WO2001072790A1 - Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001072790A1
WO2001072790A1 PCT/CN2001/000417 CN0100417W WO0172790A1 WO 2001072790 A1 WO2001072790 A1 WO 2001072790A1 CN 0100417 W CN0100417 W CN 0100417W WO 0172790 A1 WO0172790 A1 WO 0172790A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
protein
polynucleotide
factor
human
Prior art date
Application number
PCT/CN2001/000417
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2001250271A priority Critical patent/AU2001250271A1/en
Publication of WO2001072790A1 publication Critical patent/WO2001072790A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human L1 factor p40 protein 12, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
  • the L1 factor can be found in all mammalian genomes and is involved in the reverse transcription process. It is a highly repetitive DNA sequence. Although there are many L1 factors in the human genome, most of them are inactive due to truncation, rearrangement, and mutation. The L1 factor of many people has retrotransposition capabilities.
  • the 5 'end of the L1 factor is mostly a blunt-end structure, which is different from the general sticky-end structure, but does not affect its transcription integration process.
  • the 5'-end untranslated region (UTR) contains an internal promoter that regulates and controls the speed of the entire reverse transcription process.
  • the LRE2 site contains two complete open reading frames (0RF1 and 0RF2).
  • the 0RF1 frame encodes an approximately 40Kd embryonal cancer cell protein. No homologous or similar protein was found in the retrovirus.
  • the mouse 0RF1 protein mainly exists in the cytoplasm, and is dispersed and dispersed in the form of microparticles. It has no direct relationship with some other organelles in the cytoplasm, and is expressed side by side with the mRNA of L1 factor.
  • the ORF2 box has sequence similarities with reverse transcriptase and other retroviral proteins, and can mediate the reverse transcription process.
  • the inserted gene on LRE2 proved that the flanking sequence produced by the L1 factor during the read-through process can be reverse transcribed, because its tail has a different poly A structure.
  • the polypeptide of the present invention has 84% identity and 87% similarity with the p40 protein on the above-mentioned L1 factor, and contains the conservative sequence characteristic of the p40 protein. Therefore, this protein is considered to be a new type of embryonic cancer cell protein. It has a biological function similar to p40 protein and is named human L1 factor p40 protein 12.
  • the human L1 factor p40 protein 12 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more involved in these processes
  • the human L1 factor p40 protein 12 protein identifies the amino acid sequence of this protein. Isolation of the new human L1 factor p40 protein 12 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human L1 factor P 40 protein 12.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human L1 factor p40 protein 12.
  • Another object of the present invention is to provide a method for producing human L1 factor p40 protein 12.
  • Another object of the present invention is to provide antibodies against the polypeptide of the present invention, human L1 factor p40 protein 12.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human L1 factor p40 protein 12.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human L1 factor p40 protein 12. Invention grid.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1 069 to 1410 in SEQ ID NO: 1; and (b) a sequence having 1 in SEQ ID NO: 1 -1668-bit sequence.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a screen for simulation, activation, antagonism or inhibition of human L1 factor p40 protein 12 eggs
  • a method of white-active compounds comprising utilizing a polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of the human L1 factor p4 0 protein 12 protein in vitro, which comprises detecting a mutation in the polypeptide or a coding polynucleotide sequence thereof in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human L 1 factor p40 protein 12.
  • FIG 1 is a factor of the present invention, L1 and p40 protein 12 amino acid sequence homology comparing FIGS P 40 on the L protein 1 factor.
  • the upper sequence is the human L1 factor p40 protein 12, and the lower sequence is the p40 protein on the L1 factor.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human L1 factor p40 protein 12.
  • 12KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a protein or polynucleotide “variant” refers to a protein or polynucleotide that has one or more amino acid or nucleotide changes Amino acid sequence or polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human L1 factor p40 protein 12, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human L1 factor p40 protein 12.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human L1 factor p40 protein 12 when combined with human L1 factor p40 protein 12.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind the human L1 factor p40 protein 1 2.
  • “Regulation” refers to a change in the function of human L1 factor p40 protein 12, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immunological changes in human L1 factor P 40 protein 12. .
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human L1 factor p40 protein 12 using standard protein purification techniques.
  • the substantially pure human L1 factor p40 protein 12 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human L1 factor p40 protein 12 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits the hybridization of a completely complementary sequence to a target nucleic acid. Pay. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences.
  • the percentage identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.).
  • the MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0
  • the Cluster method arranges groups of sequences by checking the distance between all pairs. Into clusters. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art, such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b ') 2 and F V, which specifically binds to human factor p40 protein antigen 12 L1 determinant.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide exists in a living animal. It is not isolated, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human U factor p4 0 protein 12 refers to human L1 factor p40 protein 12 that is substantially free of other proteins, lipids, sugars, or other substances that are naturally associated with it.
  • Those skilled in the art can purify human L 1 factor p4 G protein 12 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on a non-reducing polyacrylamide gel. The purity of the human L1 factor p4 0 protein 1 2 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human L1 factor p40 protein 12, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of the human L1 factor p40 protein 12.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human L1 factor p40 protein 12 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of an amino acid encoding SEQ ID NO: 2 Polynucleotide composition of a polypeptide of the amino acid sequence.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1668 bases in length, and its open reading frame of 1069-141 0 encodes 113 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 84% homology with the p40 protein on the L1 factor. It can be concluded that the human L1 factor p40 protein 12 has a similar structure and function as the p40 protein on the L1 factor.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (there is at least 50% identity between the two sequences, preferably 70% identity).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • the invention also relates to nucleic acid fragments that hybridize to the sequences described above.
  • “core The "acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides. Nucleic acid fragments It can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human L1 factor p40 protein 12.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human L1 factor p40 protein 12 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of the transcript of human L1 factor p40 protein 12; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human L1 factor p40 protein 12 gene expression protein.
  • ELISA enzyme-linked immunosorbent assay
  • a method of amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention. Especially difficult to get from the library
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately selected according to the polynucleotide sequence information of the present invention disclosed herein, and conventional methods can be used. synthesis.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the human L1 factor p40 protein 12 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology. .
  • a polynucleotide sequence encoding the human L1 factor p40 protein 12 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human L1 factor p40 protein 12 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
  • Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 Base pairs, acting on a promoter to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human L 1 factor p4 0 protein 12 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S 2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes s melanoma cells Wait.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be harvested after exponential growth phase, with & (Treatment 1 2, procedure used are well known in the art.
  • Alternative is MgC l 2
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipid Body packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human L 1 factor p40 protein 12 (Scence, 1 984; 224: 14 31). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, or expressed on a cell membrane, or secreted Out of the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, H IV infection, and immune diseases.
  • the mammalian genome contains the L1 factor, which is a highly repetitive DNA sequence that can participate in the reverse transcription process. Human L1 factors often have the ability to retrotranspose.
  • the genome's LRE2 site contains two complete open reading frames (0RF1 and 0RF2), where the 0RF1 frame encodes an embryonic cancer cell protein, which is combined with the mRNA of the L1 factor.
  • the inserted gene on LRE2 proved that the flanking sequence produced by the L1 factor during the read-through process can undergo reverse transcription.
  • the polypeptide of the present invention and the L1 factor protein are homologous proteins and contain a characteristic sequence of the L1 factor protein family, and both have similar biological functions. It is more important for the transmission of cytogenetic information, and its expression abnormality is usually closely related to the development of diseases such as embryonic development disorders, inflammation, tumorigenesis, and the related diseases.
  • the abnormal expression of the human L1 factor p40 protein 12 of the present invention will produce various diseases, especially embryonic developmental disorders, growth and development disorders, various tumors, inflammations, and immune diseases. These diseases include but are not limited to :
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations Immune diseases: Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • Abnormal expression of the human L 1 factor p40 protein 12 of the present invention will also produce certain hereditary, hematological diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) the human L 1 factor p40 protein 12.
  • Agonists enhance human L1 factor p40 protein 12 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human L1 factor p40 protein 12 can be cultured together with labeled human L1 factor p40 protein 12 in the presence of drugs. The ability of the drug to increase or suppress this interaction is then determined.
  • Antagonists of human L1 factor p40 protein 12 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human L1 factor p 4 0 protein 12 can bind to human L1 factor p40 protein 12 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
  • human L 1 factor p4 0 protein 12 can be added to a bioanalytical assay to determine whether the compound is a compound by measuring the effect of the compound on the interaction between human L 1 factor p40 protein 12 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Polypeptide molecules capable of binding to human L 1 factor p4 0 protein 12 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, 12 molecules of the human L1 factor p40 protein should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human L1 factor p40 protein 12 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human L1 factor p40 protein 12 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
  • Techniques for preparing monoclonal antibodies to human L1 factor p40 protein 12 include, but are not limited to, hybridization Oncology technology (Kohler and Mistein. Nature, 1975, 256: 495-497), three-tumor technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human L1 factor p40 protein 12.
  • Antibodies against human L1 factor p40 protein 12 can be used in immunohistochemical techniques to detect human L1 factor p40 protein 12 in biopsy specimens.
  • Monoclonal antibodies that bind to human L1 factor p40 protein 12 can also be labeled with radioisotopes, and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human L1 factor p40 protein 12 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human L1 factor p40 protein 12 positive cells .
