WO2001075000A2 - Nouveau polypeptide, facteur humain 15 lié á la rétrotransposition, et polynucléotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, facteur humain 15 lié á la rétrotransposition, et polynucléotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001075000A2
WO2001075000A2 PCT/CN2001/000252 CN0100252W WO0175000A2 WO 2001075000 A2 WO2001075000 A2 WO 2001075000A2 CN 0100252 W CN0100252 W CN 0100252W WO 0175000 A2 WO0175000 A2 WO 0175000A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
reverse transcription
related factor
sequence
Prior art date
Application number
PCT/CN2001/000252
Other languages
English (en)
Chinese (zh)
Other versions
WO2001075000A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU2001246302A priority Critical patent/AU2001246302A1/en
Publication of WO2001075000A2 publication Critical patent/WO2001075000A2/fr
Publication of WO2001075000A3 publication Critical patent/WO2001075000A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide-to-human reverse transcription-related factor 15 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • the L1 factor can be found in all mammalian genomes and is involved in the reverse transcription process. It is a highly repetitive MA sequence. Although there are many L1 factors in the human genome, most of them are inactive due to truncation, rearrangement, and mutation. The L1 factor of many people has retrotransposition capabilities.
  • the 5 'end of the L1 factor is mostly a blunt-end structure, which is different from the general sticky-end structure, but does not affect its transcription integration process.
  • the 5 'end untranslated region (UTR) contains an internal promoter that regulates and controls the speed of the entire reverse transcription process.
  • the LRE2 site contains two complete open reading frames (0RF1 and 0RF2). The 0RF1 frame encodes an approximately 40Kd embryonic cancer cell protein.
  • the 0RF2 frame is sequenced with the reverse transcriptase and other retroviral proteins. Similarity can mediate the reverse transcription process.
  • the inserted gene on LRE2 proved that the flanking sequence produced by the L1 factor during the read-through process can undergo reverse transcription, because its tail has a different poly A structure.
  • this type of read-through process can also be achieved by retroviruses, which can also obtain the required intracellular DNA sequence, further confirming that it has a reverse transcription function. Insertion rearrangements at the LRE2 site can cause some abnormalities in gene expression.
  • a more typical example is muscular dystrophy. A muscle dystrophin protein is found in the muscles of malnourished patients. This protein gene has a 2Kb insertion gene that contains a rearranged L1 factor.
  • LRE2 has a complete copy of the target site of 13-15Bp. At the 5 ′ end, there is an unusual blunt end of 21Bp, which proves that the blunt-end structure can still Perform reverse transcription.
  • the insertion of two bases on the L1 factor can cause Duchemie muscular dystrophy (B, Bakker, & G. van Omenn, personal communication). This disease is hereditary in families, and people with this disease generally Will die in infancy or earlier adulthood.
  • polypeptide of the present invention has 77% identity, 83% similarity to the aforementioned L1 factor, and contains
  • the L1 family is a characteristic conserved sequence. Therefore, this protein is considered to be a new L1 factor with similar biological functions as the L1 factor. It participates in the reverse transcription process and is named human reverse transcription-related factor 15.
  • human reverse transcription-related factor 15 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so it has been necessary to identify more involved in these The process of human reverse transcription-associated factor 15 protein, especially the amino acid sequence of this protein is identified. Isolation of the novel human transcription factor 15-encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human reverse transcription-related factor 15.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human reverse transcription-related factor 15.
  • Another object of the present invention is to provide a method for producing human reverse transcription-related factor 15.
  • Another object of the present invention is to provide an antibody against a human reverse transcription-related factor 15 of a polypeptide of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the human reverse transcription-related factor 15 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of human reverse transcription-related factor 15.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1350-1748 in SEQ ID NO: 1; and (b) a sequence having 1-4971 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing a polynucleotide of the invention;
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell; a method for preparing a polypeptide of the present invention comprising culturing the host cell and recovering an expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human reverse transcription-related factor 15 protein activity, which comprises utilizing the polypeptide of the present invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human reverse transcription-related factor 15 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human reverse transcription-related factor 15.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement means the replacement of a different amino acid or A nucleotide replaces one or more amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human reverse transcription-related factor 15, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human reverse transcription-related factor 15.
  • Antagonist refers to a molecule that, when combined with human reverse transcription-related factor 15, can block or regulate the biological or immunological activity of human reverse transcription-related factor 15.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human reverse transcription-related factor 15.
  • Regular refers to a change in the function of human reverse transcription-related factor 15, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional or immune properties of human reverse transcription-related factor 15. change.
  • substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human reverse transcription-related factors 15 using standard protein purification techniques. Basic The pure human reverse transcription-related factor 15 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the human reverse transcription-related factor 15 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALI GN program (Lasergenes of twar e package, DNASTAR, Inc., Mad Son Wis.). The MEGAL IGN program can compare two or more sequences (H i gg ins, DG and PM Sharp (1988) Gene 73: 237-244) The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. Two amino acids Sequence such as
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jot un He in (He in J., (1990) Methods in emzumo l ogy 183: 625-645). 0 "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b ') 2 and F V, which specifically binds to the transcription factor human anti-15 antigen determinant.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides coexist in a natural state Separated in other materials, it is isolated and purified.
  • isolated human reverse transcription-related factor 15 means that human reverse transcription-related factor 15 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human RT-related factors 15 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human reverse transcription-related factor 15 peptide purity can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, a human reverse transcription-related factor 15, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human reverse transcription-related factor 15.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human reverse transcription-related factor 15 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
  • such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 4971 bases in length and its open reading frame 1350-1748 encodes 1 32 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 77% homology with the L1 factor. It can be deduced that the human reverse transcription-related factor 15 has a similar structure and function to the L1 factor.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) L ⁇ Hybridization with a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1.
  • hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides. More than nucleotides. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human reverse transcription-related factor 15.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human reverse transcription-related factor 15 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
  • cDNA libraries are also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of transcripts of human reverse transcription-related factor 15; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human reverse transcription-related factor 15 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human reverse transcription-related factor 15 coding sequence, and a recombinant technology for producing the polypeptide of the present invention. method.
  • a polynucleotide sequence encoding human reverse transcription-related factor 15 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, JBio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • An expression vector for DNA sequences and appropriate transcriptional / translational regulatory elements include in vitro recombinant DNA technology, difficult-to-synthesize technology, and in vivo recombination technology (Sambroook, et al. Mo l ecu l ar C l on ing, a Labora tory Manua l, co ld Spr ing Harbor Labora t ory. New York , 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human reverse transcription-related factor 15 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaC I using procedures well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human reverse transcription-related factor 15 (Scence, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • FIG. 1 is a comparison diagram of amino acid sequence homology of the reverse transcription-related factor 15 and L1 factor of the present inventors.
  • the upper sequence is human reverse transcription-related factor 15 and the lower sequence is L1 factor.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by.
  • FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of an isolated human reverse transcription-related factor 15.
  • FIG. 15KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • MRNA is formed by reverse transcription cDNA Quik mRNA Isolation Kit (Qiegene Co.) isolated from the total RNA poly (A) mRNA 0 2ug poly ( A) used. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 ⁇ fragment was inserted into the multicloning site of the pBSK (+) vector (Cloiuech) and transformed into DH5a. The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0109C03 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the 0109C03 clone contains a full-length cDNA of 4971bp (as shown in Seq IDN0: 1), and has a 399bp open reading frame (0RF) from 1350bp to 1748bp, which encodes a new protein (such as Seq ID NO: 2).
  • This clone pBS-0109C03 and the encoded protein was named human reverse transcription-related factor 15.
  • Example 2 Homologous search of cDNA clones
  • the sequence of the human reverse transcription-associated factor 15 and the protein sequence encoded by the present invention were performed using the Blast program (Basic local Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10 ], Perform homology search in databases such as Genbank, Swissport.
  • the gene with the highest homology to the human reverse transcription-related factor 15 of the present invention is a known L1 factor, and its accession number to Genbank is 1193570.
  • the results of protein homology are shown in Figure 1. The two are highly homologous with 77% identity; 83% similarity.
  • Example 3 Cloning of a gene encoding human reverse transcription-related factor 15 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primer2 5'- TTTATGATTCAAATTAGACTTTCG -3, (SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at Ibp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 mmol / L KC1, 10 mmol / L Tris-CI, (pH 8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a 50 ⁇ 1 reaction volume, 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
  • RT-PCR (-act in is used as a positive control and template blank is used as a negative control.
  • Amplification products are purified using a QIAGEN kit, and the TA cloning kit is used to connect to a PCR vector (Invitrogen product). DNA sequence The analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-4971bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human reverse transcription-related factor 15 gene expression:
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25m KH 2 P0 4 (pH7.4)-5 ⁇ SSC- 5 ⁇ Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 ⁇ SSC-0.1 ° / »SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human reverse transcription-related factor 15
  • Primer 3 5'- CCCGAGCTCATGAGGTATAAAGAGGAGCTGGTA -3 '(Seq ID No: 5)
  • Primer4 5'- CCCCTCGAGTTAGCATGAAGGCTGTTGAATTTT -3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Sacl and Xhol restriction sites, respectively , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the Sacl and Xhol restriction sites correspond to the expression vectors on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3). Selective endonuclease site.
  • the 0109C03 plasmid was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0109C03 plasmid, Pr imer-3 and Pr imer-4, and j is lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ h cycle parameters : 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
  • the amplified product and plasmid P ET-28 (+) were double-digested with Sacl and Xhol respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into E. coli DH5 CC using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR method and sequenced. A positive clone (pET-0109C03) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host bacteria BL21 (pET-0109C03) was cultured at 37 ° C to the logarithmic growth phase, IPTG was added to a final concentration of 1mmol / L, and continued Incubate for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. Chromatography was performed using an affinity chromatography column Hi s. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag). The purified target human reverse transcription-related factor 15 was obtained.
  • Polypeptide synthesizer (product of PE company) was used to synthesize the following human reverse transcription-related factor 15-specific peptides: NH2-Met-Arg-Tyr-Lys-Glu-Glu-Leu ⁇ Va-Pro-Phe-Leu-Leu -Lys-Pro-Phe- C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or Pathology Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same basic hybridization method after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • unhybridized probes are removed by a series of membrane washes.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 14 Resuspend the DNA pellet in a small volume of TE or water.
  • the following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0. lrag / ml) was added.
  • CT DNA (calf thymus DNA).
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRi si, JL, Lyer, V.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Humans have a genomic L1 family, and the L1 factor is present on LRE2 on chromosome lq.
  • the protein encoded by the L1 family sequence is a reverse transcriptase-like enzyme.
  • LRE2 on mammalian chromosome lq participates in the reverse transcription process.
  • the proliferation process of LRE2 includes three processes: transcription, reverse transcription, and reintegration into a new site on the genome. Insertion rearrangement at the LRE2 site can lead to some abnormalities in gene expression. Such as muscular dystrophy (Duchenne muscular dystrophy).
  • the polypeptide of the present invention and the L1 factor encoded by the L1 family of the genome are homologous proteins, containing characteristic sequences of the L1 family, and both have similar biological functions. It may also be involved in the reverse transcription process in organisms, regulating the expression of certain genes. Its abnormal expression can make the regulation of related genes wrong, and cause related diseases.
  • the abnormal expression of the human reverse transcription-related factor 15 of the present invention will produce various diseases, especially muscular dystrophy, various tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases. These diseases include, but are not limited to:
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma, embryonic developmental disorders Symptoms: Congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital hearing loss
  • Growth and development disorders mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, Specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, general variable immunodeficiency disease, primary B lymphocyte immunodeficiency disease, acquired immunodeficiency syndrome
  • Abnormal expression of the human reverse transcription-related factor 15 of the present invention will also produce certain hereditary, hematological diseases, and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially muscular dystrophy, various tumors, embryonic development disorders, and developmental disorders Diseases, inflammation, immune diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human reverse transcription-related factor 15. Agonists enhance human reverse transcription-related factors 15 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human reverse transcription-related factor 15 can be cultured with labeled human reverse transcription-related factor 15 in the presence of drugs. The ability of the drug to increase or block this interaction is then measured.
  • Antagonists of human reverse transcription-related factor 15 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human reverse transcription-related factor 15 can bind to human reverse transcription-related factor 15 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
  • human reverse transcription-related factor 15 can be added to bioanalytical assays to determine whether a compound is a compound by measuring its effect on the interaction between human reverse transcription-related factor 15 and its receptor. Antagonist. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human reverse transcription-related factor 15 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, 15 molecules related to human reverse transcription factor should be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against human reverse transcription-related factor 15 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human reverse transcription-related factor 15 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
  • Techniques for preparing monoclonal antibodies to human reverse transcription-related factor 15 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta - Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0
  • Existing techniques for producing single-chain antibodies US Pa t No. 4946778) can also be used to produce single chain antibodies against human reverse transcription-related factor 15.
  • Anti-human RT-related factor 15 antibodies can be used in immunohistochemical techniques to detect human RT-related factor 15 in biopsy specimens.
  • Monoclonal antibodies that bind to human reverse transcription-related factor 15 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human reverse transcription-related factors 15 High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human reverse transcription-related factor 15 positive cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human reverse transcription-related factor 15. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human reverse transcription-related factor 15.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human reverse transcription-related factor 15.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the levels of human RT-related factor 15 detected in the test can be used to explain the importance of human RT-related factor 15 in various diseases and to diagnose diseases in which human RT-related factor 15 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human reverse transcription-related factor 15 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human reverse transcription-related factor 15.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human RT-related factor 15 to inhibit endogenous human RT-related factor 15 activity.
  • a variant human reverse transcription-related factor 15 may be a shortened human reverse transcription-related factor 15 lacking a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human reverse transcription-related factor 15.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer a polynucleotide encoding human reverse transcription-related factor 15 into cells.
  • Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human reverse transcription-related factor 15 can be seen In the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human reverse transcription-related factor 15 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human reverse transcription-related factor 15 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • a polynucleotide encoding human reverse transcription-related factor 15 can be used for the diagnosis of diseases related to human reverse transcription-related factor 15.
  • the polynucleotide encoding human reverse transcription-related factor 15 can be used to detect the expression of human reverse transcription-related factor 15 or abnormal expression of human reverse transcription-related factor 15 in a disease state.
  • the DNA sequence encoding human reverse transcription-related factor 15 can be used to hybridize biopsy specimens to determine the expression status of human reverse transcription-related factor 15.
  • Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray (Micr oa r ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and Genetic diagnosis.
  • a microarray Merix oa r ray
  • a DNA chip also known as a "gene chip”
  • Human reverse transcription-related factor 15-specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human reverse transcription-related factor 15 transcription products.
  • Human RT-related factor 15 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human RT-related factor 15 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, the mutation may affect the expression of the protein, so the Nort Hern blot and Wes Tern blot can be used to indirectly determine whether the gene is mutated.
  • sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • Only few chromosome markers based on actual sequence data (repeat polymorphisms) are available For marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in a single step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them.
  • the polypeptides of the invention can be combined with other Of therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human reverse transcription-related factor 15 is administered in an amount effective to treat and / or prevent a particular indication.
  • the amount and dose range of human RT-related factor 15 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, un facteur humain 15 lié à la retrotransposition, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des dystrophies musculaires, des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour le facteur humain 15 lié à la rétrotransposition.
PCT/CN2001/000252 2000-03-02 2001-02-26 Nouveau polypeptide, facteur humain 15 lié á la rétrotransposition, et polynucléotide codant pour ce polypeptide WO2001075000A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001246302A AU2001246302A1 (en) 2000-03-02 2001-02-26 A novel polypeptide, human factor 15 linked to retrotransposition

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00111848 CN1311235A (zh) 2000-03-02 2000-03-02 一种新的多肽——人反转录相关因子15和编码这种多肽的多核苷酸
CN00111848.X 2000-03-02

Publications (2)

Publication Number Publication Date
WO2001075000A2 true WO2001075000A2 (fr) 2001-10-11
WO2001075000A3 WO2001075000A3 (fr) 2002-02-07

Family

ID=4581744

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000252 WO2001075000A2 (fr) 2000-03-02 2001-02-26 Nouveau polypeptide, facteur humain 15 lié á la rétrotransposition, et polynucléotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1311235A (fr)
AU (1) AU2001246302A1 (fr)
WO (1) WO2001075000A2 (fr)

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CELL vol. 87, no. 5, 1996, pages 905 - 916 *
GENETICA vol. 107, no. 1-3, 1999, pages 39 - 51 *
NAT. GENET. vol. 16, no. 1, 1997, pages 37 - 43 *

Also Published As

Publication number Publication date
CN1311235A (zh) 2001-09-05
AU2001246302A1 (en) 2001-10-15
WO2001075000A3 (fr) 2002-02-07

Similar Documents

Publication Publication Date Title
WO2001068684A1 (fr) Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide
WO2001074869A1 (fr) Nouveau polypeptide, proteine humaine de choc thermique 15, et polynucleotide codant pour ce polypeptide
WO2001075000A2 (fr) Nouveau polypeptide, facteur humain 15 lié á la rétrotransposition, et polynucléotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2001075054A2 (fr) Nouveau polypeptide, facteur humain de regulation 30 de la transcription de la microglobuline, et polynucleotide codant pour ce polypeptide
WO2001064721A1 (fr) Nouveau polypeptide, adenosine triphosphatase 30, et polynucleotide codant pour ce polypeptide
WO2001064722A1 (fr) Nouveau polypeptide, proteine humaine 9 associee a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2001064867A1 (fr) Nouveau polypeptide, facteur humain 33 associe a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001068692A1 (fr) Nouveau polypeptide, proteine humaine conjuguee du cancer de la retine 9, et polynucleotide codant pour ce polypeptide
WO2001073061A1 (fr) Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide
WO2001081395A1 (fr) Nouveau polypeptide, adn topo-isomerase i-15, et polynucleotide codant pour ce polypeptide
WO2001081392A1 (fr) Nouveau polypeptide, phosphoproteine nucleolaire humaine 13, et polynucleotide codant pour ce polypeptide
WO2001074887A1 (fr) Nouveau polypeptide, proteine humaine 9 humsiah, et polynucleotide codant pour ce polypeptide
WO2001074891A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 17, et polynucleotide codant pour ce polypeptide
WO2001079491A1 (fr) Nouveau polypeptide, canal ionique humain 12 pour le chlore, et polynucleotide codant pour ce polypeptide
WO2001071000A1 (fr) Nouveau polypeptide, znt-1-22, et polynucleotide codant pour ce polypeptide
WO2001075124A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 9, et polynucleotide codant pour ce polypeptide
WO2001083728A1 (fr) Nouveau polypeptide, proteine humaine de transport d'acides amines excitateurs 9, et polynucleotide codant pour ce polypeptide
WO2001074995A2 (fr) Nouveau polypeptide, protéine humaine de mutation 15 de l'ataxie telangiectasie, et de polynucléotide codant pour ce polypeptide
WO2001081537A2 (fr) Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP