WO2001064733A1 - Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001064733A1
WO2001064733A1 PCT/CN2001/000259 CN0100259W WO0164733A1 WO 2001064733 A1 WO2001064733 A1 WO 2001064733A1 CN 0100259 W CN0100259 W CN 0100259W WO 0164733 A1 WO0164733 A1 WO 0164733A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
reverse transcription
human reverse
related factor
Prior art date
Application number
PCT/CN2001/000259
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Fudan University
Biodoor Gene Technology Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University, Biodoor Gene Technology Ltd. Shanghai filed Critical Fudan University
Priority to AU44061/01A priority Critical patent/AU4406101A/en
Publication of WO2001064733A1 publication Critical patent/WO2001064733A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human reverse transcription-related factor 22, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • the primate and rodent genomes contain a family with a highly repetitive, long, and alternating L1 family.
  • the sequence of this family is characterized by an A-rich sequence at the 3'-terminus and 5'- The ends are blunt-ended structures with a long open reading frame (ORFs) present.
  • ORFs long open reading frame
  • Members of the L1 family exist in different types of cells, including multifunctional embryonic cells. This proves that the L1 family originates from the same sequence-encoding protein and is distributed into the genome through an RNA-mediated process.
  • the L1 family is involved in the reverse transcription process. The reverse transcription starts at the 3'-terminus and ends at overlapping sites caused by complementary DNA inserts. It can be converted into cDNA through transcription and then inserted into a process similar to pseudogene processing In the chromosome.
  • the L1 factor is present on LRE2 on chromosome lq. Structurally, the L1 factor does not have long terminal repeats, and its 3'-terminal poly-A tail is special, and it is not constant on each L1 factor.
  • the proliferation process of the L1 factor includes transcription, reverse transcription, and reintegration into a new site on the genome.
  • the 5 'end of the L1 factor is mostly a blunt-end structure, which is different from the general sticky-end structure, but does not affect its transcription integration process.
  • the untranslated region (UTR) at the 5 'end contains an internal promoter that regulates and controls the speed of the entire reverse transcription process.
  • the LRE2 site contains two complete open reading frames (0RF1 and 0RF2).
  • the 0RF1 frame encodes an approximately 40Kd embryonic cancer cell protein.
  • the 0RF2 frame is sequenced with reverse transcriptase and other retroviral proteins. Similarity can mediate the process of reverse transcription. By experimentally removing the first 32Bp of the L1 factor, the product obtained can only show 20% of normal transcription efficiency.
  • the L1 family sequence contains an open reading frame, which is similar to RM virus-dependent DNA polymerases of some viruses. It further proves that the L1 family or its ancestors are related to reverse transcriptase. The protein it encodes is actually a Kind of reverse transcriptase.
  • the polypeptide of the present invention has 87% identity and 93% similarity with the above-mentioned L1 factor, and contains a conserved sequence characteristic of the L1 family. Therefore, this protein is considered to be a new L1 factor and has a role in reverse transcription.
  • Biological function and named human reverse transcription-related factor 22 As mentioned above, the human reverse transcription-related factor 22 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more involved in these Process of human reverse transcription-associated factor 22 protein, especially the amino acid sequence of this protein is identified.
  • Isolation of the novel human transcription factor 22 protein encoding gene also provides a basis for the study to determine the role of this protein in health and disease states.
  • This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human reverse transcription-related factor 22.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human reverse transcription-related factor 22.
  • Another object of the present invention is to provide a method for producing human reverse transcription-related factor 22.
  • Another object of the present invention is to provide an antibody against a human reverse transcription-related factor 22 of the polypeptide of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the human reverse transcription-related factor 22 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of human reverse transcription-related factor 22.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • the sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 1590-2 18 sequence of 3 positions; and (b) a sequence of positions 1-3079 in SEQ ID NO: 1.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human reverse transcription-related factor 22 protein, which comprises using the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of human reverse transcription-related factor 22 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human reverse transcription-related factor 22.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” means the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. Is missing.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human reverse transcription-related factor 22, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human reverse transcription-related factor 22.
  • an “antibody” or “inhibitor” refers to a molecule that, when combined with human reverse transcription-related factor 22, can block or regulate the biological or immunological activity of human reverse transcription-related factor 22.
  • Resistants and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human reverse transcription-related factor 22.
  • Regular refers to a change in the function of human reverse transcription-related factor 22, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human reverse transcription-related factor 22. change.
  • substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human reverse transcription-related factors 22 using standard protein purification techniques. Basic The pure human reverse transcription-related factor 22 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human reverse transcription-related factor 22 polypeptide can be analyzed by amino acid sequence
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. Inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences.
  • the percentage identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.).
  • the MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244).
  • the Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
  • sequence A and sequence B The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A Number of interval residues in a sequence B
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645) 0 "similarity" refers to the amino acid sequence The degree of identical or conservative substitutions of amino acid residues at corresponding positions when aligning between them.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human reverse transcription-related factor 22.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not Components of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human reverse transcription-related factor 22 means that human reverse transcription-related factor 22 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human reverse transcription-related factors 22 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human reverse transcription-related factor 22 peptide purity can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide-to-human reverse transcription-related factor 22, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human reverse transcription-related factor 22.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human reverse transcription-related factor 22 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such One, wherein the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • an additional amino acid sequence is fused into the mature polypeptide
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It packs The polynucleotide sequence is 3079 bases in length and its open reading frame 1 590-218 3 encodes 197 amino acids. According to the amino acid sequence homology comparison, it was found that the polypeptide has 87% homology with the L1 factor, and it can be deduced that the human reverse transcription-related factor 22 has a similar structure and function to the L1 factor.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DM forms include C DNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) A denaturant was added during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42.
  • hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 More than nucleotides.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human reverse transcription-related factor 22.
  • the polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • polynucleotide sequence encoding the human reverse transcription-related factor 22 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of transcripts of human reverse transcription-related factor 22; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human reverse transcription-related factor 22 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method for amplifying DNA / RM using PCR technology is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human reverse transcription-related factor 22 coding sequence, and a recombinant technology for producing the polypeptide of the present invention. method.
  • a polynucleotide sequence encoding the human reverse transcription-related factor 22 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human reverse transcription-related factor 22 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide for selection
  • selectable marker genes to provide for selection
  • the phenotypic traits of transformed host cells such as dihydrofolate reductase, neomycin resistance and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E. coli.
  • GFP green fluorescent protein
  • a polynucleotide encoding human reverse transcription-related factor 22 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S 2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes s melanoma cells Wait.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing iron can be harvested after the exponential growth phase and treated with CaC I using procedures well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human reverse transcription-related factor 22 (Scence, 1 984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high Performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high Performance liquid chromat
  • FIG. 1 is a comparison diagram of amino acid sequence homology of the reverse transcription-related factor 22 and L1 factor of the present inventor.
  • the upper sequence is human reverse transcription-related factor 22, and the lower sequence is L1 factor.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 1 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human reverse transcription-related factor 22 isolated. 22KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDNA cloning kit (purchased from Clontech) was used to orient the 00 ⁇ fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ , and the bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Eimer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the 0018bll clone contained a full-length cDNA of 3079bp (as shown in Seq IDN0: 1), and a 594bp open reading frame (0RF) from 1590bp to 2183bp, encoding a new protein (such as Seq ID NO: 2).
  • the protein sequences of the present invention is related to the reverse transcription factor sequence encoding 2 and 2 using Blast programs (Basiclocal Alignment search tool) [Altschul , SF et al J.Mol Biol.1990; 215: 403-10 ], To perform homology search in databases such as Genbank and Swissport.
  • the gene with the highest homology to the human reverse transcription-related factor 22 of the present invention is a known L1 factor, and the accession number of the encoded protein in Genbank is M803 44 .
  • the protein homology results are shown in Figure 1. The two are highly homologous, with 87% identity; 93% similarity.
  • Example 3 Cloning of a gene encoding human reverse transcription-related factor 22 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- TACACTTCCCAGCGTCTGGTAACC -3 '(SEQ ID NO: 3)
  • Primer2 5,-ATTATATTTTAAGTTTTAGGGTAC -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) and nitric acid to which RNA was transferred
  • the cellulose membrane is in a solution at 42. C hybridization overnight, the solution contains 50% formamide-25mM H 2 P0 (pH7.4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in lx SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human reverse transcription-related factor 22
  • Primer3 5-CCCGAATTCATGTGCTGCTGGATTCATATTTTA -3 '(Seq ID No: 5)
  • Primer4 5'- CCCCTCGAGTCAGATGAGCAGATTGCAAAAATT -3, (Seq ID No: 6)
  • the 5' ends of these two primers contain EcoRI and Xhol restriction sites, respectively, which The coding sequences of the 5 'and 3' ends of the target gene are followed, respectively.
  • the EcoRI and Xhol restriction sites correspond to the selective endonucleases on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3) Enzyme site.
  • the pBS-0018bll plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 contains 10 pg of pBS- 0018bll plasmid, primers Primer-3 and Primer- 4 points. ] Is lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. EcoRI and Xhol were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5 ⁇ using the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 g / mI), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0018bll) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host strain BL21 (pET-001Sbll) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to the final concentration lmmoL / L, and continued Incubate for 5 hours.
  • the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human reverse transcription-related factor 22-specific peptides:
  • NH2-Met-Cys-Cys-Trp-I le-Hi sI le-Leu-Leu-Arg-I le-Phe-A la-Leu-Met-C00H SEQ ID NO: 7
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods see: Avramea s, eta 1. I unochemi str, 1 969; 6:43. Rabbits were immunized with 4 mg of the above-mentioned jk cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Sou thern imprinting, Northern blotting, and copying methods, etc., all of which are used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of the probe size is 1 8-50 nucleotides; 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide are directly used in the treatment of diseases, for example, 3 ⁇ 4 treatment of evil: 3 ⁇ 4 tumor, adrenal deficiency, skin disease, various inflammations, HIV infection and immunity: 1 ⁇ 2 disease, etc. .
  • Humans have a base E group L1 family, and the L1 daughter is present on LRE2 of chromosome lq.
  • the protein encoded by the L1 family sequence is a reverse transcriptase-like enzyme.
  • LRE2 on mammalian chromosome lq participates in the reverse transcription process.
  • the proliferation process of LRE2 includes three processes: transcription, reverse transcription, and reintegration into a new site on the base E group. Insertion rearrangement at the LRE2 site caused some anomalies in the expression of ⁇ . Such as the development of muscular dystrophy (Duchenne muscular dystrophy).
  • the polypeptide of the present invention and the LIE subunit encoded by the L 1 family of the group E are homologous proteins, which contain the features of the L1 family, and both have similar biological functions. It also participates in the reverse transcription process in the body, and regulates the expression of certain base E. Its abnormal expression makes the regulation of related bases erroneous and produces related diseases.
  • the abnormal expression of the human reverse transcription-related E-substance 22 of the present invention will produce various diseases, especially muscular dystrophy, various tumors, embryonic developmental disorders, growth and development disorders: diseases, inflammation, immunity: diseases These diseases include, but are not limited to:
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
  • Fetal developmental disorders congenital miscarriage, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital: hydrocephalus, congenital: 1 ⁇ 2 glaucoma or cataract, congenital deafness
  • 1 ⁇ 2 diseases mental retardation, brain development disorders, skin, fat and muscle dysplasia: 1 ⁇ 2 diseases, bone and joint dysplasia: 1 ⁇ 2 diseases, various metabolic defects, stunting, dwarfism, Cushing Combining this sign, stunting
  • Inflammation Slow: active hepatitis, sarcoidosis, polymyositis, slow: rhinitis, slow gastritis, cerebral spinal cord Multiple sclerosis, Glomerulonephritis, Myocarditis. Cardiomyopathy, Atherosclerosis, Gastric ulcer, Cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • Abnormal expression of the human reverse transcription-associated factor 22 of the present invention will also produce certain hereditary, hematological diseases, and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially muscular dystrophy, various tumors, embryonic development disorders, and developmental disorders. Diseases, inflammation, immune diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human reverse transcription-related factor 22. Agonists enhance human reverse transcription-related factors 22 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human reverse transcription-related factor 22 can be cultured with labeled human reverse transcription-related factor 22 in the presence of drugs. The ability of the drug to increase or block this interaction is then measured.
  • Antagonists of human reverse transcription-related factor 22 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human reverse transcription-related factor 22 can bind to human reverse transcription-related factor 22 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
  • human reverse transcription-related factor 22 can be added to bioanalytical assays to determine whether the compound is Antagonist. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human reverse transcription-related factor 22 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human reverse transcription-related factor 22 molecules should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the human reverse transcription-related factor 22 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human reverse transcription-related factor 22 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
  • Techniques for preparing monoclonal antibodies to human reverse transcription-related factor 22 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). And existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against human reverse transcription-related factor 22.
  • Antibodies against human reverse transcription-related factor 22 can be used in immunohistochemical techniques to detect human reverse transcription-related factor 22 in biopsy specimens.
  • Monoclonal antibodies that bind to human reverse transcription-related factor 22 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human reverse transcription-related factors 22 High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human reverse transcription-related factor 22 positive cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human reverse transcription-related factor 22.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human reverse transcription-related factor 22.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting human reverse transcription-related factor 22 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the levels of human reverse transcription-related factor 22 detected in the test can be used to explain the importance of human reverse transcription-related factor 22 in various diseases and to diagnose diseases in which human reverse transcription-related factor 22 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human reverse transcription-related factor 22 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human reverse transcription-related factor 22.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human reverse transcription-related factor 22 to inhibit endogenous human reverse transcription-related factor 22 activity.
  • a variant human reverse transcription-associated factor 22 may be shortened and lack a signaling domain. Human reverse transcription-related factor 22, although it can bind to downstream substrates, lacks signal transduction activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human reverse transcription-related factor 22.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer a polynucleotide encoding human reverse transcription-related factor 22 into cells.
  • Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human reverse transcription-related factor 22 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human reverse transcription-related factor 11 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human reverse transcription-related factor 22 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length of the two hydrazones, and using phosphorothioate or peptide bonds instead of phosphodiester bonds for the linkage between ribonucleosides.
  • the polynucleotide encoding human reverse transcription-related factor 22 can be used for the diagnosis of diseases related to human reverse transcription-related factor 22.
  • the polynucleotide encoding human reverse transcription-related factor 22 can be used to detect the expression of human reverse transcription-related factor 22 or the abnormal expression of human reverse transcription-related factor 22 in a disease state.
  • a DNA sequence encoding human reverse transcription-related factor 22 can be used to hybridize biopsy specimens to determine the expression status of human reverse transcription-related factor 22.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
  • Human reverse transcription-related factor 22-specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human reverse transcription-related factor 22 transcription products.
  • Detection of mutations in the human reverse transcription-related factor 22 gene can also be used to diagnose human reverse transcription-related factor 22-related diseases.
  • Human reverse transcription-related factor 22 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human reverse transcription-related factor 22 DNA sequence. Available already Some techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization detect mutations. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be combined with Use in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of a polypeptide or antagonist and a carrier and excipients that do not affect the efficacy of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human reverse transcription-related factor 22 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human RT-related factor 22 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne un nouveau polypeptide, un facteur humain 22 lié à la transcription inverse, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des dystrophies musculaires, des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour le facteur humain 22 lié à la transcription inverse.
PCT/CN2001/000259 2000-02-29 2001-02-26 Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide WO2001064733A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU44061/01A AU4406101A (en) 2000-02-29 2001-02-26 A new polypeptide- human reverse transcription-related factor22 and the polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00111759A CN1311202A (zh) 2000-02-29 2000-02-29 一种新的多肽——人反转录相关因子22和编码这种多肽的多核苷酸
CN00111759.9 2000-02-29

Publications (1)

Publication Number Publication Date
WO2001064733A1 true WO2001064733A1 (fr) 2001-09-07

Family

ID=4581655

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000259 WO2001064733A1 (fr) 2000-02-29 2001-02-26 Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1311202A (fr)
AU (1) AU4406101A (fr)
WO (1) WO2001064733A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112251436A (zh) * 2012-01-27 2021-01-22 比奥马林技术公司 治疗杜兴型肌营养不良症和贝克型肌营养不良症的具有改善特性的rna调节性寡核苷酸

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HATTORI M. ET AL.: "L1 family of repetitive DNA sequences in primates may be derived from a sequence encoding a reverse transcriptase-related protein", NATURE, vol. 321, no. 6070, 1986, pages 625 - 628 *
SULSTON J.E. AND WATERSTON R.: "Toward a complete human genome sequence", GENOME RES., vol. 8, no. 11, 1998, pages 1097 - 1108 *

Also Published As

Publication number Publication date
CN1311202A (zh) 2001-09-05
AU4406101A (en) 2001-09-12

Similar Documents

Publication Publication Date Title
WO2002026973A1 (fr) Nouveau polypeptide, une ribonucleoproteine nucleaire heterogene humaine 32.01, et un polynucleotide codant ce polypeptide
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2001064733A1 (fr) Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001038521A1 (fr) Nouveau polypeptide, proteine humaine 42 de liaison au calcium, et polynucleotide codant pour ce polypeptide
WO2001049738A1 (fr) Nouveau polypeptide, proteine fkbp humaine 11, et polynucleotide codant pour ce polypeptide
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2001079279A1 (fr) Nouveau polypeptide, facteur humain associe au recepteur du facteur de necrose tumorale 16, et polynucleotide codant pour ce polypeptide
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2002033077A1 (fr) Nouveau polypeptide, une proteine de regulation 10.01 etant associee au developpement humain et polynucleotide la codant
WO2001055412A1 (fr) Nouveau polypeptide, phosphoenolpyruvate carboxylase 81, et polynucleotide codant pour ce polypeptide
WO2001081391A1 (fr) Nouveau polypeptide, proteine 29 semblable a g-beta, et polynucleotide codant pour ce polypeptide
WO2002004503A1 (fr) Nouveau polypeptide, proteine humaine 15 associee a la transcription inverse orf2 du facteur l1, et polynucleotide codant ce polypeptide
WO2001073068A1 (fr) Nouveau polypeptide, l1-12, et polynucleotide codant pour ce polypeptide
WO2001049724A1 (fr) Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide
WO2001046439A1 (fr) Nouveau polypeptide, proteine dnaj humaine 39, et polynucleotide codant pour ce polypeptide
WO2001046437A1 (fr) Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide
WO2001046441A1 (fr) Nouveau polypeptide, proteine humaine shc 43, et polynucleotide codant pour ce polypeptide
WO2001083776A1 (fr) Nouveau polypeptide, hormone de croissance humaine 11, et polynucleotide codant pour ce polypeptide
WO2002004631A1 (fr) Nouveau polypeptide, proteine 11 humaine associee a la transcription inverse orf2 du facteur l1, et polynucleotide codant ce polypeptide
WO2001081593A1 (fr) Nouveau polypeptide, proteine humaine 20 contenant un domaine a structure de boite de paires appariees, et polynucleotide codant pour ce polypeptide
WO2002012324A1 (fr) Nouveau polypeptide, proteine 13 humaine associee a la transcription inverse orf2 du facteur l1, et polynucleotide codant ce polypeptide
WO2001064867A1 (fr) Nouveau polypeptide, facteur humain 33 associe a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001046236A1 (fr) Nouveau polypeptide, protamine 45 humaine, et polynucleotide codant pour ce polypeptide
WO2001064728A1 (fr) Nouveau polypeptide, proteine kinase humaine 44 de la dystrophie myotonique, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: JP