WO2001046240A1 - Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001046240A1
WO2001046240A1 PCT/CN2000/000601 CN0000601W WO0146240A1 WO 2001046240 A1 WO2001046240 A1 WO 2001046240A1 CN 0000601 W CN0000601 W CN 0000601W WO 0146240 A1 WO0146240 A1 WO 0146240A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
sequence
human
transposase
Prior art date
Application number
PCT/CN2000/000601
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU19867/01A priority Critical patent/AU1986701A/en
Publication of WO2001046240A1 publication Critical patent/WO2001046240A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human sailor transposase 19, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide. Background technique
  • Transposable elements also called transposons, are DNA sequences that can be transferred between different chromosomes in the same cell, or between different sites on the same chromosome. This transfer does not depend on the homology between the sequences.
  • transposons contain an open reading frame (0RF), which may encode a transposase.
  • UTRs terminal inverted repeats
  • a short sequence of the target sequence on the recipient DNA Due to the insertion of the transposon, the target sequence forms forward repeats on both sides of the transposon.
  • the length of the target sequence is specific to each type of transposon.
  • transposase In translocation, a transposase is required.
  • the transposase is encoded by the open reading frame of the transposon, and may be encoded by other genes, and its role is to catalyze the transposition of the transposon.
  • Human sailor transposase is a new transposon-a transposase encoded by a human sailor transposon.
  • the human sailor transposon is a type of Mariner transposon, and the Mariner transposon belongs to the transposition factor mariner / Tel superfamily. Mariner transposons are widely distributed and are found in the genomes of insects, nematodes, flatworms and mammals, including humans.
  • the Mariner transposon is one of the simplest eukaryotic transposons. Its characteristics are: It only contains one open reading frame (0RF); the terminal repeats (ITRs) at both ends are about 30bp in length; the DNA recognition site is a TA double nucleotide sequence.
  • Mariner transposons use a "cut and paste” mechanism on DNA intermediates. The result is that the transposon is cut from the original place of DNA and inserted into a new position in the genome.
  • the insertion target of the Mariner transposon is a TA dinucleotide sequence, and this dinucleotide sequence is copied when the Mariner transposon is inserted.
  • ITR terminal inverted repeat
  • the domain specific to this family of transposases is the "D, D35E” structure. This domain includes a conserved Asp and a “D35E” region. The "D35E” region contains conserved arginine and glutamic acid residues, and there are generally 35 relatively conserved amino acid residues in between.
  • the Mariner transposon family is thought to be associated with many diseases, for example, 17pl 1.2 sites are found in progressive neurofibular muscular atrophy 1A, and this site is inherited in hereditary neuropathic paralysis There is a deletion of 1. 5-Mb. In both diseases, structures similar to Mariner transposons can be found near this site [Har tl (1996)]. This structure-encoded transposase may be involved in an unbalanced exchange of 17 pl 1.2, which results in the replication or deletion of this site.
  • the polypeptide of the present invention was inferred and identified as a new human sailor transposase 19 (HMT19).
  • HMT19 human sailor transposase 19
  • Its homologous protein is a human sailor protease that has been discovered. Its protein number is U52077.
  • the human sailor transposase 19 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes
  • the human sailor transposase 19 protein identifies the amino acid sequence of this protein. Isolation of the newcomer sailor transposase 19 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so isolating its coding DNA is important. Disclosure of invention
  • An object of the present invention is to provide an isolated novel polypeptide, human sailor transposase 19 and fragments thereof, Analogs and derivatives.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a method for producing human sailor transposase 19.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human sailor transposase 19.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID No. 2 or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1 026-1535 in SEQ ID NO: 1; and (b) having a sequence 1- in SEQ ID NO: 1 1573-bit sequence.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the human sailor transposase 19 protein, which comprises utilizing the polypeptide of the invention.
  • the present invention also relates to a compound obtained by the method.
  • the present invention also relates to an in vitro detection of a disease or a disease related to abnormal expression of a human sailor transposase 19 protein or A method for susceptibility to a disease, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting the amount or biological activity of the polypeptide of the present invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human sailor transposase 19.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bio activity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human sailor transposase 19, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human sailor transposase 19.
  • Antagonist refers to a molecule that, when combined with human sailor transposase 19, can block or regulate the biological or immunological activity of human sailor transposase 19.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human sailor transposase 19.
  • Regular refers to a change in the function of human sailor transposase 19, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immunological changes in human sailor transposase 19.
  • “Substantially pure '” means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human sailor transposase 19 using standard protein purification techniques. Basically Pure human sailor transposase 19 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human sailor transposase 19 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other specifically or selectively.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (La sergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences (Higgins, DG, and PM Sharp (1988) according to different methods, such as the Cluster method. Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun He in (He in J., (1990) Methods in erazumo logy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human sailor transposase 19.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human sailor transposase 19 means that human sailor transposase 19 is substantially free of other proteins, lipids, sugars, or other substances naturally associated with it.
  • Those skilled in the art can purify human sailor transposase 19 using standard protein purification techniques.
  • Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human sailor transposase 19 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human sailor transposase 19, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human sailor transposase 19.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human sailor transposase 19 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes a nucleotide of SEQ ID NO: 1 Sequence.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1573 bases in length: its open reading frame (1026-1535) encodes 169 amino acids. Based on amino acid sequence homology comparison. This peptide has 81% homology with ⁇ homologous protein). It can be inferred that the human sailor transposase 19 has a similar structure to the human sailor protease (protein number U52077). and function.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • the "degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) A denaturant was added during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co il, 42.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human sailor transposase 19.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human sailor transposase 19 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Ciontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (DDNA-DNA or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human sailor transposase 19 transcripts; (4) by Immunological technology or determination of biological activity to detect protein products of gene expression. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human sailor transposase 19 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human sailor transposase 19 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .
  • a polynucleotide sequence encoding the human sailor transposase 19 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis.
  • promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human sailor transposase 19 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing MA can be harvested after the exponential growth phase and treated with CaC I using procedures well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human sailor transposase 19 (Sc once, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • Figure 1 is a comparison diagram of the amino acid sequence homology between the human sailor transposase 19 of the present invention and a discovered human sailor protease.
  • the upper sequence is human sailor transposase 19
  • the lower sequence is a human sailor protease that has been found.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • FIG. 2 is a polyacrylamide gel electrophoresis diagram (SDS-PAGE) of an isolated human sailor transposase 19.
  • 19kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 1303 g 08 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the results showed that the full-length cDNA contained in the 1303g08 clone was 1573bp (as shown in Seq IDN0: 1), and there was a 510bp open reading frame (0RF) from 1026bp to 1535bp, encoding a new protein (such as Seq ID NO: 2).
  • This clone pBS-1303g08 and named the encoded protein human sailor transposase 19.
  • the sequence of the human sailor transposase 19 of the present invention and the protein sequence encoded by the same were performed using the Blast program (Basiclocal Alignment search tool) [Altschul, SF et a 1. J. Mol. Biol. 1990; 215: 403-10] Perform homology search in Genbank, Swissport and other databases.
  • the gene most homologous to the human sailor transposase 19 of the present invention is a known human sailor protease, and its encoded protein has the accession number 1) 52077 in Genbank.
  • the protein homology results are shown in Figure 1. The two are highly homologous, with 81% identity; 88% similarity.
  • Example 3 Cloning of a gene encoding human sailor transposase 19 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, PCR was performed using the following primers: Priraerl: 5, — TGGACAGGAGAGGAAAAATAGGTT -3, (SEQ ID NO: 3)
  • Primer2 5'- CATAGGCCGAGGCGGCCGACATGT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 leg ol / L KC1, 10 mmol / L Tris-CI, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol in a 50 ⁇ 1 reaction volume Primer, 1U of Taq DM polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min. During RT-PCR, ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-1573bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human sailor transposase 19 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • the DNA probe used was the PCR amplified human sailor transposase 19 coding region sequence (1026bp to 1535bp) shown in FIG. 1.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) and an RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 ⁇ SSC-5 ⁇ Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in lx SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human sailor transposase 19
  • Primer 3 5'- CCCCATATGATGACAACCACTGACAACCAGCTCA -3, (Seq ID No: 5)
  • Primer4 5'- CATGGATCCCTAAGGAGAAATAAGTGTGTTTTATT -3
  • the 5 'ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences of the 5' and 3 'ends of the target gene, respectively.
  • the Ndel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
  • PCR was carried out.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 containing 10 pg of P BS-1303g08 plasmid, primers? 1 ⁇ 1116]: -3 and? 1 1116]: -4 points in addition!]
  • 10 11101 Advantage polymerase Mix
  • Cycle parameters 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
  • Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into Ca. bacillus DH5 ⁇ by the calcium chloride method.
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Protein A-Sepharose was used to isolate total IgG from antibody-positive home-immunized serum.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and the total IgG Anti-peptide antibodies were isolated.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human sailor transposase 19.
  • Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • unhybridized probes are removed by a series of membrane washes.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared after the collection solutions of the first peak are combined.
  • Human sailor transposase 19 and its encoded polypeptides have many uses. These uses include (but are not limited to) direct use as drugs to treat diseases caused by hypofunction or loss of human sailor transposase 19 and screening antibodies, peptides or other ligands that promote or counteract human sailor transposase 19 function. For example, antibodies can be used to activate or inhibit the function of human sailor transposase 19. Screening peptide libraries with the expressed recombinant human sailor transposase 19 protein can be used to find therapeutic peptide molecules that can inhibit or stimulate human sailor transposase 19 function.
  • the human sailor 19 transposon can be used as a vector to introduce the target gene into different types of animal cells.
  • transposases can independently transpose without the need for other cell-acting factors.
  • Disease mechanism and potential for gene therapy For example: To date no satisfactory vaccine or chemotherapy has been found to treat Leishmaniasis Lei shmani a ma jor (black fever), a fatal and widespread tropical disease. If the human sailor 19 transposon is introduced into the genome of black fever pathogen, large tropical Leishmania, it is possible to study the pathogenesis of black fever.
  • the human sailor 19 transposon can be used to introduce normal genes into target cells and stably express normal proteins to relieve or cure the disease.
  • Mariner transposon-like structures have been found in diseases such as progressive neurofibular muscular atrophy 1A and hereditary neuropathic paralysis.
  • the transposase encoded by this structure is thought to play a role in the unbalanced replication or deletion of 17 pl 1.2. Therefore, human sailor transposase 19, which is homologous to Mariner transposase, can be used to treat and prevent diseases such as progressive neurofibromuscular atrophy 1A and hereditary neuropathic paralysis, as well as other related diseases.
  • An antagonist or a fragment or derivative of human sailor transposase 19 can be used to treat or prevent cancer.
  • Cancers include, but are not limited to, adenocarcinoma, leukemia, lymphoma, melanoma, sarcoma, myeloma, teratoma, etc. ; Especially adrenal cancer, bladder cancer, bone cancer, bone marrow cancer, brain cancer, breast cancer, uterine cancer, gallbladder cancer, nerve center cancer, kidney cancer, liver cancer, lung cancer, thyroid cancer, thymic cancer, etc.
  • Antibodies that specifically bind to human sailor transposase 19 can be used directly as antagonists, or indirectly bring the agent to cells or tissues expressing human sailor transposase 19 in a targeting or delivery mechanism.
  • An antagonist or a fragment or derivative of human sailor transposase 19 can be used to treat or prevent cancer immune disorders.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human sailor transposase 19.
  • Agonists enhance human sailor transposase 19 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human sailor transposase 19 can be cultured with labeled human sailor transposase 19 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human sailor transposase 19 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human sailor transposase 19 can bind to human sailor transposase 19 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human sailor transposase 19 When screening compounds as antagonists, human sailor transposase 19 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human sailor transposase 19 and its receptor. . Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human sailor transposase 19 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally should The human sailor transposase 19 molecule was labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human sailor transposase 19 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human sailor transposase 19 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
  • Techniques for preparing monoclonal antibodies to human sailor transposase 19 include, but are not limited to, hybridoma technology (KoMer and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV- Hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). And existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against human sailor transposase 19.
  • Antibodies against human sailor transposase 19 can be used in immunohistochemistry to detect human sailor transposase 19 in biopsy specimens.
  • Monoclonal antibodies that bind to human sailor transposase 19 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human sailor transposase 19 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human sailor transposase 19 positive cells .
  • the antibodies of the present invention can be used to treat or prevent diseases related to human sailor transposase 19.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human sailor transposase 19.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human sailor transposase 19.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human sailor transposase 19 detected in the test can be used to explain the importance of human sailor transposase 19 in various diseases and It is used to diagnose diseases in which human sailor transposase 19 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human sailor transposase 19 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human sailor transposase 19.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human sailor transposase 19 to inhibit endogenous human sailor transposase 19 activity.
  • a mutant human sailor transposase 19 may be a shortened human sailor transposase 19 lacking a signaling domain, although it can bind to downstream substrates, but lacks signaling activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of transposition of human sailors.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer the polynucleotide encoding human sailor transposase 19 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding human sailor transposase 19 can be found in the existing literature (Sambrook, et al.).
  • the polynucleotide encoding human sailor transposase 19 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human sailor transposase 19 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis technology for oligonucleotide synthesis. Widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • Polynucleotide encoding human sailor transposase 19 is useful for diseases related to human sailor transposase 19. Diagnosis.
  • the DNA sequence encoding human sailor transposase 19 can be used to hybridize biopsy specimens to determine the expression of human sailor transposase 19. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human sailor transposase 19-specific primers can also be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human sailor transposase 19 transcripts.
  • Detection of mutations in the human sailor transposase 19 gene can also be used to diagnose human sailor transposase 19-related diseases.
  • Human sailor transposase 19 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human sailor transposase 19 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization (FI SH) of cDM clones with metaphase chromosomes can be refined in one step Perform chromosomal mapping accurately.
  • FI SH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human sailor transposase 19 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human sailor transposase 19 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une mariner transposase 19 humaine, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la mariner transposase 19 humaine.
PCT/CN2000/000601 1999-12-22 2000-12-18 Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide WO2001046240A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU19867/01A AU1986701A (en) 1999-12-22 2000-12-18 A novel polypeptide - human mariner transposase 19 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 99125674 CN1300827A (zh) 1999-12-22 1999-12-22 一种新的多肽—人水手转座酶19和编码这种多肽的多核苷酸
CN99125674.3 1999-12-22

Publications (1)

Publication Number Publication Date
WO2001046240A1 true WO2001046240A1 (fr) 2001-06-28

Family

ID=5284087

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000601 WO2001046240A1 (fr) 1999-12-22 2000-12-18 Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1300827A (fr)
AU (1) AU1986701A (fr)
WO (1) WO2001046240A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2850395A1 (fr) * 2003-01-28 2004-07-30 Centre Nat Rech Scient Transposases d'elements genetiques mobiles mariner mutantes, non phosphorylables et hyperactives

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103627684B (zh) * 2013-11-20 2016-07-06 浙江农林大学 人工优化的高活性Mariner-Like转座酶

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998040510A1 (fr) * 1997-03-11 1998-09-17 Regents Of The University Of Minnesota Systeme transposon a base d'adn permettant d'introduire de l'acide nucleique dans l'adn d'une cellule
US5869296A (en) * 1987-10-05 1999-02-09 Washington University DNA transposon Tn5seq1

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5869296A (en) * 1987-10-05 1999-02-09 Washington University DNA transposon Tn5seq1
WO1998040510A1 (fr) * 1997-03-11 1998-09-17 Regents Of The University Of Minnesota Systeme transposon a base d'adn permettant d'introduire de l'acide nucleique dans l'adn d'une cellule

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2850395A1 (fr) * 2003-01-28 2004-07-30 Centre Nat Rech Scient Transposases d'elements genetiques mobiles mariner mutantes, non phosphorylables et hyperactives
WO2004078981A1 (fr) * 2003-01-28 2004-09-16 Centre National De La Recherche Scientifique (C.N.R.S.) TRANSPOSASES D'ELEMENTS GENETIQUES MOBILES mariner MUTANTES, NON PHOSPHORYLABLES ET HYPERACTIVES
JP2006518220A (ja) * 2003-01-28 2006-08-10 サントル、ナショナール、ド、ラ、ルシェルシュ、シアンティフィク、（セーエヌエルエス） マリナー可動遺伝因子の突然変異、リン酸化不能および機能亢進性トランスポゼース

Also Published As

Publication number Publication date
AU1986701A (en) 2001-07-03
CN1300827A (zh) 2001-06-27

Similar Documents

Publication Publication Date Title
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2001046240A1 (fr) Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001038540A1 (fr) Nouveau polypeptide, la methionyl arnt synthetase humaine de 29 kda, et polynucleotide codant pour ledit polypeptide
WO2001074870A1 (fr) Nouveau polypeptide, alpha-galactosidase humaine a-11, et polynucleotide codant pour ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001066575A1 (fr) Nouveau polypeptide, actine 49, et polynucleotide codant pour ce polypeptide
WO2001046238A1 (fr) Nouveau polypeptide, alpha-1b-glycoproteine humaine 12, et polynucleotide codant pour ce polypeptide
WO2001055412A1 (fr) Nouveau polypeptide, phosphoenolpyruvate carboxylase 81, et polynucleotide codant pour ce polypeptide
WO2001075085A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2001083540A1 (fr) Nouveau polypeptide, kiaa0883-44, et polynucleotide codant pour ce polypeptide
WO2001081395A1 (fr) Nouveau polypeptide, adn topo-isomerase i-15, et polynucleotide codant pour ce polypeptide
WO2001073061A1 (fr) Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide
WO2001081393A1 (fr) Nouveau polypeptide, proteine kinase ysk1 humaine 20, et polynucleotide codant pour ce polypeptide
WO2001074995A2 (fr) Nouveau polypeptide, protéine humaine de mutation 15 de l'ataxie telangiectasie, et de polynucléotide codant pour ce polypeptide
WO2001094567A1 (fr) Nouveau polypeptide, transposase de la famille tc1/mariner humaine 11, et polynucleotide codant ce polypeptide
WO2001070994A1 (fr) Nouveau polypeptide, dihydropyridine dicarboxylate deshydrogenase humaine 18, et polynucleotide codant pour ce polypeptide
WO2001077286A2 (fr) Nouveau polypeptide, globine humaine 58 de l'uterus, et un polynucleotide codant pour ce polypeptide
WO2001081537A2 (fr) Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide
WO2001075005A2 (fr) Nouveau polypeptide, sous-unite c de l'atpase pompe a protons vacuolaire (v-atpase) 12, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2001074894A1 (fr) Nouveau polypeptide, proteine humaine de regulation 12 de la proteine phosphorylase, et polynucleotide codant pour ce polypeptide
WO2001073041A1 (fr) Nouveau polypeptide, adn ligase humaine 15, et polynucleotide codant pour ce polypeptide
WO2001040295A1 (fr) Nouveau polypeptide, proteine humaine 48 a doigt de zinc, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP