WO2001094567A1 - Nouveau polypeptide, transposase de la famille tc1/mariner humaine 11, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, transposase de la famille tc1/mariner humaine 11, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001094567A1
WO2001094567A1 PCT/CN2001/000747 CN0100747W WO0194567A1 WO 2001094567 A1 WO2001094567 A1 WO 2001094567A1 CN 0100747 W CN0100747 W CN 0100747W WO 0194567 A1 WO0194567 A1 WO 0194567A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
transposase
sequence
human
Prior art date
Application number
PCT/CN2001/000747
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU13586/02A priority Critical patent/AU1358602A/en
Publication of WO2001094567A1 publication Critical patent/WO2001094567A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide ⁇ Sailor transposase 11 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide.
  • Transposable elements also known as transposons, are DM sequences that can be transferred between different chromosomes in the same cell, or between different sites on the same chromosome. This transfer does not depend on the homology between the sequences, the sequence is not lost at the original site, only a new copy of it is inserted into the new site.
  • transposons contain an open reading frame (0RF), which may encode a transposase.
  • ITRs terminal inverted repeats
  • a short sequence of the target DNA on the recipient DNA Because of the insertion of the transposon, the target sequence forms a forward repeat on both sides of the transposon. The length of the target sequence is specific to each type of transposon.
  • transposase In translocation, a transposase is required.
  • the transposase is encoded by the open reading frame of the transposon, and may also be encoded by other genes, and its role is to catalyze the transposition of the transposon.
  • the inventor sailor 11 transposase is a new transposon-translocator enzyme encoded by the human sailor 11 transposon.
  • the human sailor 11 transposon is a type of Mariner transposon, and the Mariner transposon belongs to the transposition factor mar iner / Tel superfamily. Mariner transposons are widely distributed and are found in the genomes of insects, nematodes, flatworms, and mammals, including humans.
  • the Mariner transposon is one of the simplest eukaryotic transposons. Its characteristics are: It contains only one open reading frame (0RF); the terminal repeats (ITRs) at both ends are about 30bp in length; the identified DNA site is a TA double nucleotide sequence.
  • the Mariner transposon uses a "cut and paste” mechanism to move around the DNA intermediate. As a result, the transposon is cut from the original place of the DNA and inserted into the new position of the genome.
  • the insertion target of the Mariner transposon is a TA double nucleotide sequence, and this double nucleotide sequence is copied when the Mariner transposon is inserted.
  • ITR terminal inverted repeat
  • the domain specific to this family of transposases is the "D, D35E” structure. This domain includes a conserved Asp linked to a “D35E” region.
  • the "D35E” region contains conserved arginine and glutamic acid residues, and there are generally 35 relatively conserved amino acid residues in between.
  • the polypeptide of the present invention has 73% homology with the Mariner transposase at the protein level, so it is considered to be a new human Mariner transposon, which has similar biological functions and is named human water. ⁇ ⁇ 11 ⁇ Block enzyme 11.
  • the human sailor transposase 11 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there is always a need to identify more involved in these In the process of the human sailor transposase 11 protein, in particular the amino acid sequence of this protein was identified. Isolation of the newcomer sailor transposase 11 protein encoding gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding DNA.
  • Object of the invention is a large number of proteins are involved in these regulatory processes, so there is always a need to identify more involved in these In the process of the human sailor transposase 11 protein, in particular the amino acid sequence of this protein was identified. Isolation of the newcomer sailor transposase 11 protein
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human sailor transposase 11.
  • Another object of the present invention is to provide a method for producing human sailor transposase 11.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human sailor transposase 11.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide-human sailor transposase 11 of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human sailor transposase 11. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 261-1575 in SE.Q ID NO: 1; and (b) having 1 in SEQ ID NO: 1 -1338-bit sequence.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the human sailor transposase 11 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a human sailor transposase 11 protein, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human sailor transposase 11.
  • FIG. 1 is a comparison diagram of amino acid sequence homology between human sailor transposase 11 and human sailor transposase of the present invention.
  • the upper sequence is human sailor transposase 11 and the lower sequence is human sailor transposase.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human sailor transposase 11.
  • l lkDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human sailor transposase 11, causes a change in the protein and thereby regulates the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human sailor transposase 11.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human sailor transposase 11 when combined with human sailor transposase 11.
  • Antagonists and inhibitors can These include proteins, nucleic acids, carbohydrates or any other molecule that can bind human sailor transposase 11.
  • Regular refers to a change in the function of human sailor transposase 11, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immunological changes in human sailor transposase 11.
  • substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can purify human sailor transposase 11 using standard protein purification techniques.
  • Substantially pure human sailor transposase 11 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human sailor transposase 11 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence A-C-T The complementarity between two single-stranded molecules can be partial or complete.
  • degree of complementarity between nucleic acid strands is The efficiency and strength of hybridization between nucleic acid strands has a significant effect.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higgins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids for conservative substitutions can include Including aspartic acid and glutamic acid; positively charged amino acids can include lysine and arginine; amino acids with similarly hydrophilic head groups that have no charge can include leucine and isoleucine Acids and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and?, which specifically bind to the epitope of human sailor transposase 11.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human sailor transposase 11 means that human sailor transposase 11 is substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human sailor transposase 11 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on a non-reducing polyacrylamide gel. The purity of the human sailor transposase 11 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide_human sailor transposase 11 which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or Can be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human sailor transposase 11.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human sailor transposase 11 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) is one in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
  • such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1338 bases, and its open reading frames 261-575 encode 104 amino acids.
  • this polypeptide has 73% homology with human sailor transposase, and it can be deduced that the human sailor transposase 11 has similar structure and function to human sailor transposase.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DNA forms include cDNA, genomic DM, or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" in the present invention refers to a nucleic acid sequence that encodes a protein or polypeptide having SEQ ID NO: 2 but differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants Body, deletion variant, and insertion variant.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human sailor transposase 11.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human sailor transposase 11 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DM sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measurement Determine the level of human sailor transposase 11 transcripts; (4) Detect the protein product of gene expression by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human sailor transposase 11 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method for amplification of MA / RNA by PCR is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DM / RM fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human sailor transposase 11 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .
  • a polynucleotide sequence encoding human sailor transposase 11 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements. Methods known to those skilled in the art can be used to construct expression vectors containing the DM sequence encoding human sailor transposase 11 and appropriate transcription / translation regulatory elements.
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis.
  • promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human sailor transposase 11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or heavy vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as insect cells such as Fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after exponential growth and used.
  • treatment Step 12 the used well known in the art that alternative 2, if desired, the conversion may be performed by electroporation method MgCl
  • the host is a eukaryote
  • the following optional DM... Transfection method calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.
  • the polynucleotide sequence of the present invention can be used for expression or production Recombinant human sailor transposase 11 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • transposons are some DM sequences that can be transferred between different chromosomes in the same cell, or between different sites on the same chromosome. This transfer does not depend on the homology between the sequences. The sequence is not lost at the original site, but a new copy of it is inserted into the new site.
  • transposase is required.
  • the transposase is encoded by the open reading frame of the transposon, and may also be encoded by other genes, and its role is to catalyze the transposition of the transposon.
  • the inventor sailor 11 transposase is a new transposon-translocator enzyme encoded by the human sailor 11 transposon.
  • the Human Sailor 11 transposon is a type of Mariner transposon.
  • the Mariner transposon has a wide range of distributions.
  • the Mariner transposon uses a "cut and paste" mechanism to move on the DM intermediate.
  • the transposon is removed from the original place of the DNA. Cut it out and insert it into a new location in the genome. This process is the key factor for transposase. This effect of the transposon changes the cell's genetic code and ultimately helps genetic evolution.
  • the polypeptide of the present invention is highly homologous to Mariner transposase and contains characteristic sequences of Mariner transposase family, both of which have similar biological functions. It acts as a transposon in the body
  • the key enzyme is necessary for transposition. This transposition effect changes the cell's genetic code and often changes the characteristics of the organism. Its abnormal expression is usually closely related to the occurrence of embryonic developmental disorders, growth and development disorders, tumorigenesis, inflammation, and abnormalities in immune regulation, etc., and produce related diseases.
  • the abnormal expression of the human sailor transposase 11 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, growth and development disorders, inflammation, and immune diseases. These diseases include but are not limited to :
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, Sexual retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • the abnormal expression of the human sailor transposase 11 of the present invention will also produce certain hereditary, hematological diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or inhibit (antagonist) human sailor transposase 11.
  • Agonists enhance biological functions such as human sailor transposase 11 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human sailor transposase 11 can be cultured with labeled human sailor transposase 11 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human sailor transposase 11 include screened antibodies, compounds, receptor deletions and classes
  • the antagonist of human sailor transposase 11 can bind to human sailor transposase 11 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform a biological function.
  • human sailor transposase ⁇ ⁇ can be added to the bioanalytical assay to determine whether the compound is antagonistic by measuring the effect of the compound on the interaction between human sailor transposase 11 and its receptor. Agent. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human sailor transposase 11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the 11 molecules of human sailor transposase are generally labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human sailor transposase 11 epitopes. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human sailor transposase 11 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
  • Techniques for preparing monoclonal antibodies to human sailor transposase 11 include, but are not limited to, hybridoma technology (ohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that combine human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, HAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against human sailor transposase 11.
  • Antibodies against human sailor transposase 11 can be used in immunohistochemistry to detect human sailor transposase 11 in biopsy specimens.
  • Monoclonal antibodies that bind to human sailor transposase 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human sailor transposase 11 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human sailor transposase 11 positive cells .
  • the antibodies in the present invention can be used to treat or prevent diseases related to human sailor transposase 11.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human sailor transposase 11.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human sailor transposase 11.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human sailor transposase 11 detected in the test can be used to explain the importance of human sailor transposase 11 in various diseases and to diagnose diseases in which human sailor transposase 11 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human sailor transposase 11 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human sailor transposase 11.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human sailor transposase 11 to inhibit endogenous human sailor transposase 11 activity.
  • a mutated human sailor transposase 11 may be a shortened human sailor transposase 11 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human sailor transposase 11.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human sailor transposase 11 into a cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding human sailor transposase 11 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human sailor transposase 11 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RM and DM
  • ribozymes that inhibit human sailor transposase 11 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense RNA, DM, and ribozymes can be obtained by any existing RNA or DM synthesis technology, such as the technology of solid phase phosphate amide synthesis of oligonucleotides has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM. This DM sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond rather than the phosphate Ester bond.
  • the polynucleotide encoding human sailor transposase 11 can be used for the diagnosis of diseases related to human sailor transposase 11.
  • the polynucleotide encoding human sailor transposase 11 can be used to detect the expression of human sailor transposase 11 or the abnormal expression of human sailor transposase 11 in a disease state.
  • the DA sequence encoding human sailor transposase 11 can be used to hybridize biopsy specimens to determine the expression of human sailor transposase 11.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DM chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue.
  • Human sailor transposase 11 specific primers can also be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human sailor transposase 11 transcripts.
  • Detection of mutations in the human sailor transposase 11 gene can also be used to diagnose human sailor transposase 11-related diseases.
  • Human sailor transposase 11 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human sailor transposase 11 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.
  • Fluorescent in situ hybridization of cDM clones and metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human sailor transposase 11 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human sailor transposase 11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Human fetal brain total MA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) m was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDNA cloning kit purchased from Clontech l ⁇ cDM fragment was inserted into the multiple cloning site of pBSK (+) vector (Clontech)) to transform DH5 ⁇ to form a cDNA library.