  • the antibodies in the present invention can be used to treat or prevent diseases related to the human L1 factor p40 protein 12.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human L1 factor p40 protein 12.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human L1 factor p40 protein 12.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the level of human L1 factor p40 protein 12 detected in the test can be used to explain the importance of human L1 factor p40 protein 12 in various diseases and to diagnose diseases in which human L1 factor p40 protein 12 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human L1 factor p40 protein 12 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human L1 factor p40 protein 12.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human L1 factor p40 protein 12 to inhibit endogenous human L1 factor p40 protein 12 activity.
  • a mutated human L1 factor p40 protein 12 may be a shortened human L1 factor p40 protein 12 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human L1 factor p40 protein 12.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, and adenovirus-related diseases Viruses, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human L1 factor p40 protein 12 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding the human L1 factor p40 protein 12 can be found in existing literature (Sambrook, et al.).
  • the recombinant polynucleotide encoding human L1 factor p40 protein 12 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human L1 factor p40 protein 12 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DM, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human U factor P 40 protein 12 can be used for diagnosis of diseases related to human L 1 factor p40 protein 12.
  • the polynucleotide encoding human L1 factor p40 protein 12 can be used to detect the expression of human L1 factor p40 protein 12 or the abnormal expression of human L1 factor p40 protein 12 in a disease state.
  • the DNA sequence encoding human L1 factor p40 protein 12 can be used to hybridize biopsy specimens to determine the expression of human L1 factor p40 protein 12.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human L1 factor p40 protein 12 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human L1 factor p40 protein 12 transcription products.
  • Detection of mutations in the human L1 factor p40 protein 12 gene can also be used to diagnose human L1 factor p40 protein 12-related diseases.
  • Human L1 factor p40 protein 12 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human L1 factor p40 protein 12 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated. The sequences of the invention are also valuable for chromosome identification.
  • This sequence will specifically target a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for labeling chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human L1 factor p40 protein 12 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human L1 factor P 40 protein 12 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDM cloning kit purchased from Clontech was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library.
  • the sequences at the 5 'and 3' ends of all clones were determined using Dye terminate cyc le reac t ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer).
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 1117 ⁇ 0 was a new DM.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • the 1117 0 clone contained a full-length cDNA of 1668 bp (as shown in Seq ID N0: 1), with a 342 bp open reading frame (0RF) from 1069 bp to 1410 bp, encoding a new protein (such as Seq ID NO: 2).
  • This clone pBS-1117f 10 and the encoded protein was named human L1 factor p40 protein 12.
  • Example 2 Homologous search of cDNA clones
  • the sequence of the human L1 factor p40 protein 12 of the present invention and the protein sequence encoded by the same are used by the Blas t program (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], homology search was performed in databases such as Genbank, Swisst, etc.
  • the gene with the highest homology to the human L1 factor p40 protein 12 of the present invention is a known p40 protein on the L1 factor, and its accession number is 1193573 in Genbank.
  • the protein homology results are shown in Figure 1. The two are highly homologous, with 84% identity; 87% similarity.
  • Example 3 Cloning of a gene encoding human L1 factor p40 protein 12 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- ACAGACGGCCTCCTCAAATGGGTC -3 '(SEQ ID NO: 3)
  • Primer2 5'- TTTGCTTGGTAAATATTCCTCCAT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l / L ⁇ , 10 ⁇ l / L Tris-HCl, pH 8.5, 1.5mraol / L MgCl 2 , 200 ⁇ 1/1 dNTP, lOpmol primer, 1U in a 50 ⁇ 1 reaction volume Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1668bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human L1 factor p40 protein 12 gene expression
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RM was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 x SSC- 5 x Denhardt's solution and 200 ⁇ 1 salmon sperm DNA. After hybridization, the filter was placed at lx SSC-0.1 «/. 55 in SDS. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human L1 factor p40 protein 12
  • Primer3 5'- CCCCATATGATGAAGGGAAAAATGTTAAGGGCA -3, (Seq ID No: 5)
  • Primer4 5,-CATGGATCCTTATATTTTGGTTTGCTTTTGCAG -3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3) Digestion site.
  • PCR was performed using the pBS-1117flO plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-in7flO plasmid, primers Primer-3 and Primer-4 were 10 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into E. coli DH5a using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive clones were screened by colony PCR method and sequenced. Correct positive clone ( ⁇ - ⁇ )
  • the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method. In LB liquid medium containing kanamycin (final concentration 30 g / ml) In the experiment, the host strain BL21 (pET-1117flO) was cultured at 37 ° C.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human L1 factor p40 protein 12-specific peptides: NH2-Met-Lys-Gly-Lys-Met-Leu-Arg-Ala-Ala-Arg-Glu-Lys-Asn -Arg-Val-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds; 3. There should be no complementary regions inside the probe;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine p40 12 de facteur L1, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, des troubles du développement, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine p40 12 de facteur L1.
PCT/CN2001/000417 2000-03-27 2001-03-26 Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide WO2001072790A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001250271A AU2001250271A1 (en) 2000-03-27 2001-03-26 A novel polypeptide, a human l1 factor p40 protein 12 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115161.4 2000-03-27
CN 00115161 CN1315379A (zh) 2000-03-27 2000-03-27 一种新的多肽——人L1因子p40蛋白12和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001072790A1 true WO2001072790A1 (fr) 2001-10-04

Family

ID=4584630

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000417 WO2001072790A1 (fr) 2000-03-27 2001-03-26 Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1315379A (fr)
AU (1) AU2001250271A1 (fr)
WO (1) WO2001072790A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2200637A2 (fr) * 2007-09-20 2010-06-30 The J. David Gladstone Institutes Compositions polypeptidiques d'élément nucléaire dispersé long et leurs procédés d'utilisation

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 22 December 1998 (1998-12-22), Database accession no. AC006120 *
DATABASE GENBANK [online] 23 November 1999 (1999-11-23), accession no. EMBL Database accession no. Z68871 *
DATABASE GENBANK [online] 9 September 1999 (1999-09-09), Database accession no. AC007344 *
J. BIOL. CHEM., vol. 261, no. 14, 15 May 1986 (1986-05-15), pages 6600 - 6605 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2200637A2 (fr) * 2007-09-20 2010-06-30 The J. David Gladstone Institutes Compositions polypeptidiques d'élément nucléaire dispersé long et leurs procédés d'utilisation
EP2200637A4 (fr) * 2007-09-20 2011-10-19 David Gladstone Inst Compositions polypeptidiques d'élément nucléaire dispersé long et leurs procédés d'utilisation

Also Published As

Publication number Publication date
AU2001250271A1 (en) 2001-10-08
CN1315379A (zh) 2001-10-03

Similar Documents

Publication Publication Date Title
WO2002026973A1 (fr) Nouveau polypeptide, une ribonucleoproteine nucleaire heterogene humaine 32.01, et un polynucleotide codant ce polypeptide
WO2001068689A1 (fr) Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2001068684A1 (fr) Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide
WO2001068688A1 (fr) Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide
WO2001073068A1 (fr) Nouveau polypeptide, l1-12, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001064733A1 (fr) Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001083776A1 (fr) Nouveau polypeptide, hormone de croissance humaine 11, et polynucleotide codant pour ce polypeptide
WO2001094404A1 (fr) Nouveau polypeptide, facteur humain de retrotransposition l1 22, et polynucleotide codant ce polypeptide
WO2001081593A1 (fr) Nouveau polypeptide, proteine humaine 20 contenant un domaine a structure de boite de paires appariees, et polynucleotide codant pour ce polypeptide
WO2001094567A1 (fr) Nouveau polypeptide, transposase de la famille tc1/mariner humaine 11, et polynucleotide codant ce polypeptide
WO2001073061A1 (fr) Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide
WO2001074996A2 (fr) Nouveau polypeptide, c. elegans 52 humain, et polynucléotide codant pour ce polypeptide
WO2002004631A1 (fr) Nouveau polypeptide, proteine 11 humaine associee a la transcription inverse orf2 du facteur l1, et polynucleotide codant ce polypeptide
WO2001073045A1 (fr) Nouveau polypeptide, quinine reductase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001075029A2 (fr) Nouveau polypeptide, facteur humain 11 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001088153A1 (fr) Nouveau polypeptide, nadh-ubiquinone oxydoreductase humaine 14, et polynucleotide codant ce polypeptide
WO2001066769A1 (fr) Nouveau polypeptide, yip1p28 humaine, et polynucleotide codant pour ce polypeptide
WO2001075000A2 (fr) Nouveau polypeptide, facteur humain 15 lié á la rétrotransposition, et polynucléotide codant pour ce polypeptide
WO2001081539A2 (fr) Nouveau polypeptide, proteine humaine 26 de transport de zinc-ion, et polynucleotide codant pour ce polypeptide
WO2001071000A1 (fr) Nouveau polypeptide, znt-1-22, et polynucleotide codant pour ce polypeptide
WO2001075051A2 (fr) Nouveau polypeptide, proteine humaine 17 stag3 (antigene stromal), et polynucleotide codant pour ce polypeptide
WO2001072985A1 (fr) Nouveau polypeptide, atpase de translocation de proton 24, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP