JPH09107975A - Pepc-ase gene of monocotyledon cam plant - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new gene reinforcing photosynthetic ability under a high-temperature dry condition, raising drought resistance, having a specific base sequence, coding for a phosphoenolpyruvic acid carboxylase (PEPCase) of aloe. SOLUTION: This new cDNA codes for a phosphoenolpyruvic acid carboxylase (PEPCase) of aloe having a base sequence of the formula. A cDNA of PEPCase is transduced into a cell of a monocotyledon plant such as rice plant so that photosynthetic ability of the plant cell under a high-temperature dry condition can be strengthened and drought resistance of the plant can be raised. The PEPCase gene is obtained by extracting the whole RNA from a green leaf of aloe phosphoenolpyruvic acid Aloe arborescens, separating a mRNA from the whole RNA, preparing a cDNA library using the mRNA, screening the library by hybridization using a probe composed of a part of the PEPCase gene of aloe and recovering the DNA from a positive clone.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to phosphoenolpyruvate carboxylase of aloe, which is a monocotyledonous CAM (Crassulaceae type organic acid metabolism) plant (hereinafter referred to as PEPCas).
(abbreviated as e) gene.

[0002]

2. Description of the Related Art Plants use C _{3 to} fix C ₃
It is classified into plants, C ₄ plants and CAM plants. C ₃ plants are plants that perform photosynthesis by directly incorporating carbon dioxide in the atmosphere into the reductive pentose phosphate cycle. Most of the C ₃ plants, including dicotyledonous plants and photosynthetic bacteria, including major agricultural crops such as rice and wheat. Plants are included in this. C
₃ Normally, plants open their stomata during the day when sunlight is received, and absorb carbon dioxide to perform photosynthesis, but under strong light and dry conditions such as in desert areas, stomata are used to suppress severe transpiration during the day. May be closed (edited by Shigeto Miyaji, Contemporary Plant Physiology I, Photosynthesis, p89-p97, Asakura Shoten, (1992)). However, if the pores are closed, the absorption of carbon dioxide will not be carried out sufficiently, resulting in a decrease in photosynthetic ability. C ₄
A plant is a plant with a C ₄ dicarboxylic acid cycle, which is tropical,
There are also subtropical gramineous plants (corn, sugar cane, etc.) and some dicotyledonous plants. CAM plants perform nighttime carbonic acid fixation to accumulate organic acids (mainly malic acid),
Metabolites that synthesize sugars by decomposing these organic acids during the daytime (crassulacean acid metabolism: crassulacean acid metabolism) are plants that live in arid climate areas such as cacti, aloe, and crassulaceae. In CAM plants,
Mainly at night, carbon dioxide is fixed by absorbing carbon dioxide from stomata and synthesizing malic acid, which accumulates in vacuoles. During the day when transpiration becomes active, the pores are closed and carbon dioxide is not absorbed from the atmosphere, but carbon dioxide obtained by decarboxylating malic acid that was synthesized at night and accumulated in vacuoles is used in the Calvin cycle. It is used for the carbonic acid fixation reaction of to synthesize sugar. Although photosynthesis by such metabolism is called CAM-type photosynthesis, PEPCase is an enzyme that catalyzes a reaction of fixing carbonic acid to produce malic acid in the CAM-type photosynthesis. Therefore, PEPCase is CAM
Type is the most important key enzyme in photosynthesis.

PEPCase functions in C ₃ plants such as a complementary reaction of oxaloacetate in the Calvin cycle, and in C ₄ plants, in addition to this, catalyzes the initial reaction of carbon dioxide fixation in C ₄ type photosynthesis. However, the existence of PEPCase is known. Research examples are known of these, the C ₃ plants Tobacco (N. Koi
Izumi et al., Plant Mol. Biol., vol.17, pp.535-539, (199
1)), potato (S. Merkelbach et al., Plant Mol. Bio
l., vol.23, pp.881-888, (1993)), soybean (T. Sugimot)
o, et al., Plant Mol. Biol., vol. 20, pp. 743-747, (1992)),
Oilseed rape (Y. Yanai et al., Biosci. Biotech. Biochem.,
vol.58, pp.950-953, (1994)), corn (K. Izui et al., Nucl. Acids Res., vol.14, pp.1615-) in C ₄ plants.
1628, (1986)), Sorghum (L. Lepiniec et al., Plant Mo.
l. Biol., vol.19, pp.339-342, (1992)), flaveria (J. Hermans and P. Westhoff, Mol. Gen. Genet., vol.23.
4, pp.234-284, (1992)) and the like have been reported for gene isolation and structural analysis. It has been pointed out that the PEPCase proteins of these plants are similar in structure to each other. CAM type P
Many biochemical studies on EPCase are known (HG Nimmo et al., Enviroment and Plant Matab
olism; N. Smirnoff, pp.35-44, BIOS Scientific Publis
hers, Ltd., 1995), the gene of this enzyme has not been studied so much. However, among them, research examples of the PEPCase gene of the dicotyledonous ice plant are known (JC Cushiman and HJ Bohnert, Nucl.
Acids Res. 17, 6745-6746 (1989)). Some monocotyledons that perform CAM photosynthesis are known (M. Kluge, IP Ting, translated by Akihiro Nose, Physiology and Ecology of Desert Plants, Chapter 1, Kyushu University Press). There are few studies on PEPCase in these plants. As is clear from the above description, the PEP of a monocotyledonous plant that performs CAM-type photosynthesis throughout its life cycle
No studies have been conducted on Case and its gene, and no report has been made on the cloning of PEPCase gene of monocotyledonous CAM plants.

There are optimum environmental conditions for the growth of plants, and their growth is hindered when they are subjected to stress such as extreme high and low temperatures, drought and high salt. Up to now, efforts have been made to cultivate plants even in dry areas such as desert areas, such as hydration by irrigation and improvement of water retention capacity by soil improvement. At the same time, breeding mainly on crosses has been carried out to breed varieties with strong drought resistance. However, these methods require enormous amount of time, money and labor.
In addition, there are serious problems such as the accumulation of salt in the soil as a by-product of excessive irrigation, resulting in barren soil. Therefore, in order to enable plant cultivation in a dry area, a new solution from a viewpoint different from these conventional methods has been desired. It is important to increase the production of food and to protect the environment when a main grain is selected as the plant, in order to produce a plant having resistance to stress such as high temperature and drought. From the viewpoint of imparting drought resistance to main grains such as rice, since these main grains are classified as monocotyledonous plants, genes involved in CAM-type photosynthesis of monocotyledonous CAM plants are isolated, It is considered most effective to introduce the obtained gene into major grains such as rice. This is because the difference in the system of gene expression between monocotyledonous plants and dicotyledonous plants is known, and it is known that genes derived from dicotyledonous plants often do not function effectively in monocotyledonous plants. Is. However, the above-described breeding of monocotyledonous plants has never been performed so far.

[0005]

The problem to be solved by the present invention is to isolate a gene encoding PEPCase of a CAM type monocotyledonous plant, which is ligated to an expression vector suitable for the gene and used as a recombinant plasmid. Was prepared, and the obtained recombinant plasmid was introduced into a plant to produce PEPCas.
The purpose is to increase the activity of e, and consequently enhance the photosynthetic ability under dry conditions and enhance the drought resistance.

The object of the present invention is to provide PEPCase for aloe.
And to provide a cDNA encoding aloe PEPCase, and to provide a PEPCase expression plasmid containing a DNA base sequence encoding aloe PEPCase.

Another object of the invention is PEPC of aloe.
PEPCas containing a DNA base sequence encoding ase
PEPCas by introducing the e expression plasmid into monocots
It is intended to enhance the activity of e, enhance the photosynthetic ability under drought conditions and enhance drought resistance, and to provide a transformed plant in which the activity of PEPCase is enhanced.

[0008]

As a result of intensive studies, the present inventors have succeeded in isolating PEPCase cDNA from aloe and producing a PEPCase expression plasmid containing a DNA base sequence encoding PEPCase. Furthermore, the present inventors further obtained PEPC of transformed plants obtained by introducing the recombinant plasmid into monocotyledonous plants.
The inventors have found that the ase activity is increased and completed the present invention.

That is, the present invention relates to the aloe PEPCase cDNA having the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing.
A, a DNA base sequence encoding the amino acid sequence shown in SEQ ID NO: 1 of the Sequence Listing and a plasmid containing the DNA base sequence, microorganisms and cells transformed with the plasmid, PEPCase obtained by introducing the plasmid into a monocot plant. Method for increasing activity and PEPCas obtained by the method
The present invention provides a transformed plant having an increased e.

[0010]

BEST MODE FOR CARRYING OUT THE INVENTION cPEN of PEPCase of the present invention
A is derived from the genus Aloe ( Aloe ) and has a DNA base sequence encoding at least the entire region of the PEPCase protein of aloe. Those derived from Aloe arborescens Mill have the DNA base sequence shown in SEQ ID NO: 1 in the sequence listing.

The method for obtaining the PEPCase cDNA of the present invention is roughly as follows. That is, first, PEPCase of ice plant, corn or sorghum.
PCR using primers synthesized based on the amino acid sequence or DNA base sequence conserved between
PE from aloe RNA by the chain reaction method
A PCase cDNA fragment is isolated. The PCR method involves denaturing the template, annealing the primer to the template DNA, and extending the DNA from the primer for several tens of cycles by controlling the temperature, whereby the DNA between the primers is
This is a method for specifically amplifying a large amount of fragments. Next, PC
The nucleotide sequence of the DNA fragment obtained as a result of R was determined, and the amino acid sequence encoded by the nucleotide sequence was determined by known PEPC.
The homology is examined by comparing with the amino acid sequence of ase, and it is confirmed that the obtained DNA fragment is derived from the PEPCase gene of Aloe. Then, by performing plaque hybridization using a DNA fragment confirmed to be derived from the Aloe PEPCase gene as a probe, an Aloe PE was obtained from a cDNA library obtained by reverse transcription from aloe total RNA.
PCase cDNA is isolated. Generally, the function or activity of a protein may not be substantially changed even if some bases in the base sequence that make up the protein gene are replaced with other bases, deleted, or inserted. Is widely known. This is especially true in regions other than the active center of the protein. Therefore, among the nucleotide sequences represented by SEQ ID NO: 1, those having a small number of nucleotide substitutions, deletions, or insertions that have the activity of Aloe PEPCase are included in the scope of the present invention.

The isolated cDNA can be preserved in the form of a recombinant plasmid by ligating it with an appropriate vector and transforming it into, for example, Escherichia coli. PEPC
Examples of the recombinant plasmid containing the ase cDNA include pAP39, and examples of Escherichia coli transformed with the recombinant plasmid include MTP-001 containing pAP39. Escherichia coli MTP-001 was deposited under the deposit number FERM P-15153 at the Institute of Biotechnology, Institute of Biotechnology, Ministry of International Trade and Industry, 1-3-1, Higashi, Tsukuba, Ibaraki Prefecture, on September 5, 1995. ing. C of the obtained PEPCase
In order to confirm that the DNA is a complete and functional sequence, the nucleotide sequence of the cDNA may be determined and the expression pattern of the cDNA in plant cells may be examined.

Further, by using the cDNA, an expression plasmid utilizing a primer that is effectively expressed in plants can be constructed and introduced into rice to obtain a transformed plant. That is, the PEPCa of aloe obtained by the present invention
SE cDNA is ligated with an appropriate promoter such as a cauliflower mosaic virus-derived promoter or a promoter related to photosynthesis into a plant cell vector to construct a PEPCase expression plasmid. This PEPCase expression plasmid is used for monocots such as rice,
Transformed plants are produced by introducing into plants such as tobacco by electroporation, a method using agrobacterium or particle gun, and the like.
The transformed plant obtained as described above has P intracellular
PEPCase activity is increased because EPCase is overexpressed. In particular, since the artificial gene constructed in the present invention contains PEPCase of aloe, which is a CAM plant, when it is introduced into major grain plants such as rice, which is a monocotyledonous C ₃ plant, CAM-type PEPCase activity is expressed in the plant. As a result, the ability to fix carbon dioxide under dry conditions is enhanced, so that drying resistance is imparted and grain productivity is improved.

[0014]

According to the present invention, PEPCase of aloe is prepared.
Is provided, and a DNA base sequence encoding the amino acid sequence of PEPCase of Aloe, and a plasmid containing the DNA base sequence are provided.

According to the present invention, the cDNA of aloe PEPCase was cloned and its nucleotide sequence was determined. As a result, PEPCase involved in CAM photosynthesis
The structure of was first revealed. Using this cDNA, P, which is involved in CAM photosynthesis in plants, especially monocots
EPCase activity can be imparted. The transformed plant thus obtained has an increased ability to fix carbon dioxide under dry conditions, and thus is imparted with drought resistance. Further, when the transformed plant is a grain plant, grain productivity can be improved.

[0016]

[Example 1]

(1) Construction of aloe green leaf-derived cDNA library First, aloe total RNA was extracted. The experimental procedure is AGPC (Acid Guanidium thiocyanate Phenol Chloro) described in Experimental Medicine, Vol 9, No 15, pp.99-102, (1991).
According to the form method, Aloe arborescens ( Aloe arb
orescens Mill ) and total RNA was extracted from 5 g of green leaves.
Next, Oligotex dT-30 (manufactured by Daiichi Pure Chemicals) was used to synthesize cDNA from the obtained total RNA.
Poly (A) + RNA containing mRNA was purified from total RNA. The preparation method was in accordance with the instruction manual for Oligotex dT-30. About 5 μg of mRNA was obtained, and about 2 μg of it was used to produce ZA from Stratagene.
CDNA was synthesized using the P-cDNA Synthesis Kit. The obtained cDNA is lambda vector (UNI-ZAP
GIGAPACK-II Gold after inserting it between EcoRI recognition site and XhoI recognition site of XR Vector Arms (Stratagene)
(Stratagene) was used to package lambda phage, which was infected with E. coli XL1-Blue MRF 'to obtain a large number of recombinant phages. This was used as an aloe green leaf cDNA library. The size of this cDNA library was measured by diluting the recombinant phage to infect E. coli and forming plaques on an agar medium according to the method described in the ZAP-cDNA Synthesis Kit instruction manual. . As a result, it was found that the constructed aloe green leaf-derived cDNA library contained 1 × 10 ⁶ independent clones. This size was considered to be sufficient for a library for gene isolation.

(2) Preparation of probe An attempt was made to amplify the DNA fragment of PEPCasec of Aloe. First, a region having the highest homology is selected by comparing the nucleotide sequences and amino acid sequences of PEPCase genes of corn, sorghum and ice plant obtained as a result of information retrieval, and the corresponding primer A (SEQ ID NO: 2) and primer B (SEQ ID NO: 3) was synthesized. Using these primers, a reverse transcription reaction was performed using the total RNA extracted from Aloe green leaves as a template in the same manner as in (1) above to synthesize the corresponding single-stranded DNA. Further, PCR was performed using a thermostable DNA polymerase. As a result, a specific DNA fragment considered to correspond to the PEPCase gene was amplified, and this was isolated, the ends were treated with DNA polymerase for blunting, inserted into the SmaI site of plasmid pUC19, and cloned into E. coli. The DNA base sequence of the cloned DNA fragment was determined by the dye primer method and the dye terminator method according to the Sanger (dideoxy) method using an automatic DNA sequencer. The determined DNA base sequence is shown in SEQ ID NO: 4 in the sequence listing. The amino acid sequence encoded by this DNA base sequence is the PEPCa of the ice plant that has already been reported.
Since it showed about 77% homology with se, it was considered that the DNA fragment was derived from PEPCase. Therefore, using this DNA fragment as a probe, PEPCase of Aloe
It was decided to isolate the cDNA of.

(3) Isolation of aloe PEPCase cDNA The following experiment was carried out to isolate the aloe PEPCase cDNA from the aloe cDNA library constructed in (1) above. First, a plaque derived from a phage contained in the aloe green leaf cDNA library obtained in (1) above was formed on an agar medium and transferred to a nylon membrane (Hibond N manufactured by Amersham). The phage DNA contained in the plaques of the phage transferred to the nylon membrane was treated with an alkaline denaturing solution (1.5M NaCl, 2.0M).
M NaOH) and neutralizing solution (1.0M Tris-HCl pH5.0, 2.0M Na
Cl) was treated for 10 minutes each, and then UV irradiation was performed to fix it on the nylon membrane. Next, the DNA fragment obtained in (2) above was labeled with a nonradioactive DIG to serve as a probe, and plaque hybridization was performed with the above-described nylon membrane having the phage DNA immobilized thereon. In addition, the labeling of the probe is DIG-ELISA DNA Labeling & Detect.
Ion Kit (Boehringer Mannheim)
Hybridization experiments were performed according to the method described in the instruction manual. As a result of plaque hybridization, 104 plaques showed a strong signal to the probe, strongly suggesting that the recombinant phage contained in these plaques may contain PEPCase cDNA. Then, these phages were collected, a DNA fragment containing cDNA was extracted from lambda phage, and transferred to a plasmid vector pBluescript. The 104 plasmid DNAs obtained by this operation were designated as pAP1 to pAP104, respectively.

(4) Southern hybridization 104 plasmid clones from pAP1 to pA104 were simultaneously digested with restriction enzymes EcoRI and XhoI, and then separated by agarose gel electrophoresis. Next, a vacuum blotting device (Pharmacia LKB / Vacugene B
After the DNA fragment was transferred to a nylon membrane by the (lotting system), denaturation and neutralization treatments were performed by the method described in (3) above, and Southern hybridization was performed using the probe used in (3) above. As a result, all clones showed a positive signal.

(5) Creation of restriction enzyme map and comparison of structure of 3'region A restriction enzyme map was prepared for the clone obtained in (4) above. The restriction enzyme maps of these clones were so similar to each other that they were considered to be similar cDNAs.
Therefore, among these clones, 17 clones having a relatively large insert fragment of 1 kb or more were subjected to the above (2)
The nucleotide sequences of those 3'regions were examined according to the method described in 1. As a result, it was found that the nucleotide sequences of 12 clones were the same. The remaining 5 clones had different nucleotide sequences. The Escherichia coli MTP-001 having the recombinant plasmid pAP39 having the longest insertion fragment among the 12 clones having the same nucleotide sequence was designated by the accession number F.
ERM P-15153 was deposited at the Institute of Biotechnology, Institute of Biotechnology, Ministry of International Trade and Industry. FIG. 1 shows a restriction enzyme map of the recombinant plasmid pAP39.

(6) Analysis of expression of PEPCase cDNA PEPCase corresponding to recombinant plasmid pAP39
The expression pattern of the cDNA was examined. Plant PEPC in general
Since the ase gene forms a multigene family (Y.Ya
nai et al., Biosci.Biotech.Biochem., Vol.58, pp.950-953,
(1994)), a gene specific for the recombinant plasmid pAP39 was prepared by utilizing the 3'untranslated region to distinguish each gene. Using this probe, Northern analysis was carried out on total RNA prepared from green leaves, stems and roots of Aloe. RNA was prepared in the same manner as in (1) above. As the aloe, a plant body was used in which it was kept in a dry state and CMA-type photosynthesis was actively performed for about 2 weeks before the start of the experiment. Northern analysis
A sample separated by formaldehyde-containing agarose gel electrophoresis using 3.5 μg of RNA was transferred to a nylon membrane and then transferred in accordance with a conventional method (Shintaro Nomura, Joji Inazawa, Deisotope Experimental Protocol 1 DIG Hybridization, Shujunsha (1994). )Carried out. A band having an affinity for the probe was detected by a DIG Nucleic Acid Detection kit (manufactured by Boehringer Mannheim) using CDP-STAR (manufactured by TROPIX) as a luminescent substrate. As a result of Northern analysis, rRNA was detected in all tissues.
PCase mRNA was detected only in RNA samples obtained from green leaves, which is the tissue in which the expression of this gene is observed.
A band was detected at a position corresponding to PCase mRNA. That is, it was confirmed that the PEPCase gene corresponding to pAP39 was specifically expressed in leaves (Fig. 2). No expression was confirmed in the stems and roots, and it was revealed that this gene expression was specific only in the green leaves undergoing CAM-type photosynthesis. From the above, pA
It was strongly suggested that PEPCase encoded by P39 is an enzyme involved in CAM-type photosynthesis.

(7) Analysis of base sequence of cDNA The base sequence was determined by the method described in (2) above. The nucleotide sequence of the pAP39 cDNA thus determined is shown in SEQ ID NO: 1. The nucleotide sequence of SEQ ID NO: 1 is 96
It encoded a protein consisting of 4 amino acid residues.
The amino acid sequences of the proteins defined by these base sequences are used for the PE of ice plant, sorghum, and corn.
When compared with the amino acid sequence of PCase, 74.5% ~
There was 85.0% homology. Therefore, the cDNA contained in pAP39 is a P that is involved in CAM-type photosynthesis of aloe.
It was thought to encode EPCase. Therefore, this protein was named APPC1.

[Example 2] (1) Construction of PEPCase expression plasmid pPPC1 A plasmid expressing the protein APPC1 with the 35S promoter derived from cauliflower mosaic virus and the chlorophyll a / b binding protein (Cab) promoter (cab promoter) was prepared. Tried to build. 35
The plasmid pAP39 is used for the expression of Aloe PEPCase using the S promoter and NOS (nopaline synthase) terminator (Nos terminator).
Was digested with KpnI and partially digested with BamHI to obtain a full-length PEPCasec DNA fragment. Next, pBI2
21 (purchased from Toyobo) was digested with BamHI and SacI, synthetic linker 1 (SEQ ID NO: 5) was ligated to the SacI protruding end to introduce a KpnI recognition site, and finally, it was digested with KpnI.
The P containing the 35S promoter thus obtained
EPCase expression plasmid and recombinant plasmid pA
The fragment containing the cDNA from P39 was ligated. The PEPCase expression plasmid obtained here was named pPPC1. The structure of the insert of the constructed expression plasmid is shown in FIG.
Shown in

(2) PEPCase expression plasmid pP
Construction of PC101 In order to express Aloe PEPCase using the Cab promoter and the NOS terminator, BamH corresponding to full-length cDNA from pAP39 was similarly prepared.
An I-KpnI fragment was prepared and used as an expression vector pL.
HC4.4 (Y. Tada et al., EMBO J. vol.10, pp1803-
1808, 1991) at the BamHI and KpnI sites. As a result, the resulting PEPCase expression plasmid was transformed into pPP
It was named C101. The structure of the constructed insert fragment of the expression plasmid is shown in FIG.

(3) Transformation of rice The expression plasmid constructed above was used for the method of Tada et al.
et al., Theor. Appl. Genet. Vol. 80, pp. 475-480, (19
90)), and introduced into rice (Kinuhikari) protoplasts by electroporation. The obtained cells were prepared according to the method of Fujimura et al. (Fujimura et al. Plant Tiss
ue Culture Lett., vol.2, p.74, (1985)). When DNA was extracted from these cells and Southern hybridization was performed using the introduced gene as a probe, expression plasmid pPPC1 was obtained.
DNAs that were considered to be derived from pPPC101 and pPPC101 were detected from 8 strains and 12 strains, respectively.

[0026]

[Sequence list]

SEQ ID NO: 1 Sequence length: 3443 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA to mRNA Origin: Organism name: Aloe arborescens
Mill) Tissue type: Green leaf Sequence features 1-255 E 5'UTR 256-3147 S CDS 3149-3443 E 3'UTR sequence CACGAGTTCC TTCTTCGCTC GCTCGCTCGC TCGCTCTCCCTCCCTGCTCT CTCTTTCTCT 60 TGTCTTCATC ACGGACATAT CCTCTTTCGACTCTCCTTTCGACTCT CCTTTCGACTCT CCTTTCGACTCT CCTTTCGACTCT TACCTGCTTGCCTT TTGATGCTTT 180 AATATCTCTT TTGGATTTTC AATTTAGCCA GAACAAGTTC TCTTATTCTG AGAGAAGCGA 240 GGAGTTTTGA AGGAG ATG GCG ACT CGA GTG GAG AAG TTG GCG TCG ATC GAC 291 Met Ala Thr Arg Val Glu Lys Leu Ala Ser Ile Asp 1 5 10 GCG GCG CAG CTG CTG GAG GAT GAC AAA 339 Ala Gln Leu Arg Ala Leu Ala Pro Lys Lys Val Ser Glu Asp Asp Lys 15 20 25 TTG GTC GAG TAC GAC GCG CTC CTC TTG GAT CGG TTC CTC GAA ATC CTT 387 Leu Val Glu Tyr Asp Ala Leu Leu Leu Asp Arg Phe Leu Glu Ile Leu 30 35 40 GAA GAT TTG CAC GGC GAG GAC ATT CGA GAG ACG GTT CAA GCT TGC TAT 435 Glu Asp Leu His Gly Glu Asp Ile Arg Glu Thr Val Gln Ala Cys Tyr 45 50 55 60 GAG TTA TCT GCT GAG TAC GAG GCG AAG CAC GAC CCC AAG AAG CTA GAT 483 Gl u Leu Ser Ala Glu Tyr Glu Ala Lys His Asp Pro Lys Lys Leu Asp 65 70 75 GAA CTG GGG AAT GTG CTG ACG AGT TTG GAT CCG GGG GAT TCT ATC GTT 531 Glu Leu Gly Asn Val Leu Thr Ser Leu Asp Pro Gly Asp Ser Ile Val 80 85 90 GTT GCG AGC TCA TTC TCG CAC ATG CTC AAC CTC GCC AAC TTG GCT GAG 579 Val Ala Ser Ser Phe Ser His Met Leu Asn Leu Ala Asn Leu Ala Glu 95 100 105 GAG GTT CAA ACT GCT TAC AGG AGG AAG ATC AAG CTG AAT AAG AAG GGA 627 Glu Val Gln Thr Ala Tyr Arg Arg Lys Ile Lys Leu Asn Lys Lys Gly 110 115 120 GAT TTC CTC GAT GAG GCT TGT GCG ACG ACT GAG TCG GAC ATT GAG GAG 675 Asp Phe Leu Asp Glu Ala Cys Ala Thr Thr Glu Ser Asp Ile Glu Glu 125 130 135 140 ACT TTG AAA AAG CTT TTG TTG ATG AAG AAG TCG AAG GAG GAG ATT TTC 723 Thr Leu Lys Lys Leu Leu Leu Met Lys Lys Ser Lys Glu Glu Ile Phe 145 150 155 GAT GCT CTG AAG AAC CAA ACT GTG GAT CTT GTT TTT ACT GCA CAT CCA 771 Asp Ala Leu Lys Asn Gln Thr Val Asp Leu Val Phe Thr Ala His Pro 160 165 170 ACT CAG TCG GTC AGG AGG TCA CTG CTT CAG AAG CAT GGA AGG ATA AGG 8 19 Thr Gln Ser Val Arg Arg Ser Leu Leu Gln Lys His Gly Arg Ile Arg 175 180 185 AAT TGT TTA GCT CAG TTG TAT GCC CAC GAT ATA ACA CCT GAT GAT AAG 867 Asn Cys Leu Ala Gln Leu Tyr Ala His Asp Ile Thr Pro Asp Asp Lys 190 195 200 CAA GAA CTT GAT GAA GCT CTC CAG AGA GAG ATT CAA GCA GCC TTT AGA 915 Gln Glu Leu Asp Glu Ala Leu Gln Arg Glu Ile Gln Ala Ala Phe Arg 205 210 215 220 ACC GAT GAA ATT CGT AGA ACT CCT CCA GCT CCA CAA GAT GAA ATG AGG 963 Thr Asp Glu Ile Arg Arg Thr Pro Pro Ala Pro Gln Asp Glu Met Arg 225 230 235 GCT GGT ATG AGT TAT TTC CAT GAA ACT ATA TGG AAG GGT GTT CCC AAG 1011 Ala Gly Met Ser Tyr Phe His Glu Thr Ile Trp Lys Gly Val Pro Lys 240 245 250 TTT TTG CGT CGT GTT GAT ACA GCT CTG AAA AAC ATT GGG ATT AAT GAG 1059 Phe Leu Arg Arg Val Asp Thr Ala Leu Lys Asn Ile Gly Ile Asn Glu 255 260 265 CGT TTT CCA TAC AAT GCT CCT CTT ATT CAG TTC TCT TCG TGG ATG GGG 1107 Arg Phe Pro Tyr Asn Ala Pro Leu Ile Gln Phe Ser Ser Trp Met Gly 270 275 280 GGT GAC CGT GAT GGA AAT CCT AGA GTC ACG CCA GAG GT T ACA AGG GAT 1155 Gly Asp Arg Asp Gly Asn Pro Arg Val Thr Pro Glu Val Thr Arg Asp 285 290 295 300 GTA TGC TTG TTA GCC AGA ATG ATG GCT GCT AAT TTG TAC TTT TCA CAA 1203 Val Cys Leu Leu Ala Arg Met Met Ala Ala Asn Leu Tyr Phe Ser Gln 305 310 315 ATT GAT GAT CTC ATG TTT GAG CTC TCT ATG TGG CGC TGC AGT GAT GAG 1251 Ile Asp Asp Leu Met Phe Glu Leu Ser Met Trp Arg Cys Ser Asp Glu 320 325 330 CTT CGT GTC CGA GCA GAT ATA TTA CAT CGC TCT TTA AAG AAG GAT GCA 1299 Leu Arg Val Arg Ala Asp Ile Leu His Arg Ser Leu Lys Lys Asp Ala 335 340 345 AAA CAT TAT ATT GAA TTC TGG AAA CAA ATT CCT CCA AGT GAA CCA TAT 1347 Lys His Tyr Ile Glu Phe Trp Lys Gln Ile Pro Pro Ser Glu Pro Tyr 350 355 360 CGT GTT ATA CTT TCT GAT GTG AGA GAT AAG CTA TAT TAT ACA CGT GAA 1395 Arg Val Ile Leu Ser Asp Val Arg Asp Lys Leu Tyr Tyr Thr Arg Glu 365 370 375 380 AGA GCC AGA CAT TTG TTG TCA AAT GGG TAT TCT GAC ATT CCT GAG GAA 1443 Arg Ala Arg His Leu Leu Ser Asn Gly Tyr Ser Asp Ile Pro Glu Glu 385 390 395 GCA GCT TTC ACA AAT ATT GAG CAG TTC CTA GAA CCC CTT GAA CTT TGC 1491 Ala Ala Phe Thr Asn Ile Glu Gln Phe Leu Glu Pro Leu Glu Leu Cys 400 405 410 TAT CGC TCG CTT TGT GAT TGC GGC GAT AGA CCA ATA GCA GAT GGT AGC 1539 Tyr Arg Ser Leu Cys Asp Cys Gly Asp Arg Pro Ile Ala Asp Gly Ser 415 420 425 CTT CTT GAC TTT CTG CGC CAA GTC TCA ACC TTT GGC CTC TCT CTT GTA 1587 Leu Leu Asp Phe Leu Arg Gln Val Ser Thr Phe Gly Leu Ser Leu Val 430 435 440 AGA CTC GAC ATC AGG CAA GAA TCC GAG AGG CAC ACC GAC GTC ATG GAT 1635 Arg Leu Asp Ile Arg Gln Glu Ser Glu Arg His Thr Asp Val Met Asp 445 450 455 460 GCC ATC ACC AGG CAT CTA GAG CTT GGG TCC TAC CGT GAG TGG TCT GAG 1683 Ala Ile Thr Arg His Leu Glu Leu Gly Ser Tyr Arg Glu Trp Ser Glu 465 470 475 GAG CGC CGC CAA GAA TGG CTG CTG TCC GAA CTC AGT GGA AAA CGC CCT 1731 Glu Arg Arg Gln Glu Trp Leu Leu Leu Ser Glu Leu Ser Gly Lys Arg Pro 480 485 490 CTT TTC GGT CCT GAC CTC CCT AAA ACC GAA GAA ATT GCC GAC GTC TTA 1779 Leu Phe Gly Pro Asp Leu Pro Lys Thr Glu Glu Ile Ala Asp Val Leu 495 500 505 GGT GCG TTC CAC GTC ATC TCC GAG CTC CCC TAC GAT TGT TTC GGA GCA 1827 Gly Ala Phe His Val Ile Ser Glu Leu Pro Tyr Asp Cys Phe Gly Ala 510 515 520 TAC ATA ATC TCG ATG GCG ACC TCC TCG TCT GAC GTC CTC GCC GTC GAG 1875 Tyr Ile Ile Ser Met Ala Thr Ser Ser Ser Asp Val Leu Ala Val Glu 525 530 535 540 CTC TTG CAG CGA GCG TGT GGG GTG AAG AAA CCT TTA AGA GTC GCA CCT 1923 Leu Leu Gln Arg Ala Cys Gly Val Lys Lys Pro Leu Arg Val Ala Pro 545 550 555 CTT TTT GAA AAG CTC GCA GAT CTT GAG GCT GCT CCT GCT GCA ATG GAG 1971 Leu Phe Glu Lys Leu Ala Asp Leu Glu Ala Ala Pro Ala Ala Met Glu 560 565 570 AGG CTC TTC TCG ATC GAC TGG TAC AGG GAC CGG ATC AAC GGA AAA CAA 2019 Arg Leu Phe Ser Ile Asp Trp Tyr Arg Asp Arg Ile Asn Gly Lys Gln 575 580 585 GAA GTC ATG ATC GGA TAC TCA GAT TCC GGC AAG GAC GCG GGC CGT CTC 2067 Glu Val Met Ile Gly Tyr Ser Asp Ser Gly Lys Asp Ala Gly Arg Leu 590 595 600 TCA GCG GCT TGG CAG TTG TAT AAA GCT CAG GAG GAT ATG GTG AAG GTC 2115 Ser Ala Ala Trp Gln Leu Tyr Lys Ala Gln Glu Asp Met Val Lys Val 6 05 610 615 620 GCG AAG GAG TAT GGG GTG AAG CTG ACT ATG TTT CAT GGA CGA GGG GGG 2163 Ala Lys Glu Tyr Gly Val Lys Leu Thr Met Phe His Gly Arg Gly Gly 625 630 635 ACT GTT GGG AGA GGA GGC GGA CCT ACT CAC CTG GCT CTT CTG TCT CAG 2211 Thr Val Gly Arg Gly Gly Gly Pro Thr His Leu Ala Leu Leu Ser Gln 640 645 650 CCG CCT GAC ACA ATT AAT GGA TCA ATT CGC GTT ACA GTT CAG GGA GAG 2259 Pro Pro Asp Thr Ile Asn Gly Ser Ile Arg Val Thr Val Gln Gly Glu 655 660 665 GTT ATT GAG CAG TCC TTC GGT GAG GAG CGC TTG TGC TTC AGA ACT CTG 2307 Val Ile Glu Gln Ser Phe Gly Glu Glu Arg Leu Cys Phe Arg Thr Leu 670 675 680 CAG CGG TAC ACA GCG GCT ACT CTC GAG CAT GGG ATG AAC CCC CCG ATT 2355 Gln Arg Tyr Thr Ala Ala Thr Leu Glu His Gly Met Asn Pro Pro Ile 685 690 695 700 TCT CCG AAG CCT GAG TGG CGC GCT CTG CTG GAT GAG ATG GCT GTC GTG 2403 Ser Pro Lys Pro Glu Trp Arg Ala Leu Leu Asp Glu Met Ala Val Val 705 710 715 GCT ACA AAG GAG TAC CGA TCG ATT GTC TTT CAG GAG CCG CGG TTT GTT 2451 Ala Thr Lys Glu Tyr Arg Ser Ile Val Phe Gl n Glu Pro Arg Phe Val 720 725 730 GAG TAC TTC CGC CTG GCA ACA CCC GAG ACA GAA TAT GGC AGG ATG AAC 2499 Glu Tyr Phe Arg Leu Ala Thr Pro Glu Thr Glu Tyr Gly Arg Met Asn 735 740 745 ATC GGG AGT AGG CCA TCA AAA AGG AAG CCT AGC GGG GGG ATA GAG AGT 2547 Ile Gly Ser Arg Pro Ser Lys Arg Lys Pro Ser Gly Gly Ile Glu Ser 750 755 760 TTA CGT GCA ATT CCG TGG ATA TTT GCG TGG ACC CAG ACG AGG TTC CAT 2595 Leu Arg Ala Ile Pro Trp Ile Phe Ala Trp Thr Gln Thr Arg Phe His 765 770 775 780 CTT CCT GTC TGG CTC GGT TTT GGT GCA GCA TTT AAG CAT ATC ATG GAA 2643 Leu Pro Val Trp Leu Gly Phe Gly Ala Ala Phe Lys His Ile Met Glu 785 790 795 AAG GAT AAG AAA AAT TTC CAG ACA CTC AGA GAG ATG TAC AAT GTG TGG 2691 Lys Asp Lys Lys Asn Phe Gln Thr Leu Arg Glu Met Tyr Asn Val Trp 800 805 810 CCG TTC TTT AGG GTC ACA ATT GAT TTG CTT GAG ATG GTT TTC GCA AAG 2739 Pro Phe Phe Arg Val Thr Ile Asp Leu Leu Glu Met Val Phe Ala Lys 815 820 825 GGA GAC CCT GGC ATA GCT GCT CTG TAT GAC AAA CTG CTG GTC TCC GAA 2787 Gly Asp Pro Gly Ile Ala Ala Leu Tyr Asp Lys Leu Leu Val Ser Glu 830 835 840 GAT TTA CTG CCA TTT GGT GAG CGA CTC AGA AAC AAC TAT GTT GAA ACA 2835 Asp Leu Leu Pro Phe Gly Glu Arg Leu Arg Asn Asn Tyr Val Glu Thr 845 850 855 860 AAG CGC CTC CTT CTG CAG GTC GCC GGG CAC AGG GAT CTC CTT GAA GGG 2883 Lys Arg Leu Leu Leu Gln Val Ala Gly His Arg Asp Leu Leu Glu Gly 865 870 875 GAC CCG TAT CTA AAG CAG AGA CTT CGC CTG CGT GAC GCC GCC GCC GCC ATA ACA 2931 Asp Pro Tyr Leu Lys Gln Arg Leu Arg Leu Arg Asp Ala Tyr Ile Thr 880 885 890 ACC CTG AAT GTG TGC CAA GCA TAC ACT CTG AAA CGC ATC AAA GAT CCC 2979 Thr Leu Asn Val Cys Gln Ala Tyr Thr Leu Lys Arg Ile Lys Asp Pro 895 900 905 ACC TAC AAC GTG AAC CTG AGG CCC CGC CTC TCC AAG GAC GTG ACC CAG 3027 Thr Tyr Asn Val Asn Leu Arg Pro Arg Leu Ser Lys Asp Val Thr Gln 910 915 920 CCG AGA AAG CCG GCT GCT GAG TTC CTG ACG CTG AAC CCA ACC AGC GAG 3075 Pro Arg Lys Pro Ala Ala Glu Phe Leu Thr Leu Asn Pro Thr Ser Glu 925 930 935 940 TAC GCG CCT GGG CTT GAG GAC ACG TTG ATC CTC ACC ATG AAG GGA ATC 3123 Tyr Ala Pro Gly Leu Glu Asp Thr Leu Ile Leu Thr Met Lys Gly Ile 945 950 955 GCT GCA GGC CTG CAA AAC ACG GGC TAGGTGTCGT ATCTATAAGT TTCTTTCTTC 3177 AlaGTlaGALY GAu Leu Gln Asn Thrn Gly 960 964 ATATAA AGAGGAGAGA GAGAAATAAA GGAGGGGGGG GGGGGCGGTT 3297 GTTGGTTGGG TTACATTAAG CTGCTTTTTG TGTTGTCCAT GTACTTATGA ACTTATGATA 3357 AATGTGCAAC TGGGCCTTGA GGTCTTCTAG CTTAAGAATA AATAATGAAA AGAGGATTGC 3417 AACAAAAAAAAAAAAAAAAAAAAAAAA

SEQ ID NO: 2 Sequence length: 23 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Sequence GGGAAGCAGG AGGTCATGAT CGG

SEQ ID NO: 3 Sequence length: 24 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Sequence GAAGTACTCG ACAAATCGAG GCTC

SEQ ID NO: 4 Sequence length: 450 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA Origin: Organism name: Aloe arborescens Tissue type : green leaves sequence: GGGAAGCAGG AGGTCATGAT CGGATACTCA GATTCCGGCA AGGACGCGGG CCGTCTCTCA 60 GCGGCTTGGC AGTTGTATAA AGCTCAGGAG GATATGGTGA AGGTCGCGAA GGAGTATGGG 120 GTGAAGCTGA CTATGTTTCA TGGACGAGGG GGGACTGTTG GGAGAGGAGG CGGACCTACT 180 CACCTGGCTC TTCTGTCTCA GCCGCCTGAC ACAATTAATG GATCAATTCG CGTTACAGTT 240 CAGGGAGAGG TTATTGAGCA GTCCTTCGGT GAGGAGCGCT TGTGCTTCAG AACTCTGCAG 300 CGGTACACAG CGGCTACTCT CGAGCATGGG ATGAACCCCC CGATTTCTCC GAAGCCTGAG 360 TGGCGCGCTC TGCTGGATGA GATGGCTGTC GTGGCTACAA AGGAGTACCG ATCGATTGTC 420 TTTCAGGAGC CTCGATTTGT CGAGTACTTC 450

SEQ ID NO: 5 Sequence length: 15 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Sequence CCCGGGTACC GAGCT

[Brief description of the drawings]

FIG. 1 is a diagram showing a restriction enzyme cleavage point map of the recombinant plasmid pAP39 obtained in Example 1 of the present invention.

FIG. 2 is an electrophoretic photograph showing the results of Northern analysis of total RNA of aloe green leaves, stems, and roots. In the figure, "Leaf" indicates the results of analysis of RNA samples extracted from leaves, "Shoot" indicates the analysis of RNA samples extracted from the stem, and "Root" indicates the analysis results of RNA samples extracted from the root. In the figure, the one indicated by A is P
Detected expression of EPCase cDNA, in the figure,
The one indicated by B shows the results obtained using the probes that detect 25S rRNA and 18S rRNA used as controls. The 25S rRNA and 18S rRNA shown in the figure indicate the positions corresponding to the sizes of the respective rRNAs detected in B in the figure and are size markers.

FIG. 3 is a diagram showing the structure of an insert fragment of PEPCase expression plasmid pPPC1 obtained in the example of the present invention.

FIG. 4 is a diagram showing the structure of an insert fragment of PEPCase expression plasmid pPPC101 obtained in the example of the present invention.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical indication C12N 9/88 C12N 5/00 C // (C12N 1/21 C12R 1:19) (C12N 5 / 10 C12R 1:91) (72) Inventor Tatsuto Fujimura 1144, Togo, Mobara-shi, Chiba Mitsui Toatsu Chemical Co., Ltd.

Claims (6)

[Claims] 1. An aloe PEPCase cDNA having the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing. 2. A DNA base sequence encoding the amino acid sequence shown in SEQ ID NO: 1 of the Sequence Listing. 3. A plasmid containing the DNA base sequence according to claim 2. 4. Microorganisms and cells transformed with the plasmid according to claim 3. 5. A method for increasing the PEPCase activity by introducing the plasmid according to claim 3 into a monocotyledonous plant. 6. A transformed plant having an increased PEPCase obtained by introducing the plasmid according to claim 3 into a monocotyledonous plant.