WO2001055412A1 - Nouveau polypeptide, phosphoenolpyruvate carboxylase 81, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, phosphoenolpyruvate carboxylase 81, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001055412A1
WO2001055412A1 PCT/CN2001/000029 CN0100029W WO0155412A1 WO 2001055412 A1 WO2001055412 A1 WO 2001055412A1 CN 0100029 W CN0100029 W CN 0100029W WO 0155412 A1 WO0155412 A1 WO 0155412A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
phosphoenolpyruvate carboxylase
human
sequence
Prior art date
Application number
PCT/CN2001/000029
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biodoor Gene Technology Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biodoor Gene Technology Ltd. Shanghai filed Critical Biodoor Gene Technology Ltd. Shanghai
Priority to AU2001229967A priority Critical patent/AU2001229967A1/en
Publication of WO2001055412A1 publication Critical patent/WO2001055412A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human phosphoenolpyruvate carboxylase 81, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • Phosphoenolpyruvate carboxylase catalyzes the ⁇ -carboxylation of phosphoenolpyruvate to form oxaloacetate and inorganic phosphoric acid. This response is irreversible.
  • the reaction formula is:
  • Phosphoenolpyruvate carboxylase is found in all plants and many types of microorganisms, and is an important step for C4 plants to fix CO 2 through the C-4 cycle. During the development of seed cotyledons, phosphoenolpyruvate carboxylase plays an important role in the synthesis of organic acids and provides a carbon skeleton for the synthesis of amino acids. [GolombekS, Planta 1999 Mar; 208 (1): 66-72] Analysis of the crystal structure of phosphoenolpyruvate carboxylase from bacteria found that four subunits each form a square structure in groups of two, the cc helix and The ⁇ -sheet content was 65% and 5%, respectively.
  • P-barrel P-barrel
  • Two movable ring structures constitute the active region of the enzyme.
  • Histidine and lysine play important roles in enzyme activity. If the histidine 138 of bacterial phosphoenolpyruvate carboxylase is mutated to aspartic acid, the mutant enzyme lacks carboxylation activity, but can catalyze bicarbonate-dependent dephosphorylation. If the histidine residue at position 579 of this enzyme is mutated to aspartic acid, the mutated enzyme activity is 69 ° / of wild-type carboxylase.
  • amino acid sequences near these two conserved amino acid residues are consistent in different plants and bacteria and cyanobacteria, and can be used as the characteristic sequence of the enzyme: [VT] — X— T— A— H— P—T — [EQ] -x (2) -R- [KRH], where H is the enzyme active site; [IV] -M- [LIVM] -GYSDSXKD- [STAG] -G, where K is the enzyme active site.
  • the polypeptide of the present invention contains the characteristic conserved sequence of phosphoenolpyruvate carboxylase, so it is considered to be a new member of the enzyme family, which has a biological function common to the enzyme family, and is named human phosphoenolpyruvate carboxylation Enzyme XX.
  • human phosphoenolpyruvate carboxylase 81 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more people involved in these processes Phosphoenolpyruvate carboxylase 81 protein, particularly the amino acid sequence of this protein was identified.
  • New Isolation of the gene encoding human phosphoenolpyruvate carboxylase 81 protein also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human phosphoenolpyruvate carboxylase 81.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human phosphoenolpyruvate carboxylase 81.
  • Another object of the present invention is to provide a method for producing human phosphoenolpyruvate carboxylase 81.
  • Another object of the present invention is to provide an antibody against the polypeptide-human phosphoenolpyruvate carboxylase 81 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human phosphoenolpyruvate carboxylase 81.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human phosphoenolpyruvate carboxylase 81.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 76-2289 in SEQ ID NO: 1; and (b) a sequence having 1-2863 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human phosphoenolpyruvate carboxylase 81 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of the human phosphoenolpyruvate carboxylase 81 protein, which comprises detecting mutations in the polypeptide or a sequence encoding the polynucleotide in a biological sample Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the present invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human phosphoenolpyruvate carboxylase 81. .
  • Nucleic acid sequence means an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genome or a synthesis DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and a fragment or part thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acid or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • “Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similar The term “immunologically active” refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human phosphoenolpyruvate carboxylase 81, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human phosphoenolpyruvate carboxylase 81.