  • Dye terminate cycle react ion sequencing Kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elraer
  • the determined CDM sequences were compared with the existing co-DNA sequence database (Genebank ), The result found that the CDM sequence of one of the clones 1521e03 was a new DM.
  • a series of primers were synthesized to determine the inserted CDM fragments in both directions.
  • the sequence of the human sailor transposase 11 and the encoded protein sequence of the present invention were subjected to the Blast program (Basic local al ignment search tool) [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403 -10], perform homology search in databases such as Genbank and Swissport.
  • the gene with the highest homology to the human sailor transposase 11 of the present invention is a known human sailor transposase, and the protein encoded by the accession number of Genbank is U52077.
  • the protein homology results are shown in Figure 1. The two are highly homologous, with an identity of 73% and a similarity of 80%.
  • Example 3 Cloning of a gene encoding human sailor transposase 11 by RT-PCR
  • CDNA was synthesized using fetal brain total RM as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- TGGCTCGGTCTCCCGGCTGCGCGC —3, (SEQ ID NO: 3)
  • Primer2 5'- CATAGGCCGAGGCGGCCGACATGT -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions containing 50mmol / L KCl in a reaction volume of 50 ⁇ 1, 10mmol / L Tri s-HCl pH8 5, 1. 5mmol / L MgCl 2, 2 (mol / L dNTP, lOpmol primer, 1U. Taq DNA Polymerase (Clontech).
  • PE9600 DNA Thermal Cycler Perkin-Elmer: 25 cycles of reaction: 94 ° C 30sec; 55. C 30sec; 72 ° C 2rain 0 During RT-PCR, ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen).
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l-1338bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human sailor transposase 11 gene expression
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25raM sodium citrate, 0.2M sodium acetate ( PH 4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49 : 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2.2 M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • 32 P dATP labeled probe 32 ⁇ - DM prepared by the random primer Method - with cc.
  • the DNA probe used was the PCR amplified human sailor transposase 11 coding region sequence (261b P to 575bp) shown in FIG. 1.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ral) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H 2 P0 4 (pH7. 4) -5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DM. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min Then, the Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human sailor transposase 11
  • Pr iraer 3 5'-CCCCATATGATGGAAATGATGTTAGACGAAAAG-3 '(Seq ID No: 5)
  • Pr imer, 4 5' -CATGGATCCTCAAATGCTGAATGACCGTAGGAT-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI, respectively Enzymatic digestion sites, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively.
  • the Ndel and BamHI digestion sites correspond to the expression vector plasmid pET-28b (+) (Novagen product, Ca t. No. 69865 3) Selective endonuclease sites.
  • PCR reaction was performed using the P BS-1521e03 plasmid containing the full-length target gene as a template.
  • PCR reaction conditions were: 1 in a total volume of 50 ⁇ plasmid pBS-1521e03 containing 10pg, primers Pr imer-3 and Pr imer - 4 were l Opmol, Advantage po lymerase Mix ( Clontech Products) 1 ⁇ 1.
  • Cycle parameters 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles.
  • Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed with colibacillus DH5 CX by the calcium chloride method.
  • LB plate medium containing kanamycin (final concentration 30 ⁇ ⁇ 1) after overnight, positive clones selected by colony PCR method bar, and sequenced.
  • a positive clone (PET-I521e03) with the correct sequence was selected, and the recombinant plasmid was transformed into Escherichia coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the purified target protein human sailor transposase 11 was obtained and subjected to SDS-PAGE electrophoresis to obtain a single band at 1 lkDa ( Figure 2).
  • the band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method.
  • the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2.
  • the following peptides specific to human sailor transposase 11 were synthesized using a peptide synthesizer (product of PE company): NH2-Met-G 1 u-Met-Met-Leu-As pG 1 u-Ly s-G 1 n- 11 eG 1 n-Va 1-11 e- Phe-Leu- C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avrameas, et al. Im ochemi s try, 1969; 6: 43.
  • the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter membrane hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods, etc., all of which fix the polynucleotide sample to be tested on the filter The membranes were hybridized using essentially the same procedure.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag and 3-10rag pre-hybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • 3-10rag pre-hybridization solution lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)
  • High-intensity washing film 1) Take out the sample membrane of hybridization.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Genetics & Genomics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une transposase de la famille tc1/mariner humaine 11, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, des troubles du développement, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la transposase de la famille tc1/mariner humaine 11.
PCT/CN2001/000747 2000-05-16 2001-05-14 Nouveau polypeptide, transposase de la famille tc1/mariner humaine 11, et polynucleotide codant ce polypeptide WO2001094567A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU13586/02A AU1358602A (en) 2000-05-16 2001-05-14 A new polypeptide- human sailor transposase 11 and the polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115728A CN1323889A (zh) 2000-05-16 2000-05-16 一种新的多肽——人水手转座酶11和编码这种多肽的多核苷酸
CN00115728.0 2000-05-16

Publications (1)

Publication Number Publication Date
WO2001094567A1 true WO2001094567A1 (fr) 2001-12-13

Family

ID=4585172

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000747 WO2001094567A1 (fr) 2000-05-16 2001-05-14 Nouveau polypeptide, transposase de la famille tc1/mariner humaine 11, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1323889A (fr)
AU (1) AU1358602A (fr)
WO (1) WO2001094567A1 (fr)

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ARTHUR M. ET AL.: "The vanZ gene of Tn1546 from enterococcus faecium BM4147 confers resistance to teicoplanin", GENE, vol. 154, no. 1, 1995, pages 87 - 92 *
ROBERTSON H.M. AND ZUMPANO K.L.: "Molecular evolution of an ancient mariner transposon, Hsmar1, in the human genome", GENE, vol. 205, no. 1-2, 1997, pages 203 - 217 *
TAKAMI H. ET AL.: "An improved physical and genetic map of the genome of alkaliphilic bacillus sp. C-125", EXTREMOPHILES, vol. 3, no. 1, 1999, pages 21 - 28 *
YU W. ET AL.: "Large-scale concatenation cDNA sequencing", GENOME RES., vol. 7, no. 4, 1997, pages 353 - 358 *
ZHU T. AND HO D.D.: "Was HIV present in 1959?", NATURE, vol. 374, no. 6522, 1995, pages 503 - 504 *

Also Published As

Publication number Publication date
CN1323889A (zh) 2001-11-28
AU1358602A (en) 2001-12-17

Similar Documents

Publication Publication Date Title
WO2002026973A1 (fr) Nouveau polypeptide, une ribonucleoproteine nucleaire heterogene humaine 32.01, et un polynucleotide codant ce polypeptide
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2001083780A1 (fr) Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide
WO2001046240A1 (fr) Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide
WO2001094567A1 (fr) Nouveau polypeptide, transposase de la famille tc1/mariner humaine 11, et polynucleotide codant ce polypeptide
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2001064733A1 (fr) Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001090369A1 (fr) Nouveau polypeptide, n-acetylgalactosamine transferase 28, et polynucleotide codant ce polypeptide
WO2001094404A1 (fr) Nouveau polypeptide, facteur humain de retrotransposition l1 22, et polynucleotide codant ce polypeptide
WO2001083540A1 (fr) Nouveau polypeptide, kiaa0883-44, et polynucleotide codant pour ce polypeptide
WO2001079279A1 (fr) Nouveau polypeptide, facteur humain associe au recepteur du facteur de necrose tumorale 16, et polynucleotide codant pour ce polypeptide
WO2001073068A1 (fr) Nouveau polypeptide, l1-12, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2002004631A1 (fr) Nouveau polypeptide, proteine 11 humaine associee a la transcription inverse orf2 du facteur l1, et polynucleotide codant ce polypeptide
WO2002012323A1 (fr) Nouveau polypeptide, proteine secretrice 11 de la famille des hlyd, et polynucleotide codant ce polypeptide
WO2001081537A2 (fr) Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide
WO2002012324A1 (fr) Nouveau polypeptide, proteine 13 humaine associee a la transcription inverse orf2 du facteur l1, et polynucleotide codant ce polypeptide
WO2002004503A1 (fr) Nouveau polypeptide, proteine humaine 15 associee a la transcription inverse orf2 du facteur l1, et polynucleotide codant ce polypeptide
WO2001074996A2 (fr) Nouveau polypeptide, c. elegans 52 humain, et polynucléotide codant pour ce polypeptide
WO2001096525A2 (fr) Nouveau polypeptide, unite de transposition pogo 18, et polynucleotide codant ce polypeptide
WO2001064867A1 (fr) Nouveau polypeptide, facteur humain 33 associe a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001075120A1 (fr) Nouveau polypeptide, alkylguanine-adn/cysteine proteine methyltransferase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001075000A2 (fr) Nouveau polypeptide, facteur humain 15 lié á la rétrotransposition, et polynucléotide codant pour ce polypeptide
WO2001073010A1 (fr) Nouveau polypeptide, proteine humaine de transport vesiculaire 43, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP