WO2001055412A1 - Novel polypeptide---human phosphoenol pyruvate carboxylase 81 and polynucleotide encoding it - Google Patents

Abstract

The invention concerns human phosphoenol pyruvate carboxylase 81 and polynucleotide encoding it. The invention also concerns the process of producing the polypeptide by recombinant DNA technique. The methods for treating many diseases e.g. malignant tumor, hemopathy, infection of HIV, immunological diseases and a variety of inflammations utilizing the polypeptide are disclosed. The invention discloses the antagonist against the polypeptide and therapeutics thereof. The invention also discloses the uses of the polynucleotide, which encodes human phosphoenol pyruvate carboxylase 81.

Description

 A new polypeptide-human phosphoenolpyruvate carboxylase 81 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human phosphoenolpyruvate carboxylase 81, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique

 Phosphoenolpyruvate carboxylase catalyzes the β-carboxylation of phosphoenolpyruvate to form oxaloacetate and inorganic phosphoric acid. This response is irreversible. The reaction formula is:

 CH2 = C (OP03H2) C02H + C02 + H20? = → C02HCOCii2C02H + Pi

Phosphoenolpyruvate carboxylase is found in all plants and many types of microorganisms, and is an important step for C4 plants to fix CO ₂ through the C-4 cycle. During the development of seed cotyledons, phosphoenolpyruvate carboxylase plays an important role in the synthesis of organic acids and provides a carbon skeleton for the synthesis of amino acids. [GolombekS, Planta 1999 Mar; 208 (1): 66-72] Analysis of the crystal structure of phosphoenolpyruvate carboxylase from bacteria found that four subunits each form a square structure in groups of two, the cc helix and The β-sheet content was 65% and 5%, respectively. All P-folds form a P-barrel structure (P-barrel). Two movable ring structures constitute the active region of the enzyme. [Kai Y, Mats Ra H et al, Proc Natl Acad Sci US A 1999 Feb 2; 96 (3): 823-8] Histidine and lysine play important roles in enzyme activity. If the histidine 138 of bacterial phosphoenolpyruvate carboxylase is mutated to aspartic acid, the mutant enzyme lacks carboxylation activity, but can catalyze bicarbonate-dependent dephosphorylation. If the histidine residue at position 579 of this enzyme is mutated to aspartic acid, the mutated enzyme activity is 69 ° / of wild-type carboxylase. , But the affinity with phosphoenolpyruvate decreased 24 times. [TeradaKetal, Eur J Biochem 1991 Dec 18; 202 (3): 797-803] ₀ Another conserved amino acid residue is lysine at position 606. [Jiao JA, Biochim Biophys Acta 1990 Dec 5; 1041 (3): 291-5]

 The amino acid sequences near these two conserved amino acid residues are consistent in different plants and bacteria and cyanobacteria, and can be used as the characteristic sequence of the enzyme: [VT] — X— T— A— H— P—T — [EQ] -x (2) -R- [KRH], where H is the enzyme active site; [IV] -M- [LIVM] -GYSDSXKD- [STAG] -G, where K is the enzyme active site.

 The polypeptide of the present invention contains the characteristic conserved sequence of phosphoenolpyruvate carboxylase, so it is considered to be a new member of the enzyme family, which has a biological function common to the enzyme family, and is named human phosphoenolpyruvate carboxylation Enzyme XX.

Since the human phosphoenolpyruvate carboxylase 81 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more people involved in these processes Phosphoenolpyruvate carboxylase 81 protein, particularly the amino acid sequence of this protein was identified. New Isolation of the gene encoding human phosphoenolpyruvate carboxylase 81 protein also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human phosphoenolpyruvate carboxylase 81 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human phosphoenolpyruvate carboxylase 81.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human phosphoenolpyruvate carboxylase 81.

 Another object of the present invention is to provide a method for producing human phosphoenolpyruvate carboxylase 81.

 Another object of the present invention is to provide an antibody against the polypeptide-human phosphoenolpyruvate carboxylase 81 of the present invention.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human phosphoenolpyruvate carboxylase 81.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human phosphoenolpyruvate carboxylase 81.

 The present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 76-2289 in SEQ ID NO: 1; and (b) a sequence having 1-2863 in SEQ ID NO: 1 Sequence of bits.

The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product. The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human phosphoenolpyruvate carboxylase 81 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of the human phosphoenolpyruvate carboxylase 81 protein, which comprises detecting mutations in the polypeptide or a sequence encoding the polynucleotide in a biological sample Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.

 The present invention also relates to a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human phosphoenolpyruvate carboxylase 81. .

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated:-"Nucleic acid sequence" means an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genome or a synthesis DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and a fragment or part thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acid or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

"Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similar The term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with human phosphoenolpyruvate carboxylase 81, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human phosphoenolpyruvate carboxylase 81.

 "Antagonist" or "inhibitor" refers to a biological or immunological activity that can block or modulate human phosphoenolpyruvate carboxylase 81 when combined with human phosphoenolpyruvate carboxylase 81 Molecule. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human phosphoenolpyruvate carboxylase 81.

 "Regulation" refers to a change in the function of human phosphoenolpyruvate carboxylase 81, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties of human phosphoenolpyruvate carboxylase 81 , Functional or immune properties.

 "Substantially pure" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human phosphoenolpyruvate carboxylase 81 using standard protein purification techniques. Basically pure human phosphoenolpyruvate carboxylase 81 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human phosphoenolpyruvate carboxylase 81 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of a polynucleotide by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits the hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that two sequences bind to each other as a specific or selective interaction.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. Then cluster each cluster in pairs or Group allocation. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of matching residues between sequence A and sequence X 100

(The number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B) The percent identity between nucleic acid sequences can also be determined by the Clus ter method or by a method known in the art such as Jotun He in. (Hein J., (1990) Methods in emzumology 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the primary biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') ₂ and? ^ It can specifically bind to the epitope of human phosphoenolpyruvate carboxylase 81.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .

As used herein, "isolated human phosphoenolpyruvate carboxylase 81" means that human phosphoenolpyruvate carboxylase 81 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Ability Those skilled in the art can purify human phosphoenolpyruvate carboxylase 81 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human phosphoenolpyruvate carboxylase 81 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, human phosphoenolpyruvate carboxylase 81, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of human phosphoenolpyruvate carboxylase 81. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human phosphoenolpyruvate carboxylase 81 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (Π Ι) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) As set forth herein, such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide) consisting essentially of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2863 bases and its open reading frame of 76-2289 encodes 737 amino acids. This polypeptide has a characteristic sequence of a characteristic sequence of a phosphoenolpyruvate carboxylase, and it can be deduced that the human phosphoenolpyruvate carboxylase 81 has a structure and a function represented by the characteristic sequence of a phosphenolpyruvate carboxylase.

 The polynucleotide of the present invention may be in the form of DNA or RM. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used in the present invention, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; The coding sequence of the cooked polypeptide and various additional coding sequences; the coding sequence (and optional additional coding sequences) of the mature polypeptide and non-coding sequences.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that encodes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least two sequences between

50%, preferably 70% identity). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 ° /. SDS, 60Ό; or (2) adding denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi col l, 42 ° C, etc .; or (3 ) Hybridization occurs only when the identity between the two sequences is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human phosphoenolpyruvate carboxylase 81.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human phosphoenolpyruvate carboxylase 81 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available. Obtained (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the transcript of human phosphoenolpyruvate carboxylase 81 Level; (4) detecting protein products of gene expression by immunological techniques or measuring biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, the protein product of the human phosphoenolpyruvate carboxylase 81 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

 A method for amplifying DNA / RNA using PCR technology (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-rapid amplification of cDNA ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be separated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human phosphoenolpyruvate carboxylase 81 coding sequence, and recombinant technology to produce the present invention. Said method of polypeptide.

In the present invention, a polynucleotide sequence encoding human phosphoenolpyruvate carboxylase 81 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, which are well known in the art. Transcript virus or other vector. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Na thans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human phosphoenolpyruvate carboxylase 81 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Labora tory Manua 1, Cold Spring Harbor Labora tory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the l ac or trp promoter of E. coli; the _PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, and early and late SV40 Promoters, retroviral LTRs, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on the promoter to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding human phosphoenolpyruvate carboxylase 81 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetic engineering containing the polynucleotide or the recombinant vector. Host cell. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Use of the DNA sequence of the present invention or a recombinant vector containing the DNA sequence to transform a host cell is useful The conventional techniques are well known to those skilled in the art. When the host is a prokaryote such as E. coli, it can absorb

DNA competent cells harvested after exponential growth phase, treated with CaC l ₂ method used in the step are well known in the art. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 The polynucleotide sequence of the present invention can be used to express or produce recombinant human phosphoenolpyruvate carboxylase 81 by conventional recombinant DNA technology (Scence, 1984; 224: 1431). Generally there are the following steps:

 (1) Use the polynucleotide (or variant) encoding human human phosphoenolpyruvate carboxylase 81 of the present invention, or transform or transduce a suitable host cell with a recombinant expression vector containing the polynucleotide ;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 Fig. 1 is a comparison diagram of the amino acid sequences of the characteristic sequences of human phosphoenolpyruvate carboxylase 81 and phosphoenolpyruvate carboxylase of the present invention.

Figure 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of the isolated human phosphoenolpyruvate carboxylase 81. 81KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods in the following examples are not marked with specific conditions, usually according to conventional conditions such as Sambrook et al., Molecular cloning: the conditions described in the laboratory manual (New York: Cold Harbor Harbor Laboratory Press, 1989), or according to the manufacturing conditions Conditions recommended by the manufacturer. Example 1: Cloning of human phosphoenolpyruvate carboxylase 81

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA was formed into cDNA by reverse transcription. A Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5α. The bacteria formed a cDNA library. Dye termina te cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. Comparing the determined cDNA sequence with the existing public DNA sequence database (Genebank), it was found that the cDNA sequence of one of the clones 0665a02 was new DNA. The cloned insert cDNA fragment was bidirectionally determined by synthesizing a series of primers. The results showed that the 0665a02 clone contained a full-length cDNA of 2863bp (as shown in Seq ID NO: 1), and a 2214bp open reading frame (0RF) from 76bp to 2289bp, encoding a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS-0665a02, and the encoded protein was named human phosphoenolpyruvate carboxylase 81. Example 2: Domain analysis of cDNA clones

 The sequence of the human phosphoenolpyruvate carboxylase 81 of the present invention and the protein sequence encoded by the same were prepared using prof i le scan lj ^ (Bas icloca l Al ignment search tool) in GCG [Al tschul, SF et a l J. Mol. Biol. 1990; 215: 403-10], domain analysis was performed in a database such as Proste. The human phosphoenolpyruvate carboxylase 81 of the present invention is homologous to the characteristic sequence of the domain phosphoenolpyruvate carboxylase. The homology results are shown in FIG. 1. Example 3: Cloning of a gene encoding human phosphoenolpyruvate carboxylase 81 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.

After purification of Qiagene's kit, PCR amplification was performed with the following primers:

 Pr imerl: 5-GGAATTTTCCGAAATCCCTTTTAT -3 '(SEQ ID NO: 3)

 Pr imer2: 5'- AAAGGAAGGAAAATATTTTATTAA -3 '(SEQ ID NO: 4)

Pr imerl is a forward sequence located at the 5th end of bp in SEQ ID NO: 1; Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification reaction conditions: 50 μl / L KC1, 10 mmol / L Tris-CI, (pH8.5), 1.5 mmol / L MgCl ₂ , 200 μ mol / L dNTP, lOpmol primers in a reaction volume of 50 μ 1 , 1U of Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. During RT-PCR, β-actin was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2863bp shown in SEQ ID NO: 1. Example 4: Northern blot analysis of human phosphoenolpyruvate carboxylase 81 gene expression:

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] „This method involves acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M acetic acid sodium _(P H4.0) of the tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform - isoamyl alcohol. (49: 1), mixed with the water absorbing layer centrifugation, isopropanol ( 0.8 volume) and the mixture was centrifuged to obtain an RNA pellet. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. With 20 g of RNA, 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7) .0) - electrophoresed on ImM EDTA-2.2M formaldehyde-1.2% agarose gel and transferred to nitrocellulose membranes Preparation of a- ³² P dATP using ³² P- labeled by random priming Method - 5 mM sodium acetate. DNA probe. The DNA probe used was the PCR amplified human phosphoenolpyruvate carboxylase 81 coding region sequence (76 bp to 2289 bp) shown in Figure 1. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) and transferred to a nitrocellulose membrane RNA is hybridized overnight at 42 ° C in a solution, the solution comprising 50% formamide _{-25mM KH 2 P0 4 (pH7.4)} -5 SSC-5 χ

 Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Phosphor Imager was then used for analysis and quantification. Example 5: In vitro expression, isolation and purification of recombinant human phosphoenolpyruvate carboxylase 81

 Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers were designed. The sequences are as follows:

 Primer3: 5'- CATGCTAGCATGAAGATTGGTATTGTCAGACGG -3 '(Seq ID No: 5)

Primer4: 5'- CCCGAATTCTCAAAATGAGCTCCAATACAAATG -3 '(Seq ID No: 6) The 5' ends of these two primers contain Nhel and EcoRI digestion sites, respectively, followed by the coding sequences of the 5 'and 3, ends of the target gene, respectively. The Nhel and EcoRI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid _P ET 28b (+) (Novagen, Cat. No. 69865.3). PCR was performed using the pBS-0665a02 plasmid containing the full-length target gene as a template. The PCR reaction conditions are: pBS- 0665a02 in a total volume of 50 μ 1 Plasmid 10pg, Primer-3 and Primer-3? 11161 "-4 points and 1 for 1 (^ [1101, Advantage polymerase Mix (Clontech)) 1 μ 1. Cycle parameters: 94.C 20s, 60.C 30s, 68 ° C 2 min, 25 cycles in total The digestion product and plasmid pET-28 (+) were double-digested with Nhel and EcoRI, respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed by the calcium chloride method of coliform bacteria DH5a. After kanamycin (final concentration 30 μg / ml) was cultured on LB plates overnight, colony PCR method was used to screen positive clones and sequenced. Select positive clones (pET-0665a02) with the correct sequence and use the calcium chloride method to transform the recombinant plasmid E. coli BL21 (DE3) plySs (Novagen) was transformed. In a LB liquid medium containing kanamycin (final concentration 30 μg / ml), the host strain BL21 (pET-0665a02) was cultured at 37 ° C. to In the logarithmic growth phase, add IPTG to a final concentration of 1 mmol / L, and continue the cultivation for 5 hours. Centrifuge the bacteria to collect the bacteria, ultrasonically break the bacteria, and centrifuge to collect the supernatant, which can be combined with 6 histidines (6H s-Tag). Affinity chromatography column His s. Bind Quick Cartr idge (Novagen) for chromatography A purified target protein, human phosphoenolpyruvate carboxylase 81, was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 81 KDa (Figure 2). The band was transferred to a PVDF membrane using the Edams hydrolysis method. Analysis of the N-terminal amino acid sequence revealed that the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Anti-human phosphoenolpyruvate carboxylase 81 antibody Generation

 The following peptides specific to human phosphoenolpyruvate carboxylase 81 were synthesized using a peptide synthesizer (product of PE):

NH2-Met-Lys-I le-Gly-I le-Val-Arg-Arg-I le-Leu-Leu-Thr-Leu-Val-Ser-C00H (SEQ ID NO: 7). The peptide was coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43 ₀ 4 mg of the above hemocyanin polypeptide complex plus complete Freund's adjuvant Rabbits were immunized, and 15 days later they were boosted with hemocyanin polypeptide complex and incomplete Freund's adjuvant. A titer plate coated with 15 μg / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human phosphoenolpyruvate carboxylase 81. Example 7: Use of a polynucleotide fragment of the present invention as a hybridization probe

Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Organization Whether the expression in the cell is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods, etc. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. In this embodiment, higher-intensity washing conditions (such as lower salt concentration and higher temperature) are used to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the invention; the second type of probes are partially related to the invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2.The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

 3, there should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The region is compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

5'- TGAAGATTGGTATTGTCAGACGGATTTTGCTAACTTTAGTA -3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt): 5'- TGAAGATTGGTATTGTCAGACGGATTTTGCTAACTTTAGTA -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental steps, please refer to the literature: DNA PROBES GH Keller; MM Manak; Stockton Press, 1989 (USA (USA) ), And more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" U998 Second Edition) [US] Sambruck et al., Science Press.

 Sample Preparation:

 1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in level J immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the pellet (about 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mmol / LnaCl; 25 crypto ol / L MgCl ₂ ). 4) at 4. C Homogenize the tissue suspension at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1-5 ml per 0.1 g of the original tissue sample) and centrifuge at 1000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method ''

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000 _g for 10 minutes. 2) Resuspend the pelleted cells (1 × 10 ⁸ cells / ml) with cold cell lysate and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. Purification of DM and ethanol precipitation were then performed.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or use drops Pipetting tube, while gradually increasing the TE, mixed until fully dissolved DNA, every 1- 5 χ 10 ⁶ cells extracted about plus lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase, re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1), and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 10 volumes of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well-20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A _26fl and A _{28 测定} to check the purity and yield of DNA. 15) Store at -20 ° C after dispensing.

Preparation of sample film:

 1) Take 4x2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number lightly with a pencil. Two NC membranes are required for each probe, so that they can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0. IOD / Ιθμ 1), add 2 μ I inase buffer, 8-10 uCi γ_ ³² P-dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Start collecting the first peak before ³² P-Probe washes out (can be monitored by Monitor :).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) After the collection of the first peak is combined, the ³² P-Probe (the second peak is free γ- ³² P-dATP) is prepared. Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3- 10 mg of prehybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml) was added.

CT DNA (calf thymus DNA). ), After sealing the bag, shake at 68 ° C for 2 hours.

Cross Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight.

 Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 3) Wash in 0.1 x SSC, 0.1% SDS at 40 ° C for 15 minutes (twice).

 4) 0.1xSSC, 0.1% SDS, 55. Wash for 30 minutes (twice) and dry at room temperature.

 Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 37 ° C for 15 minutes (twice).

 4) Wash in 0.1 x SSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

 X-ray autoradiography:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than that of hybridization spots. The radioactive intensity of the hybridization spot of the other probe. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues. Industrial applicability

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

 Phosphoenolpyruvate carboxylase catalyzes the P-carboxylation of phosphoenolpyruvate to form oxaloacetate and inorganic phosphoric acid. This response is irreversible. The reaction products are of great significance in the tricarboxylic acid cycle. Histidine and lysine in the phosphoenolpyruvate carboxylase sequence play an important role in the activity of the enzyme, and its mutations can cause a decrease in enzyme activity and a decrease in affinity with phosphoenolpyruvate. The characteristic conserved sequence of phosphoenolpyruvate carboxylase is necessary for its activity.

 The polypeptide of the present invention contains a characteristic conserved sequence of a phosphoenolpyruvate carboxylase and has a biological function similar to that of the phosphoenolpyruvate carboxylase, which is of great significance for the substance and energy metabolism of the tricarboxylic acid cycle.

It can be seen that abnormal expression of the human phosphoenolpyruvate carboxylase 81 of the present invention will produce various diseases. Diseases, especially those related to substance and energy metabolism, various tumors, and disorders of growth and development. These diseases include but are not limited to:

 Disorders related to energy and substance metabolism disorders: isovaleric acidemia, propionic acidemia, methylmalonic aciduria, combined carboxylase deficiency, glutaric acid type I, phenylketonuria, albinism, color Aminoemia, Glycineemia, Hypersarcosineemia, Metabolism of glutamate, Metabolism of urea cycle, Metabolism of histidine deficiency, Metabolism of lysine, Mucopolysaccharidosis Type I ~ Π , Mucolipid storage disease, Ray-niney syndrome, xanthineuria, orotic aciduria, adenine deaminase deficiency, hyperlipoproteinemia, familial hyperalpha-lipoproteinemia, congenital Lactose intolerance, hereditary fructose intolerance, galactosemia, defects in fructose metabolism, glycogen storage disease

 Tumors of various tissues: stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal and sinus tumors, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma

 Growth disorders: mental retardation, cerebral palsy, mental retardation, mental retardation, familial cerebellar dysplasia, strabismus, skin, fat, and muscular dysplasias such as congenital skin relaxation, albinism , Alzheimer's disease, congenital keratosis, bone and joint dysplasia diseases such as cartilage dysplasia, epiphyseal dysplasia, metabolic bone disease, various metabolic defects such as various amino acid metabolic defects, dementia, dwarfism Cushing syndrome, sexual retardation

 Abnormal expression of the human phosphoenolpyruvate carboxylase 81 of the present invention will also produce certain hereditary, hematological and immune system diseases.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially diseases related to substances and energy metabolism, various tumors, and disorders of growth and development, Certain hereditary, hematological and immune system diseases. The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human phosphoenol pyruvate carboxylase 81. Agonists enhance human phosphoenolpyruvate carboxylase 81 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human phosphoenolpyruvate carboxylase 81 can be cultured with labeled human phosphoenolpyruvate carboxylase 81 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

Antagonists of human phosphoenolpyruvate carboxylase 81 include antibodies, compounds, and receptor deficiency screened Lost property and the like. Antagonists of human phosphoenolpyruvate carboxylase 81 can bind to human phosphoenolpyruvate carboxylase 81 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide such that The polypeptide cannot perform biological functions.

 When screening compounds as antagonists, human phosphoenolpyruvate carboxylase 81 can be added to the bioanalytical assay. Influence to determine if a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human phosphoenolpyruvate carboxylase 81 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, generally, 81 molecules of human phosphoenolpyruvate carboxylase should be labeled.

 The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against human phosphoenolpyruvate carboxylase 81 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.

 Polyclonal antibodies can be produced by injecting human phosphoenolpyruvate carboxylase 81 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant, etc. Techniques for preparing monoclonal antibodies to human phosphoenolpyruvate carboxylase 81 include, but are not limited to, hybridoma technology (Koh ler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, Human B-cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al., PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human phosphoenolpyruvate carboxylase 81.

 Antibodies against human phosphoenolpyruvate carboxylase 81 can be used in immunohistochemical techniques to detect human phosphoenolpyruvate carboxylase 81 in biopsy specimens.

 Monoclonal antibodies that bind to human phosphoenolpyruvate carboxylase 81 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human phosphoenolpyruvate carboxylase 81 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human phosphoenolpyruvate carboxylase 81 positive cells. The antibodies in the present invention can be used to treat or prevent diseases related to human phosphoenolpyruvate carboxylase 81. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human phosphoenolpyruvate carboxylase 81.

 The invention also relates to a diagnostic test method for quantitative and localized detection of human phosphoenolpyruvate carboxylase 81 levels. These tests are well known in the art and include F I SH assays and radioimmunoassays. The level of human phosphoenolpyruvate carboxylase 81 detected in the test can be used to explain the importance of human phosphoenolpyruvate carboxylase 81 in various diseases and to diagnose human phosphoenolpyruvate carboxylase Disease in which enzyme 81 acts.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.

 The polynucleotide encoding human phosphoenolpyruvate carboxylase 81 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human phosphoenolpyruvate carboxylase 81. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human phosphoenolpyruvate carboxylase 81 to inhibit endogenous human phosphoenolpyruvate carboxylase 81 activity. For example, a variant human phosphoenolpyruvate carboxylase 81 may be a shortened human phosphoenolpyruvate carboxylase 81, which lacks a signaling domain, and although it can bind to a downstream substrate, it lacks Signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human phosphoenolpyruvate carboxylase 81. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human phosphoenolpyranoate carboxylase 81 into cells. A method for constructing a recombinant viral vector carrying a polynucleotide encoding human phosphoenolpyruvate carboxylase 81 can be found in the existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human phosphoenolpyruvate carboxylase 81 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human phosphoenolpyruvate carboxylase 81 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RM, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis methods has been widely used. Antisense RM molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DNA sequence has been integrated into the vector's RNA polymerase primer Downstream of the mover. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding human phosphoenolpyruvate carboxylase 81 can be used for the diagnosis of diseases related to human phosphoenolpyruvate carboxylase 81. A polynucleotide encoding human phosphoenolpyruvate carboxylase 81 can be used to detect the expression of human phosphoenolpyruvate carboxylase 81 or abnormal expression of human phosphoenolpyruvate carboxylase 81 in a disease state . For example, a DNA sequence encoding human phosphoenolpyruvate carboxylase 81 can be used to hybridize biopsy specimens to determine the expression of human phosphoenolpyruvate carboxylase 81. Hybridization techniques include Sou thern blotting, Northern blotting, and in situ hybridization. These technical methods are all mature technologies that are publicly available, and related kits are commercially available. A part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microcroix) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and Genetic diagnosis. Human phosphoenolpyruvate carboxylase 81 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect the transcription product of human phosphoenolpyruvate carboxylase 81.

 Detection of mutations in the human phosphoenolpyruvate carboxylase 81 gene can also be used to diagnose human phosphoenolpyruvate carboxylase 81-related diseases. Human phosphoenolpyruvate carboxylase 81 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human phosphoenolpyruvate carboxylase 81 DNA sequence. Mutations can be detected using existing techniques such as Sou thern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells containing human genes corresponding to the primers will produce amplified fragments.

Somatic cell hybridization by PCR is a quick and easy way to map D to a specific chromosome. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries. Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manu l of Basic Techniques, Pergamon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inherance in Man (available online with Johns Hopkins University Welch Medi Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them. In addition, the polypeptide of the present invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human phosphoenolpyruvate carboxylase 81 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human phosphoenolpyruvate carboxylase 81 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Claim

1. An isolated polypeptide-human phosphoenolpyruvate carboxylase 81, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof Thing.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence at positions 76-2289 in SEQ ID NO: 1 or a sequence at positions 1-2863 in SEQ ID NO: 1. .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having human phosphoenolpyruvate carboxylase 81 activity, characterized in that the method comprises:

 (a) culturing the engineered host cell of claim 8 under conditions that express human phosphoenolpyruvate carboxylase 81;

 (b) A polypeptide having human phosphoenolpyruvate carboxylase 81 activity is isolated from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human phosphoenolpyruvate carboxylase 81.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human phosphoenolpyruvate carboxylase 81.

12. The compound according to claim 11, characterized in that it is a polynucleotide sequence shown in SEQ ID NO: 1 Antisense sequence of a column or fragment thereof.

 13. Use of a compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human phosphoenolpyruvate carboxylase 81 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human phosphoenolpyruvate carboxylase 81; Or used for peptide fingerprint identification.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormality of human phosphoenolpyruvate carboxylase 81.

 18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Diseases, HIV infection and immune diseases and drugs of various inflammations.