  • Antagonist refers to a biological or immunological activity that can block or modulate human phosphoenolpyruvate carboxylase 81 when combined with human phosphoenolpyruvate carboxylase 81 Molecule.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human phosphoenolpyruvate carboxylase 81.
  • Regular refers to a change in the function of human phosphoenolpyruvate carboxylase 81, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties of human phosphoenolpyruvate carboxylase 81 , Functional or immune properties.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human phosphoenolpyruvate carboxylase 81 using standard protein purification techniques. Basically pure human phosphoenolpyruvate carboxylase 81 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human phosphoenolpyruvate carboxylase 81 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of a polynucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits the hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. Then cluster each cluster in pairs or Group allocation. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by a method known in the art such as Jotun He in. (Hein J., (1990) Methods in emzumology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the primary biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and? ⁇ It can specifically bind to the epitope of human phosphoenolpyruvate carboxylase 81.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human phosphoenolpyruvate carboxylase 81 means that human phosphoenolpyruvate carboxylase 81 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated.
  • ability Those skilled in the art can purify human phosphoenolpyruvate carboxylase 81 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human phosphoenolpyruvate carboxylase 81 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human phosphoenolpyruvate carboxylase 81, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human phosphoenolpyruvate carboxylase 81.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human phosphoenolpyruvate carboxylase 81 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
  • such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide) consisting essentially of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2863 bases and its open reading frame of 76-2289 encodes 737 amino acids.
  • This polypeptide has a characteristic sequence of a characteristic sequence of a phosphoenolpyruvate carboxylase, and it can be deduced that the human phosphoenolpyruvate carboxylase 81 has a structure and a function represented by the characteristic sequence of a phosphenolpyruvate carboxylase.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; The coding sequence of the cooked polypeptide and various additional coding sequences; the coding sequence (and optional additional coding sequences) of the mature polypeptide and non-coding sequences.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that encodes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least two sequences between
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 ° /. SDS, 60 ⁇ ; or (2) adding denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi col l, 42 ° C, etc .; or (3 ) Hybridization occurs only when the identity between the two sequences is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human phosphoenolpyruvate carboxylase 81.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human phosphoenolpyruvate carboxylase 81 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the transcript of human phosphoenolpyruvate carboxylase 81 Level; (4) detecting protein products of gene expression by immunological techniques or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of the human phosphoenolpyruvate carboxylase 81 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method for amplifying DNA / RNA using PCR technology is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be separated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human phosphoenolpyruvate carboxylase 81 coding sequence, and recombinant technology to produce the present invention. Said method of polypeptide.
  • a polynucleotide sequence encoding human phosphoenolpyruvate carboxylase 81 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, which are well known in the art. Transcript virus or other vector.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human phosphoenolpyruvate carboxylase 81 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Labora tory Manua 1, Cold Spring Harbor Labora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on the promoter to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human phosphoenolpyruvate carboxylase 81 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetic engineering containing the polynucleotide or the recombinant vector.
  • Host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • DNA sequence of the present invention or a recombinant vector containing the DNA sequence to transform a host cell is useful
  • the conventional techniques are well known to those skilled in the art.
  • the host is a prokaryote such as E. coli, it can absorb
  • DNA competent cells harvested after exponential growth phase, treated with CaC l 2 method used in the step are well known in the art.
  • the alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human phosphoenolpyruvate carboxylase 81 by conventional recombinant DNA technology (Scence, 1984; 224: 1431). Generally there are the following steps:
  • polynucleotide or variant encoding human human phosphoenolpyruvate carboxylase 81 of the present invention, or transform or transduce a suitable host cell with a recombinant expression vector containing the polynucleotide ;
  • the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
  • Fig. 1 is a comparison diagram of the amino acid sequences of the characteristic sequences of human phosphoenolpyruvate carboxylase 81 and phosphoenolpyruvate carboxylase of the present invention.
  • Figure 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of the isolated human phosphoenolpyruvate carboxylase 81.
  • 81KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • the experimental methods in the following examples are not marked with specific conditions, usually according to conventional conditions such as Sambrook et al., Molecular cloning: the conditions described in the laboratory manual (New York: Cold Harbor Harbor Laboratory Press, 1989), or according to the manufacturing conditions Conditions recommended by the manufacturer.
  • Example 1 Cloning of human phosphoenolpyruvate carboxylase 81
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA was formed into cDNA by reverse transcription. A Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ . The bacteria formed a cDNA library.
  • Dye termina te cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the cloned insert cDNA fragment was bidirectionally determined by synthesizing a series of primers.
  • the 0665a02 clone contained a full-length cDNA of 2863bp (as shown in Seq ID NO: 1), and a 2214bp open reading frame (0RF) from 76bp to 2289bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • This clone pBS-0665a02 and the encoded protein was named human phosphoenolpyruvate carboxylase 81.
  • Example 2 Domain analysis of cDNA clones
  • the sequence of the human phosphoenolpyruvate carboxylase 81 of the present invention and the protein sequence encoded by the same were prepared using prof i le scan lj ⁇ (Bas icloca l Al ignment search tool) in GCG [Al tschul, SF et a l J. Mol. Biol. 1990; 215: 403-10], domain analysis was performed in a database such as Proste.
  • the human phosphoenolpyruvate carboxylase 81 of the present invention is homologous to the characteristic sequence of the domain phosphoenolpyruvate carboxylase. The homology results are shown in FIG. 1.
  • Example 3 Cloning of a gene encoding human phosphoenolpyruvate carboxylase 81 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Pr imerl 5-GGAATTTTCCGAAATCCCTTTTAT -3 '(SEQ ID NO: 3)
  • Pr imer2 5'- AAAGGAAGGAAAATATTTTATTAA -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of bp in SEQ ID NO: 1; Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l / L KC1, 10 mmol / L Tris-CI, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a reaction volume of 50 ⁇ 1 , 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen).
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2863bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human phosphoenolpyruvate carboxylase 81 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] rempliThis method involves acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M acetic acid sodium (P H4.0) of the tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform - isoamyl alcohol. (49: 1), mixed with the water absorbing layer centrifugation, isopropanol ( 0.8 volume) and the mixture was centrifuged to obtain an RNA pellet. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA probe 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7) .0) - electrophoresed on ImM EDTA-2.2M formaldehyde-1.2% agarose gel and transferred to nitrocellulose membranes Preparation of a- 32 P dATP using 32 P- labeled by random priming Method - 5 mM sodium acetate. DNA probe.
  • the DNA probe used was the PCR amplified human phosphoenolpyruvate carboxylase 81 coding region sequence (76 bp to 2289 bp) shown in Figure 1.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) and transferred to a nitrocellulose membrane RNA is hybridized overnight at 42 ° C in a solution, the solution comprising 50% formamide -25mM KH 2 P0 4 (pH7.4) -5 SSC-5 ⁇
  • Example 5 In vitro expression, isolation and purification of recombinant human phosphoenolpyruvate carboxylase 81
  • Primer3 5'- CATGCTAGCATGAAGATTGGTATTGTCAGACGG -3 '(Seq ID No: 5)
  • Primer4 5'- CCCGAATTCTCAAAATGAGCTCCAATACAAATG -3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Nhel and EcoRI digestion sites, respectively, followed by the coding sequences of the 5 'and 3, ends of the target gene, respectively.
  • the Nhel and EcoRI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid P ET 28b (+) (Novagen, Cat. No. 69865.3).
  • PCR was performed using the pBS-0665a02 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are: pBS- 0665a02 in a total volume of 50 ⁇ 1 Plasmid 10pg, Primer-3 and Primer-3? 11161 "-4 points and 1 for 1 ( ⁇ [1101, Advantage polymerase Mix (Clontech)) 1 ⁇ 1. Cycle parameters: 94.C 20s, 60.C 30s, 68 ° C 2 min, 25 cycles in total The digestion product and plasmid pET-28 (+) were double-digested with Nhel and EcoRI, respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed by the calcium chloride method of coliform bacteria DH5a.
  • kanamycin final concentration 30 ⁇ g / ml
  • colony PCR method was used to screen positive clones and sequenced.
  • Select positive clones pET-0665a02 with the correct sequence and use the calcium chloride method to transform the recombinant plasmid E. coli BL21 (DE3) plySs (Novagen) was transformed.
  • the host strain BL21 pET-0665a02 was cultured at 37 ° C. to In the logarithmic growth phase, add IPTG to a final concentration of 1 mmol / L, and continue the cultivation for 5 hours.
  • a titer plate coated with 15 ⁇ g / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human phosphoenolpyruvate carboxylase 81.
  • Example 7 Use of a polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Organization Whether the expression in the cell is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods, etc. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps. In this embodiment, higher-intensity washing conditions (such as lower salt concentration and higher temperature) are used to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the invention; the second type of probes are partially related to the invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The region is compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt): 5'- TGAAGATTGGTATTGTCAGACGGATTTTGCTAACTTTAGTA -3 '(SEQ ID NO: 9)
  • probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt): 5'- TGAAGATTGGTATTGTCAGACGGATTTTGCTAACTTTAGTA -3 '(SEQ ID NO: 9)
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag, and 3- 10 mg of prehybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml) was added.
  • prehybridization solution lOxDenhardt's; 6xSSC, 0.1 mg / ml
  • CT DNA (calf thymus DNA).
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Phosphoenolpyruvate carboxylase catalyzes the P-carboxylation of phosphoenolpyruvate to form oxaloacetate and inorganic phosphoric acid. This response is irreversible. The reaction products are of great significance in the tricarboxylic acid cycle. Histidine and lysine in the phosphoenolpyruvate carboxylase sequence play an important role in the activity of the enzyme, and its mutations can cause a decrease in enzyme activity and a decrease in affinity with phosphoenolpyruvate. The characteristic conserved sequence of phosphoenolpyruvate carboxylase is necessary for its activity.
  • the polypeptide of the present invention contains a characteristic conserved sequence of a phosphoenolpyruvate carboxylase and has a biological function similar to that of the phosphoenolpyruvate carboxylase, which is of great significance for the substance and energy metabolism of the tricarboxylic acid cycle.
  • abnormal expression of the human phosphoenolpyruvate carboxylase 81 of the present invention will produce various diseases. Diseases, especially those related to substance and energy metabolism, various tumors, and disorders of growth and development. These diseases include but are not limited to:
  • disorders related to energy and substance metabolism disorders isovaleric acidemia, propionic acidemia, methylmalonic aciduria, combined carboxylase deficiency, glutaric acid type I, phenylketonuria, albinism, color Aminoemia, Glycineemia, Hypersarcosineemia, Metabolism of glutamate, Metabolism of urea cycle, Metabolism of histidine deficiency, Metabolism of lysine, Mucopolysaccharidosis Type I ⁇ ⁇ , Mucolipid storage disease, Ray-niney syndrome, xanthineuria, orotic aciduria, adenine deaminase deficiency, hyperlipoproteinemia, familial hyperalpha-lipoproteinemia, congenital Lactose intolerance, hereditary fructose intolerance, galactosemia, defects in fructose metabolism, glycogen storage disease
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal and sinus tumors, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma
  • Growth disorders mental retardation, cerebral palsy, mental retardation, mental retardation, familial cerebellar dysplasia, strabismus, skin, fat, and muscular dysplasias such as congenital skin relaxation, albinism , Alzheimer's disease, congenital keratosis, bone and joint dysplasia diseases such as cartilage dysplasia, epiphyseal dysplasia, metabolic bone disease, various metabolic defects such as various amino acid metabolic defects, dementia, dwarfism Cushing syndrome, sexual retardation
  • Abnormal expression of the human phosphoenolpyruvate carboxylase 81 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially diseases related to substances and energy metabolism, various tumors, and disorders of growth and development, Certain hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human phosphoenol pyruvate carboxylase 81. Agonists enhance human phosphoenolpyruvate carboxylase 81 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human phosphoenolpyruvate carboxylase 81 can be cultured with labeled human phosphoenolpyruvate carboxylase 81 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human phosphoenolpyruvate carboxylase 81 include antibodies, compounds, and receptor deficiency screened Lost property and the like. Antagonists of human phosphoenolpyruvate carboxylase 81 can bind to human phosphoenolpyruvate carboxylase 81 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide such that The polypeptide cannot perform biological functions.
  • human phosphoenolpyruvate carboxylase 81 When screening compounds as antagonists, human phosphoenolpyruvate carboxylase 81 can be added to the bioanalytical assay. Influence to determine if a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human phosphoenolpyruvate carboxylase 81 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, generally, 81 molecules of human phosphoenolpyruvate carboxylase should be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against human phosphoenolpyruvate carboxylase 81 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human phosphoenolpyruvate carboxylase 81 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to human phosphoenolpyruvate carboxylase 81 include, but are not limited to, hybridoma technology (Koh ler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, Human B-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al., PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human phosphoenolpyruvate carboxylase 81.
  • Antibodies against human phosphoenolpyruvate carboxylase 81 can be used in immunohistochemical techniques to detect human phosphoenolpyruvate carboxylase 81 in biopsy specimens.
  • Monoclonal antibodies that bind to human phosphoenolpyruvate carboxylase 81 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human phosphoenolpyruvate carboxylase 81 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human phosphoenolpyruvate carboxylase 81 positive cells.
  • the antibodies in the present invention can be used to treat or prevent diseases related to human phosphoenolpyruvate carboxylase 81.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human phosphoenolpyruvate carboxylase 81.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human phosphoenolpyruvate carboxylase 81 levels. These tests are well known in the art and include F I SH assays and radioimmunoassays.
  • the level of human phosphoenolpyruvate carboxylase 81 detected in the test can be used to explain the importance of human phosphoenolpyruvate carboxylase 81 in various diseases and to diagnose human phosphoenolpyruvate carboxylase Disease in which enzyme 81 acts.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
  • the polynucleotide encoding human phosphoenolpyruvate carboxylase 81 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human phosphoenolpyruvate carboxylase 81.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human phosphoenolpyruvate carboxylase 81 to inhibit endogenous human phosphoenolpyruvate carboxylase 81 activity.
  • a variant human phosphoenolpyruvate carboxylase 81 may be a shortened human phosphoenolpyruvate carboxylase 81, which lacks a signaling domain, and although it can bind to a downstream substrate, it lacks Signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human phosphoenolpyruvate carboxylase 81.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human phosphoenolpyranoate carboxylase 81 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding human phosphoenolpyruvate carboxylase 81 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human phosphoenolpyruvate carboxylase 81 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human phosphoenolpyruvate carboxylase 81 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RM, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis methods has been widely used.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DNA sequence has been integrated into the vector's RNA polymerase primer Downstream of the mover. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human phosphoenolpyruvate carboxylase 81 can be used for the diagnosis of diseases related to human phosphoenolpyruvate carboxylase 81.
  • a polynucleotide encoding human phosphoenolpyruvate carboxylase 81 can be used to detect the expression of human phosphoenolpyruvate carboxylase 81 or abnormal expression of human phosphoenolpyruvate carboxylase 81 in a disease state .
  • a DNA sequence encoding human phosphoenolpyruvate carboxylase 81 can be used to hybridize biopsy specimens to determine the expression of human phosphoenolpyruvate carboxylase 81.
  • Hybridization techniques include Sou thern blotting, Northern blotting, and in situ hybridization. These technical methods are all mature technologies that are publicly available, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microcroix) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and Genetic diagnosis.
  • Human phosphoenolpyruvate carboxylase 81 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect the transcription product of human phosphoenolpyruvate carboxylase 81.
  • Human phosphoenolpyruvate carboxylase 81 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human phosphoenolpyruvate carboxylase 81 DNA sequence. Mutations can be detected using existing techniques such as Sou thern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells containing human genes corresponding to the primers will produce amplified fragments.
  • Somatic cell hybridization by PCR is a quick and easy way to map D to a specific chromosome.
  • a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inherance in Man (available online with Johns Hopkins University Welch Medi Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
  • the polypeptide of the present invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human phosphoenolpyruvate carboxylase 81 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human phosphoenolpyruvate carboxylase 81 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une phosphoénolpyruvate carboxylase 81, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la phosphoénolpyruvate carboxylase 81.
PCT/CN2001/000029 2000-01-26 2001-01-15 Nouveau polypeptide, phosphoenolpyruvate carboxylase 81, et polynucleotide codant pour ce polypeptide WO2001055412A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001229967A AU2001229967A1 (en) 2000-01-26 2001-01-15 Novel polypeptide---human phosphoenol pyruvate carboxylase 81 and polynucleotideencoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00111511.1 2000-01-26
CN 00111511 CN1307104A (zh) 2000-01-26 2000-01-26 一种新的多肽——人磷酸烯醇丙酮酸羧化酶81和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001055412A1 true WO2001055412A1 (fr) 2001-08-02

Family

ID=4581421

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000029 WO2001055412A1 (fr) 2000-01-26 2001-01-15 Nouveau polypeptide, phosphoenolpyruvate carboxylase 81, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1307104A (fr)
AU (1) AU2001229967A1 (fr)
WO (1) WO2001055412A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MX2010001128A (es) * 2007-07-31 2010-03-09 Basf Plant Science Gmbh Plantas que contienen rasgos mejorados relacionados con el rendimiento y un metodo para obtenerlas.

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH0866189A (ja) * 1994-08-31 1996-03-12 Mitsubishi Chem Corp 新規ｄｎａ断片
JPH09107975A (ja) * 1995-10-19 1997-04-28 Mitsui Toatsu Chem Inc 単子葉ＣＡＭ植物のＰＥＰＣａｓｅ遺伝子

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH0866189A (ja) * 1994-08-31 1996-03-12 Mitsubishi Chem Corp 新規ｄｎａ断片
JPH09107975A (ja) * 1995-10-19 1997-04-28 Mitsui Toatsu Chem Inc 単子葉ＣＡＭ植物のＰＥＰＣａｓｅ遺伝子

Also Published As

Publication number Publication date
CN1307104A (zh) 2001-08-08
AU2001229967A1 (en) 2001-08-07

Similar Documents

Publication Publication Date Title
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2001055425A1 (fr) Nouveau polypeptide, proteine phosphatase humaine 2c26, et polynucleotide codant pour ce polypeptide
WO2001055412A1 (fr) Nouveau polypeptide, phosphoenolpyruvate carboxylase 81, et polynucleotide codant pour ce polypeptide
WO2001047968A1 (fr) Nouveau polypeptide, hexokinase 12, et polynucleotide codant pour ce polypeptide
WO2001046240A1 (fr) Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide
WO2001085903A2 (fr) Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier de p5cr, et polynucleotide codant pour ce polypeptide
WO2001038540A1 (fr) Nouveau polypeptide, la methionyl arnt synthetase humaine de 29 kda, et polynucleotide codant pour ledit polypeptide
WO2001072815A1 (fr) Nouveau polypeptide, ferredoxine humaine 12, et polynucleotide codant pour ce polypeptide
WO2002002611A1 (fr) Nouveaux polypeptides, domaine de repetition 12 de recepteurs peptidiques de la motilite du sperme et proteine ribosomale l22, et polynucleotides codant ces polypeptides
WO2001055404A1 (fr) Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide
WO2001064733A1 (fr) Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001048173A1 (fr) Nouveau polypeptide, aminoacyl-arnt synthetase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001087953A1 (fr) Nouveau polypeptide, galactokinase humaine 11, et polynucleotide codant ce polypeptide
WO2001049858A1 (fr) NOUVEAU POLYPEPTIDE, η-GLUTAMYL TRANSPEPTIDASE 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001075085A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide
WO2001046441A1 (fr) Nouveau polypeptide, proteine humaine shc 43, et polynucleotide codant pour ce polypeptide
WO2001049738A1 (fr) Nouveau polypeptide, proteine fkbp humaine 11, et polynucleotide codant pour ce polypeptide
WO2001048159A1 (fr) Nouveau polypeptide, dihydroorotase 9, et polynucleotide codant pour ce polypeptide
WO2001072791A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2002012323A1 (fr) Nouveau polypeptide, proteine secretrice 11 de la famille des hlyd, et polynucleotide codant ce polypeptide
WO2002012305A1 (fr) Nouveau polypeptide, avidine 9, et polynucleotide codant ce polypeptide
WO2001081381A1 (fr) Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier d'une recombinase specifique au site, et polynucleotide codant pour ce polypeptide
WO2001083776A1 (fr) Nouveau polypeptide, hormone de croissance humaine 11, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP