparing monoclonal antibodies to human cyclin-dependent kinase 1 4 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta cells Hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrie et al, PNAS, 1985, 81: 685 1).
  • the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human cyclin-dependent kinase 14.
  • Anti-human cyclin-dependent kinase 14 antibodies can be used in immunohistochemical techniques to detect human cyclin-dependent kinases 14 in biopsy specimens.
  • Monoclonal antibodies that bind to human cyclin-dependent kinases can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human cyclin-dependent kinase 14 high-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human cyclin-dependent kinase 14 positive cells .
  • the antibodies of the present invention can be used to treat or prevent diseases related to human cyclin-dependent kinase 14. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human cyclin-dependent kinase 14.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human cyclin-dependent kinase 14. Law. These tests are well known in the art and include FI SH assays and radioimmunoassays. The levels of human cyclin-dependent kinase 14 detected in the test can be used to explain the importance of human cyclin-dependent kinase 14 in various diseases and to diagnose diseases in which human cyclin-dependent kinase 14 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human cyclin-dependent kinase 14 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human cyclin-dependent kinase 14.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human cyclin-dependent kinases 14 to inhibit endogenous human cyclin-dependent kinase 14 activity.
  • a mutated human cyclin-dependent kinase 14 may be a shortened human cyclin-dependent kinase 14 lacking a signal transduction domain.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human cyclin-dependent kinase 14.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer polynucleotides encoding human cyclin-dependent kinases into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding human cyclin-dependent kinase 14 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human cyclin-dependent kinase 14 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human cyclin-dependent kinase 1 4 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human cyclin-dependent kinase 1 4 can be used for the diagnosis of diseases related to human cyclin-dependent kinase 1 4.
  • Polynucleotide encoding human cyclin-dependent kinase 14 can be used to detect the human cycle Expression of Protein-dependent Kinase 14 or Abnormal Expression of Human Cyclin-dependent Kinase 14 in a Disease State.
  • a DNA sequence encoding human cyclin-dependent kinase 14 can be used to hybridize biopsy specimens to determine the expression of human cyclin-dependent kinase 14.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human cyclin-dependent kinase 14 specific primers can also be used to detect RNA-polymerase chain reaction (RT-PCR) in vitro amplification of human cyclin-dependent kinase 14 transcripts.
  • Human cyclin-dependent kinase 14 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human cyclin-dependent kinase 14 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data.
  • These data can be found in, for example, V. Mckusick, Mendel ian Nher i tance in Man (available through contact with Johns Hopkins Uni vers i ty Welch Medical
  • Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human cyclin-dependent kinase 14 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human cyclin-dependent kinase 14 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une kinase humaine cycline-dépendante 14, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, des troubles du développement, de l'infection par VIH, des maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la kinase humaine cycline-dépendante 14.
PCT/CN2001/000322 2000-03-17 2001-03-16 Nouveau polypeptide, kinase humaine cycline-dependante 14, et polynucleotide codant pour ce polypeptide WO2001075013A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU50239/01A AU5023901A (en) 2000-03-17 2001-03-16 A novel polypeptide, cycline-dependent human kinase 14 and the plynucleotide encoding the polypeptide

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 00114983 CN1314478A (zh) 2000-03-17 2000-03-17 一种新的多肽——人周期蛋白依赖激酶14和编码这种多肽的多核苷酸

Publications (2)

Publication Number Publication Date
WO2001075013A2 true WO2001075013A2 (fr) 2001-10-11
WO2001075013A3 WO2001075013A3 (fr) 2002-03-21

Family

ID=4584454

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000322 WO2001075013A2 (fr) 2000-03-17 2001-03-16 Nouveau polypeptide, kinase humaine cycline-dependante 14, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1314478A (fr)
AU (1) AU5023901A (fr)
WO (1) WO2001075013A2 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5814503A (en) * 1996-01-05 1998-09-29 Eli Lilly And Company Fusion proteins comprising cell cycle regulatory proteins
US6015692A (en) * 1994-06-02 2000-01-18 Mitotix, Inc. CDC37 cell-cycle regulatory protein and uses related thereto

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6015692A (en) * 1994-06-02 2000-01-18 Mitotix, Inc. CDC37 cell-cycle regulatory protein and uses related thereto
US5814503A (en) * 1996-01-05 1998-09-29 Eli Lilly And Company Fusion proteins comprising cell cycle regulatory proteins

Also Published As

Publication number Publication date
WO2001075013A3 (fr) 2002-03-21
CN1314478A (zh) 2001-09-26
AU5023901A (en) 2001-10-15

Similar Documents

Publication Publication Date Title
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001092319A1 (fr) NOUVEAU POLYPEPTIDE, RECEPTEUR HUMAIN 19.68 DE L'INTERFERON α, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2001075013A2 (fr) Nouveau polypeptide, kinase humaine cycline-dependante 14, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001075023A2 (fr) Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001074876A1 (fr) Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2002000823A2 (fr) Nouveau polypeptide, proteine d'activation enzymatique ras gtp 9.57, et polynucleotide codant ce polypeptide
WO2001055414A1 (fr) Nouveau polypeptide, proteine rgs 17, et polynucleotide codant pour ce polypeptide
WO2001064721A1 (fr) Nouveau polypeptide, adenosine triphosphatase 30, et polynucleotide codant pour ce polypeptide
WO2001079280A1 (fr) Nouveau polypeptide, proteine humaine 16 associee au represseur catabolique du carbone, et polynucleotide codant pour ce polypeptide
WO2001068692A1 (fr) Nouveau polypeptide, proteine humaine conjuguee du cancer de la retine 9, et polynucleotide codant pour ce polypeptide
WO2001081392A1 (fr) Nouveau polypeptide, phosphoproteine nucleolaire humaine 13, et polynucleotide codant pour ce polypeptide
WO2001070983A1 (fr) Nouveau polypeptide, proteine antigene prostatique specifique membranaire 9, et polynucleotide codant pour ce polypeptide
WO2001079437A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2001070960A1 (fr) Nouveau polypeptide, proteine humaine de reparation 13 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2002020775A1 (fr) Nouveau polypeptide, proteine kinase cycline-dependante cdk411, et polynucleotide codant ce polypeptide
WO2001072802A1 (fr) Nouveau polypeptide, proteine humaine de liaison 14 d'une proteine precurseur de l'amyloide, et polynucleotide codant pour ce polypeptide
WO2001066589A1 (fr) Nouveau polypeptide, element de beta-transduction 11, et polynucleotide codant pour ce polypeptide
WO2001081536A2 (fr) Nouveau polypeptide, proteine kinase ysk1 humaine 10, et polynucleotide codant pour ce polypeptide
WO2001083728A1 (fr) Nouveau polypeptide, proteine humaine de transport d'acides amines excitateurs 9, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP